Vibrio ichthyoenteri ATCC 700023 VII00023_1, whole genome shotgun [asmbl_id: NC_000000].4641086, GC%: 44.42%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1705070..705435 PHAGE_Vibrio_VEJphi: putative regulator protein; VII00023_02039; phage(gi238821381) 2e-34 Click
2complement(705464..705769) hypothetical protein; VII00023_02044 0.0 Click
3complement(705903..706454) hypothetical protein; VII00023_02049 0.0 Click
4complement(706863..708002) PHAGE_Vibrio_VEJphi: putative assembly protein; VII00023_02054; phage(gi238821380) 3e-124 Click
5complement(707999..708313) PHAGE_Vibrio_VEJphi: putative minor capsid protein; VII00023_02059; phage(gi238821379) 3e-32 Click
6complement(708315..709331) PHAGE_Vibrio_VEJphi: minor capsid protein; VII00023_02064; phage(gi238821378) 1e-74 Click
7complement(709791..709883) PHAGE_Vibrio_VEJphi: putative minor capsid protein; VII00023_02069; phage(gi238821377) 1e-06 Click
8complement(709896..710030) PHAGE_Vibrio_VEJphi: major capsid protein; VII00023_02074; phage(gi238821376) 7e-08 Click
9complement(710042..710284) PHAGE_Vibrio_VEJphi: putative minor capsid protein; VII00023_02079; phage(gi238821375) 9e-16 Click
10complement(710294..710608) PHAGE_Vibrio_VCY_phi: ssDNA-binding protein; VII00023_02084; phage(gi358356473) 6e-25 Click
11complement(710601..711869) PHAGE_Vibrio_VCY_phi: DNA replication initiation protein; VII00023_02089; phage(gi358356472) 2e-130 Click
12complement(711862..712086) PHAGE_Vibrio_VCY_phi: hypothetical protein; VII00023_02094; phage(gi358356471) 4e-13 Click
13complement(712086..712406) hypothetical protein; VII00023_02099 0.0 Click
14712634..713002 PHAGE_Vibrio_VEJphi: putative regulator protein; VII00023_02104; phage(gi238821382) 1e-20 Click
15complement(713174..713485) translation initiation factor Sui1; VII00023_02109 0.0 Click
16complement(713488..713862) hypothetical protein; VII00023_02114 0.0 Click
17713961..714917 PHAGE_Entero_P1: Cre; VII00023_02119; phage(gi46401628) 1e-11 Click

Region 2, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11760998..1761009 attL    TTTTTTTTAAGA 0.0 Click
21775720..1775767 attL    ATATGGCAGGGGTGGAGAGATTCGAACTCCCAACACGCGGATTTGGAA 0.0 Click
3complement(1775924..1776877) PHAGE_Erwini_ENT90: phage integrase family protein; VII00023_02874; phage(gi431810942) 8e-73 Click
4complement(1776917..1777213) PHAGE_Yersin_413C: gpC; VII00023_02879; phage(gi30065734) 8e-14 Click
51777312..1777527 hypothetical protein; VII00023_02884 0.0 Click
61777527..1777742 PHAGE_Vibrio_pYD21_A: hypothetical protein; VII00023_02889; phage(gi472340472) 9e-06 Click
71777745..1777918 hypothetical protein; VII00023_02894 0.0 Click
81777915..1778136 hypothetical protein; VII00023_02899 0.0 Click
91778133..1779926 PHAGE_Pseudo_PM2: putative replication initiation protein P12; VII00023_02904; phage(gi9632863) 5e-65 Click
101780040..1780246 hypothetical protein; VII00023_02909 0.0 Click
111780233..1780601 hypothetical protein; VII00023_02914 0.0 Click
121780602..1781057 hypothetical protein; VII00023_02919 0.0 Click
131781038..1781754 hypothetical protein; VII00023_02924 0.0 Click
141781887..1782012 hypothetical protein; VII00023_02929 0.0 Click
151782015..1782836 putative outer membrane receptor protein; VII00023_02934 0.0 Click
161782847..1783125 hypothetical protein; VII00023_02939 0.0 Click
171783135..1783317 hypothetical protein; VII00023_02944 0.0 Click
181783314..1783529 hypothetical protein; VII00023_02949 0.0 Click
191783696..1783896 hypothetical protein; VII00023_02954 0.0 Click
201783901..1784353 PHAGE_Pseudo_PM2: hypothetical protein PM2_17; VII00023_02959; phage(gi9632873) 1e-05 Click
211784353..1785084 hypothetical protein; VII00023_02964 0.0 Click
221785084..1785563 PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber protein; VII00023_02969; phage(gi422937566) 4e-15 Click
23complement(1786098..1786211) hypothetical protein; VII00023_02974 0.0 Click
241786377..1786796 PHAGE_Pseudo_PM2: structural protein P5; VII00023_02979; phage(gi9632875) 5e-24 Click
251786796..1786897 hypothetical protein; VII00023_02984 0.0 Click
261786905..1787246 PHAGE_Pelagi_HTVC011P: hypothetical protein; VII00023_02989; phage(gi460042350) 6e-07 Click
271787287..1787409 hypothetical protein; VII00023_02994 0.0 Click
281787402..1787530 hypothetical protein; VII00023_02999 0.0 Click
291787598..1787645 attR    ATATGGCAGGGGTGGAGAGATTCGAACTCCCAACACGCGGATTTGGAA 0.0 Click
30complement(1787601..1787677) tRNA 0.0 Click
31complement(1787713..1787789) tRNA 0.0 Click
32complement(1787882..1788505) PROPHAGE_Escher_MG1655: IS3 transposase B; VII00023_20070; phage(gi16128284) 4e-68 Click
331788506..1788979 PHAGE_Salmon_RE_2010: integrase; VII00023_05162; phage(gi418489683) 7e-47 Click
34complement(1789097..1790140) PHAGE_Staphy_42E: ORF012; VII00023_05167; phage(gi66395520) 4e-42 Click
351795551..1795562 attR    TTTTTTTTAAGA 0.0 Click

Region 3, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4219647..4220300) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0046; VII00023_20687; phage(gi89886027) 1e-27 Click
2complement(4220313..4220489) hypothetical protein; VII00023_20692 0.0 Click
3complement(4220503..4220688) hypothetical protein; VII00023_20697 0.0 Click
44220923..4221294 PHAGE_Vibrio_VfO3K6: Vpf121; VII00023_20702; phage(gi9635475) 2e-38 Click
5complement(4221321..4222652) PHAGE_Vibrio_fs2: putative maturation protein; VII00023_20707; phage(gi9630770) 6e-128 Click
6complement(4222673..4222861) hypothetical protein; VII00023_20712 0.0 Click
7complement(4222836..4223915) PHAGE_Vibrio_fs2: putative maturation protein; VII00023_20717; phage(gi9630769) 5e-127 Click
8complement(4223915..4224286) PHAGE_Vibrio_fs2: putative capsid protein; VII00023_20722; phage(gi9630768) 5e-33 Click
9complement(4224289..4225776) PHAGE_Vibrio_fs2: hypothetical protein fs-2_6; VII00023_20727; phage(gi9630767) 5e-60 Click
10complement(4225837..4226058) PHAGE_Vibrio_fs2: hypothetical protein fs-2_5; VII00023_20732; phage(gi9630766) 1e-10 Click
11complement(4226085..4226201) hypothetical protein; VII00023_20737 0.0 Click
12complement(4226201..4226320) hypothetical protein; VII00023_20742 0.0 Click
13complement(4226331..4226642) PHAGE_Vibrio_fs2: hypothetical protein fs-2_2; VII00023_20747; phage(gi9630763) 3e-11 Click
14complement(4226711..4228732) PHAGE_Vibrio_fs2: putative replication protein; VII00023_20752; phage(gi9630762) 6e-150 Click
15complement(4228732..4229019) hypothetical protein; VII00023_20757 0.0 Click
16complement(4229016..4229360) hypothetical protein; VII00023_20762 0.0 Click
174229613..4230980 PHAGE_Apoche_nucleopolyhedrovirus: GP37; VII00023_02244; phage(gi402502149) 7e-29 Click