Escherichia coli O104:H4 str. H112180283 CS1, whole genome shotgun [asmbl_id: NC_000000].5335863, GC%: 50.60%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1328634..329587 PHAGE_Cyanop_MED4_213: TalC; PP_00360; phage(gi472340344) 6e-12 Click
2329702..330289 molybdenum cofactor biosynthesis protein MogA [Shigella sonnei Ss046] gi|74310623|ref|YP_309042.1|; PP_00361 2e-105 Click
3complement(330324..330890) hypothetical protein SSON_0011 [Shigella sonnei Ss046] gi|74310624|ref|YP_309043.1|; PP_00362 1e-103 Click
4complement(331039..331752) hypothetical protein O3K_21485 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483812|ref|YP_006780961.1|; PP_00363 2e-130 Click
5complement(331778..332182) hypothetical protein ECW_m0013 [Escherichia coli W] gi|386607322|ref|YP_006122808.1|; PP_00364 6e-70 Click
6332559..334475 PHAGE_Bathyc_BpV1: hypothetical protein; PP_00365; phage(gi313768007) 2e-154 Click
7334564..335694 PHAGE_Cafete_BV_PW1: putative DnaJ/Hsp40; PP_00366; phage(gi310831116) 7e-47 Click
8335842..336045 PROPHAGE_Escher_MG1655: IS186 transposase; PP_00367; phage(gi90111427) 3e-31 Click
9336042..336638 PROPHAGE_Escher_MG1655: IS186 transposase; PP_00368; phage(gi90111427) 7e-97 Click
10complement(336832..336984) PHAGE_Entero_Min27: mokW; PP_00369; phage(gi170783687) 3e-16 Click

Region 2, total : 66 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11138117..1138131 attL    GCTTTTTTATACTAA 0.0 Click
2complement(1138205..1139275) PHAGE_Entero_lambda: integration protein; PP_01193; phage(gi9626273) 0.0 Click
3complement(1139511..1139678) PHAGE_Entero_lambda: hypothetical protein lambdap35; PP_01194; phage(gi19263393) 4e-28 Click
41139980..1140102 hypothetical protein EC55989_0757 [Escherichia coli 55989] gi|218694192|ref|YP_002401859.1|; PP_01195 6e-16 Click
51140374..1140523 hypothetical protein O3K_17790 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483083|ref|YP_006780232.1|; PP_01196 5e-22 Click
6complement(1141054..1141269) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_01197; phage(gi20065893) 2e-34 Click
7complement(1141346..1141459) PHAGE_Entero_lambda: hypothetical protein lambdap38; PP_01198; phage(gi9626278) 1e-13 Click
8complement(1141689..1142369) PHAGE_Entero_2008: putative exonuclease; PP_01199; phage(gi209427739) 7e-131 Click
9complement(1142366..1143151) PHAGE_Entero_lambda: bet; PP_01200; phage(gi9626281) 7e-151 Click
10complement(1143157..1143453) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_01201; phage(gi116222045) 3e-52 Click
11complement(1143529..1143735) PHAGE_Entero_HK225: Kil protein; PP_01202; phage(gi428782413) 6e-30 Click
12complement(1144333..1144947) PHAGE_Entero_ST104: CI; PP_01203; phage(gi46358671) 3e-89 Click
131145128..1145358 PHAGE_Escher_HK639: cro; PP_01204; phage(gi356870651) 2e-19 Click
141145428..1145967 PHAGE_Entero_mEp237: CII protein; PP_01205; phage(gi435439306) 3e-64 Click
151145964..1146983 PHAGE_Entero_lambda: DNA replication protein; PP_01206; phage(gi9626295) 1e-110 Click
161146980..1147681 PHAGE_Entero_lambda: DNA replication protein; PP_01207; phage(gi9626296) 1e-127 Click
171147678..1147980 PHAGE_Entero_lambda: ren exclusion protein; PP_01208; phage(gi9626297) 4e-42 Click
181148226..1149020 putative phage recombinase [Escherichia coli O104:H4 str. 2011C-3493] gi|407483066|ref|YP_006780215.1|; PP_01209 2e-147 Click
191149240..1149371 antirepressor protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407483065|ref|YP_006780214.1|; PP_01210 1e-16 Click
201149948..1150199 hypothetical protein O3K_17695 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483064|ref|YP_006780213.1|; PP_01211 7e-42 Click
211150394..1150849 PHAGE_Cronob_phiES15: hypothetical protein; PP_01212; phage(gi401817579) 3e-61 Click
221150849..1151019 PHAGE_Escher_HK639: NinE; PP_01213; phage(gi356870663) 6e-15 Click
231151012..1151302 PHAGE_Entero_mEp237: hypothetical protein; PP_01214; phage(gi435439317) 3e-48 Click
24complement(1151349..1151483) hypothetical; PP_01217 0.0 Click
251151484..1151660 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_01215; phage(gi435439318) 2e-23 Click
261151657..1151797 PHAGE_Entero_mEp237: hypothetical protein; PP_01216; phage(gi435439319) 5e-11 Click
271151883..1152266 PHAGE_Entero_2008: antitermination protein Q; PP_01218; phage(gi209427762) 5e-56 Click
28complement(1152455..1153537) outer membrane porin, DLP12 prophage [Escherichia coli O104:H4 str. 2011C-3493] gi|407483057|ref|YP_006780206.1|; PP_01219 0.0 Click
291154126..1154341 PHAGE_Stx2_c_II: holin; PP_01220; phage(gi302393164) 5e-28 Click
301154341..1154838 PHAGE_Entero_cdtI: lysin; PP_01221; phage(gi148609440) 1e-91 Click
311154835..1155272 PHAGE_Escher_HK75: Rz; PP_01222; phage(gi356870731) 8e-73 Click
321155477..1155998 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_01223; phage(gi399498859) 1e-100 Click
33complement(1156138..1156302) arginyl-tRNA synthetase [Escherichia coli O7:K1 str. CE10] gi|386622925|ref|YP_006142653.1|; PP_01224 2e-10 Click
34complement(1156805..1156924) hypothetical; PP_01225 0.0 Click
351157154..1157297 hypothetical protein ECIAI1_1590 [Escherichia coli IAI1] gi|218554109|ref|YP_002387022.1|; PP_01226 5e-19 Click
361157437..1157982 PHAGE_Entero_lambda: DNA packaging protein; PP_01227; phage(gi9626244) 4e-98 Click
371157957..1159081 PHAGE_Entero_lambda: DNA packaging protein; PP_01228; phage(gi9626245) 0.0 Click
381159147..1159524 PHAGE_Entero_lambda: DNA packaging protein; PP_01229; phage(gi9626245) 4e-69 Click
391159569..1159787 PHAGE_Entero_lambda: DNA packaging protein; PP_01230; phage(gi9626245) 7e-35 Click
401159784..1159990 PHAGE_Entero_lambda: head-tail joining protein; PP_01231; phage(gi9626246) 4e-32 Click
411159987..1161588 PHAGE_Entero_lambda: capsid component; PP_01232; phage(gi9626247) 0.0 Click
421161569..1162804 PHAGE_Entero_lambda: capsid component; PP_01233; phage(gi9626248) 0.0 Click
431162814..1163146 PHAGE_Entero_lambda: head-DNA stabilization protein; PP_01234; phage(gi9626250) 2e-57 Click
441163175..1164227 PHAGE_Entero_lambda: capsid component; PP_01235; phage(gi9626251) 0.0 Click
451164269..1164664 PHAGE_Entero_lambda: DNA packaging protein; PP_01236; phage(gi9626252) 2e-57 Click
461164676..1165029 PHAGE_Entero_lambda: head-tail joining protein; PP_01237; phage(gi9626253) 4e-61 Click
471165041..1165619 PHAGE_Entero_lambda: tail component; PP_01238; phage(gi9626254) 2e-101 Click
481165616..1166011 PHAGE_Entero_lambda: tail component; PP_01239; phage(gi9626255) 3e-71 Click
491166019..1166759 PHAGE_Entero_lambda: tail component; PP_01240; phage(gi9626256) 4e-135 Click
501166775..1167197 PHAGE_Entero_lambda: tail component; PP_01241; phage(gi9626257) 2e-63 Click
511167179..1167613 PHAGE_Entero_lambda: tail component; PP_01242; phage(gi9626258) 4e-81 Click
521167606..1170170 PHAGE_Entero_lambda: tail component; PP_01243; phage(gi9626259) 0.0 Click
531170234..1170497 PHAGE_Entero_lambda: tail component; PP_01244; phage(gi9626260) 1e-43 Click
541170497..1171195 PHAGE_Entero_lambda: tail component; PP_01245; phage(gi9626261) 4e-131 Click
551171344..1171943 PHAGE_Entero_lambda: tail component; PP_01246; phage(gi9626262) 4e-114 Click
561171907..1172512 PHAGE_Entero_lambda: tail component; PP_01247; phage(gi9626263) 3e-108 Click
571172573..1173001 PHAGE_Entero_lambda: tail:host specificity protein; PP_01248; phage(gi9626264) 1e-55 Click
581173012..1174277 PHAGE_Entero_lambda: tail:host specificity protein; PP_01249; phage(gi9626264) 0.0 Click
591174240..1176042 PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_01250; phage(gi148609400) 0.0 Click
601176113..1176712 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_01251; phage(gi148609401) 1e-112 Click
61complement(1177275..1178012) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01253; phage(gi9626267) 4e-55 Click
621178048..1178182 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_01252 1e-15 Click
631178143..1179624 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01254; phage(gi16129506) 1e-135 Click
641179605..1179853 PHAGE_Entero_lambda: Tail fiber; PP_01255; phage(gi9626268) 1e-27 Click
651179853..1180437 PHAGE_Entero_lambda: Putative fiber assembly protein; PP_01256; phage(gi9626269) 4e-106 Click
66complement(1180511..1181842) PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; PP_01257; phage(gi399529005) 3e-05 Click
671182483..1182497 attR    GCTTTTTTATACTAA 0.0 Click
68complement(1182588..1183064) kinase inhibitor protein [Shigella sonnei Ss046] gi|74311317|ref|YP_309736.1|; PP_01258 1e-91 Click
69complement(1183123..1184355) PHAGE_Mycoba_Myrna: gp183; PP_01259; phage(gi203454746) 2e-06 Click

Region 3, total : 76 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11443257..1443268 attL    ACCGCCTGCTTT 0.0 Click
2complement(1443394..1444623) PHAGE_Escher_P13374: phage integrase; PP_01533; phage(gi410491596) 0.0 Click
3complement(1444757..1445041) PHAGE_Escher_P13374: excisionase; PP_01534; phage(gi410491597) 1e-51 Click
4complement(1445087..1445338) PHAGE_Escher_TL_2011c: putative bacteriophage protein; PP_01535; phage(gi418487053) 4e-41 Click
5complement(1445703..1446056) PHAGE_Escher_P13374: hypothetical protein; PP_01536; phage(gi410491600) 3e-62 Click
6complement(1446092..1446304) PHAGE_Escher_P13374: hypothetical protein; PP_01537; phage(gi410491601) 1e-32 Click
7complement(1446264..1446890) PHAGE_Escher_P13374: methylase; PP_01538; phage(gi410491602) 2e-122 Click
8complement(1446887..1447243) PHAGE_Escher_P13374: regulatory protein; PP_01539; phage(gi410491603) 7e-63 Click
9complement(1447374..1448012) PHAGE_Escher_P13374: antirepressor antB; PP_01540; phage(gi410491605) 1e-120 Click
10complement(1448368..1449264) PHAGE_Escher_P13374: hypothetical protein; PP_01541; phage(gi410491607) 2e-174 Click
11complement(1449267..1449401) PHAGE_Escher_P13374: hypothetical protein; PP_01542; phage(gi410491608) 2e-17 Click
12complement(1449460..1449867) PHAGE_Escher_P13374: hypothetical protein; PP_01543; phage(gi410491609) 5e-73 Click
13complement(1449864..1450589) PHAGE_Escher_P13374: hypothetical protein; PP_01544; phage(gi410491610) 4e-132 Click
14complement(1450740..1451135) PHAGE_Escher_P13374: hypothetical protein; PP_01545; phage(gi410491611) 7e-72 Click
15complement(1451212..1452033) PHAGE_Escher_P13374: hypothetical protein; PP_01546; phage(gi410491612) 7e-152 Click
16complement(1452097..1452444) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01547; phage(gi418487086) 8e-62 Click
17complement(1452519..1453106) PHAGE_Escher_P13374: hypothetical protein; PP_01548; phage(gi410491615) 2e-110 Click
18complement(1453106..1453795) PHAGE_Escher_P13374: exonuclease; PP_01549; phage(gi410491616) 8e-135 Click
19complement(1453792..1454742) PHAGE_Escher_P13374: recombinase; PP_01550; phage(gi410491617) 0.0 Click
20complement(1454759..1455040) PHAGE_Escher_P13374: hypothetical protein; PP_01551; phage(gi410491618) 2e-50 Click
21complement(1455061..1455282) PHAGE_Escher_P13374: hypothetical protein; PP_01552; phage(gi410491619) 5e-37 Click
22complement(1455354..1455566) PHAGE_Escher_P13374: host killing protein; PP_01553; phage(gi410491620) 1e-34 Click
23complement(1455637..1456092) PHAGE_Escher_P13374: antitermination; PP_01554; phage(gi410491621) 1e-83 Click
24complement(1456567..1457340) PHAGE_Escher_P13374: regulatory protein; PP_01555; phage(gi410491624) 6e-145 Click
25complement(1457969..1458922) PHAGE_Escher_P13374: restriction endonuclease; PP_01556; phage(gi410491625) 0.0 Click
26complement(1458919..1460388) PHAGE_Escher_P13374: DNA methylase; PP_01557; phage(gi410491626) 0.0 Click
27complement(1460483..1461196) PHAGE_Escher_P13374: prophage repressor CI; PP_01558; phage(gi410491627) 2e-134 Click
281461292..1461495 PHAGE_Escher_P13374: cro repressor; PP_01559; phage(gi410491628) 2e-32 Click
291462273..1462404 PHAGE_Escher_P13374: hypothetical protein; PP_01560; phage(gi410491630) 2e-18 Click
301462398..1463918 PHAGE_Escher_P13374: helicase; PP_01561; phage(gi410491631) 0.0 Click
311463929..1464879 PHAGE_Escher_P13374: primase; PP_01562; phage(gi410491632) 0.0 Click
321464879..1465328 PHAGE_Escher_P13374: hypothetical protein; PP_01563; phage(gi410491633) 1e-84 Click
331465336..1465899 PHAGE_Escher_P13374: recombination endonuclease; PP_01564; phage(gi410491634) 2e-108 Click
341465896..1466090 PHAGE_Escher_P13374: hypothetical protein; PP_01565; phage(gi410491635) 2e-32 Click
351466083..1466517 PHAGE_Escher_P13374: antiterminator Q; PP_01566; phage(gi410491636) 1e-82 Click
361466766..1466918 PHAGE_Stx2_c_86: DNA modification methylase; PP_01567; phage(gi116222073) 8e-22 Click
371466959..1467034 tRNA 0.0 Click
381467044..1467120 tRNA 0.0 Click
391467134..1467210 tRNA 0.0 Click
401467301..1468260 PHAGE_Escher_P13374: shiga toxin 2 subunit A; PP_01568; phage(gi410491638) 0.0 Click
411468272..1468541 PHAGE_Escher_P13374: shiga toxin 2 subunit B; PP_01569; phage(gi410491639) 1e-46 Click
421469027..1470964 PHAGE_Escher_P13374: hypothetical protein; PP_01570; phage(gi410491642) 0.0 Click
431471101..1471280 PHAGE_Escher_P13374: hypothetical protein; PP_01571; phage(gi410491643) 2e-28 Click
441471321..1471566 PHAGE_Escher_P13374: hypothetical protein; PP_01572; phage(gi410491644) 6e-39 Click
451471644..1471859 PHAGE_Escher_P13374: lysis protein, holin; PP_01573; phage(gi410491645) 9e-35 Click
461471864..1472397 PHAGE_Escher_P13374: lysis protein, lysozyme; PP_01574; phage(gi410491646) 4e-103 Click
471472671..1473033 PHAGE_Escher_P13374: antirepressor; PP_01575; phage(gi410491647) 7e-63 Click
481473039..1473239 PHAGE_Escher_P13374: antirepressor; PP_01576; phage(gi410491647) 1e-31 Click
491473254..1473388 PHAGE_Escher_P13374: hypothetical protein; PP_01577; phage(gi410491648) 1e-17 Click
501473400..1473828 PHAGE_Escher_P13374: endopeptidase; PP_01578; phage(gi410491649) 8e-75 Click
511474031..1474582 PHAGE_Escher_P13374: regulatory protein; PP_01579; phage(gi410491650) 4e-103 Click
521474706..1474819 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; PP_01580; phage(gi20065959) 6e-17 Click
531474875..1475681 PHAGE_Escher_P13374: phage terminase small subunit; PP_01581; phage(gi410491651) 5e-151 Click
541475707..1477368 PHAGE_Escher_P13374: phage terminase large subunit; PP_01582; phage(gi410491652) 0.0 Click
551477368..1478288 PHAGE_Escher_P13374: phage portal protein; PP_01583; phage(gi410491653) 3e-166 Click
561478257..1478412 PHAGE_Escher_P13374: phage portal protein; PP_01584; phage(gi410491653) 9e-24 Click
571478442..1479515 PHAGE_Escher_P13374: phage portal protein; PP_01585; phage(gi410491653) 0.0 Click
581479673..1480680 PHAGE_Escher_P13374: hypothetical protein; PP_01586; phage(gi410491654) 0.0 Click
591480704..1481918 PHAGE_Escher_P13374: structural protein; PP_01587; phage(gi410491655) 0.0 Click
601481974..1482363 PHAGE_Escher_P13374: hypothetical protein; PP_01588; phage(gi410491656) 2e-66 Click
611482413..1482874 PHAGE_Escher_P13374: hypothetical protein; PP_01589; phage(gi410491657) 1e-82 Click
621482858..1483421 PHAGE_Escher_P13374: hypothetical protein; PP_01590; phage(gi410491658) 2e-104 Click
631483421..1484071 PHAGE_Escher_P13374: hypothetical protein; PP_01591; phage(gi410491659) 1e-122 Click
641484068..1484931 PHAGE_Stx2_c_II: putative tail fiber protein; PP_01592; phage(gi302393090) 1e-129 Click
651485045..1486259 PHAGE_Escher_P13374: phage tail fibre; PP_01593; phage(gi410491660) 0.0 Click
661486346..1486858 PHAGE_Escher_P13374: tail fibre adesine; PP_01594; phage(gi410491661) 2e-96 Click
671487026..1488717 PHAGE_Escher_TL_2011c: hypothetical protein; PP_01595; phage(gi418487111) 0.0 Click
681488714..1489982 PHAGE_Escher_P13374: phage tail fibre tip; PP_01596; phage(gi410491664) 0.0 Click
691490281..1490898 PHAGE_Escher_P13374: hypothetical protein; PP_01597; phage(gi410491665) 4e-122 Click
701490989..1491723 PHAGE_Escher_P13374: outer membrane lom precursor; PP_01598; phage(gi410491666) 4e-140 Click
711491956..1492096 PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_01599; phage(gi410491667) 1e-21 Click
721492177..1492554 PHAGE_Escher_P13374: hypothetical protein; PP_01600; phage(gi410491668) 1e-69 Click
731492648..1493304 PHAGE_Escher_P13374: hypothetical protein; PP_01601; phage(gi410491669) 5e-122 Click
741493307..1493753 PHAGE_Escher_P13374: hypothetical protein; PP_01602; phage(gi410491670) 1e-80 Click
751493763..1494014 PHAGE_Escher_P13374: hypothetical protein; PP_01603; phage(gi410491671) 2e-40 Click
761494025..1495290 PHAGE_Escher_P13374: hypothetical protein; PP_01604; phage(gi410491672) 0.0 Click
771495360..1503741 PHAGE_Escher_P13374: hypothetical protein; PP_01605; phage(gi410491673) 0.0 Click
78complement(1503807..1503923) PHAGE_Escher_P13374: hypothetical protein; PP_01606; phage(gi410491674) 1e-16 Click
791504673..1504846 Stress-induced protein, KGG, repeat [Shigella sonnei 53G] gi|383177657|ref|YP_005455662.1|; PP_01607 8e-27 Click
80complement(1504929..1506257) PHAGE_Lactob_KC5a: putative minor tail protein; PP_01608; phage(gi90592623) 6e-06 Click
811511985..1511996 attR    ACCGCCTGCTTT 0.0 Click

Region 4, total : 66 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11816356..1816378 attL    TGGTACATGGATATCGATACCAC 0.0 Click
2complement(1816515..1817645) PHAGE_Entero_HK630: integrase; PP_01979; phage(gi428782814) 8e-49 Click
3complement(1817936..1820407) PHAGE_Entero_mEp460: putative exonuclease; PP_01980; phage(gi428782342) 3e-56 Click
4complement(1820500..1820691) hypothetical protein NRG857_07890 [Escherichia coli O83:H1 str. NRG 857C] gi|387616914|ref|YP_006119936.1|; PP_01981 3e-29 Click
5complement(1820688..1820876) regulator of cell division encoded by prophage [Escherichia coli S88] gi|218558190|ref|YP_002391103.1|; PP_01982 2e-29 Click
61820905..1821075 hypothetical protein ECNA114_4765 [Escherichia coli NA114] gi|386622308|ref|YP_006141888.1|; PP_01983 6e-28 Click
71821503..1821637 hypothetical protein O3K_14335 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482404|ref|YP_006779553.1|; PP_01984 4e-17 Click
8complement(1821626..1821964) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01985; phage(gi418487085) 4e-08 Click
9complement(1821976..1822209) PHAGE_Salico_CGphi29: hypothetical protein; PP_01986; phage(gi472340166) 7e-10 Click
10complement(1822425..1822844) PHAGE_Entero_HK022: regulatory protein cI; PP_01987; phage(gi19343388) 3e-21 Click
111822924..1823178 PHAGE_Escher_HK75: regulatory protein cro; PP_01988; phage(gi356870715) 2e-18 Click
121823175..1823600 PHAGE_Escher_HK639: cII; PP_01989; phage(gi356870652) 3e-05 Click
131823623..1824585 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_01990; phage(gi18249881) 2e-33 Click
141824626..1825051 phage protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482397|ref|YP_006779546.1|; PP_01991 7e-74 Click
151825325..1825891 hypothetical protein CE10_1450 [Escherichia coli O7:K1 str. CE10] gi|386623816|ref|YP_006143544.1|; PP_01992 4e-111 Click
16complement(1826326..1826505) hypothetical protein O3K_14285 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482394|ref|YP_006779543.1|; PP_01993 6e-27 Click
171826726..1827772 PHAGE_Entero_mEp460: hypothetical protein; PP_01994; phage(gi428782365) 7e-111 Click
181827785..1828159 PHAGE_Escher_HK75: RusA-like protein; PP_01995; phage(gi356870726) 3e-37 Click
191828156..1828977 PHAGE_Entero_HK225: late gene regulator Q; PP_01996; phage(gi428782441) 2e-90 Click
201829204..1829401 PHAGE_Entero_phiP27: hypothetical protein P27p23; PP_01997; phage(gi18249887) 2e-30 Click
211829552..1830601 PHAGE_Entero_phiP27: putative DNA methylase; PP_01998; phage(gi18249888) 0.0 Click
221830651..1830726 tRNA 0.0 Click
231830734..1830809 tRNA 0.0 Click
241830823..1830899 tRNA 0.0 Click
251831399..1831530 hypothetical protein SDY_1443 [Shigella dysenteriae Sd197] gi|82776726|ref|YP_403075.1|; PP_01999 9e-18 Click
26complement(1831811..1831996) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; PP_02000; phage(gi209447168) 8e-22 Click
27complement(1832272..1832421) hypothetical protein i02_1307 [Escherichia coli str. 'clone D i2'] gi|386628791|ref|YP_006148511.1|; PP_02001 3e-19 Click
281832407..1834260 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; PP_02002; phage(gi116221995) 0.0 Click
291834420..1834626 PHAGE_Escher_P13374: lysis protein, holin; PP_02003; phage(gi410491645) 2e-33 Click
301834802..1835332 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; PP_02004; phage(gi116221997) 6e-93 Click
311835375..1835668 PHAGE_Entero_4795: putative R protein; PP_02005; phage(gi157166033) 9e-48 Click
321836008..1836139 PHAGE_Escher_P13374: hypothetical protein; PP_02006; phage(gi410491648) 5e-11 Click
331836142..1836258 hypothetical protein G2583_2456 [Escherichia coli O55:H7 str. CB9615] gi|291283181|ref|YP_003499999.1|; PP_02007 2e-12 Click
341836313..1836825 PHAGE_Entero_HK620: endopeptidase; PP_02008; phage(gi13559860) 5e-67 Click
351836822..1836965 PHAGE_Entero_mEp460: hypothetical protein; PP_02009; phage(gi428782374) 4e-21 Click
361837044..1837331 hypothetical protein O3K_14205 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482378|ref|YP_006779527.1|; PP_02010 2e-52 Click
371838016..1838189 hypothetical protein O3K_14195 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482376|ref|YP_006779525.1|; PP_02011 5e-24 Click
381838236..1838508 hypothetical protein O3K_14190 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482375|ref|YP_006779524.1|; PP_02012 6e-48 Click
391838590..1839138 PHAGE_Entero_HK630: terminase small subunit nu1; PP_02013; phage(gi428782788) 8e-51 Click
401839290..1840384 PHAGE_Entero_HK630: terminase large subunit A; PP_02014; phage(gi428782789) 2e-161 Click
411840348..1840482 DNA packaging protein of prophage [Shigella flexneri 5 str. 8401] gi|110806588|ref|YP_690108.1|; PP_02015 2e-05 Click
421840519..1840656 PHAGE_Entero_HK630: terminase large subunit A; PP_02016; phage(gi428782789) 4e-10 Click
431840643..1841041 PHAGE_Entero_HK630: terminase large subunit A; PP_02017; phage(gi428782789) 7e-35 Click
441841025..1841231 PHAGE_Entero_HK630: head-tail connector W; PP_02018; phage(gi428782790) 1e-11 Click
451841228..1842820 PHAGE_Entero_HK630: portal protein B; PP_02019; phage(gi428782791) 0.0 Click
461842810..1843373 PHAGE_Entero_HK630: head maturation protease C; PP_02020; phage(gi428782792) 1e-53 Click
471843373..1844317 PHAGE_Entero_HK630: head maturation protease C; PP_02021; phage(gi428782792) 9e-43 Click
481844354..1844701 PHAGE_Entero_HK630: head decoration protein D; PP_02022; phage(gi428782794) 1e-24 Click
491844759..1845787 PHAGE_Entero_HK630: major head subunit E; PP_02023; phage(gi428782795) 4e-114 Click
501845807..1846211 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; PP_02024; phage(gi169257229) 3e-11 Click
511846229..1846558 PHAGE_Entero_HK630: head-tail connector Fii; PP_02025; phage(gi428782797) 1e-38 Click
521846573..1847148 PHAGE_Entero_HK630: minor tail protein Z; PP_02026; phage(gi428782798) 8e-57 Click
531847145..1847540 PHAGE_Entero_HK630: minor tail protein U; PP_02027; phage(gi428782799) 8e-59 Click
541847548..1848300 PHAGE_Entero_HK630: major tail protein V; PP_02028; phage(gi428782800) 1e-111 Click
551848314..1848745 PHAGE_Entero_HK630: minor tail protein G; PP_02029; phage(gi428782801) 2e-45 Click
561848796..1849185 PHAGE_Entero_HK630: tail assembly protein GT; PP_02030; phage(gi428782802) 4e-43 Click
571849166..1850527 PHAGE_Entero_HK630: tail length tape measure protein H; PP_02031; phage(gi428782803) 0.0 Click
581850553..1850669 PHAGE_Entero_HK630: tail length tape measure protein H; PP_02032; phage(gi428782803) 5e-09 Click
591850653..1851195 PHAGE_Entero_HK630: tail component I; PP_02033; phage(gi428782807) 5e-76 Click
60complement(1851297..1851428) hypothetical; PP_02034 0.0 Click
611851482..1851607 hypothetical protein ECS88_1384 [Escherichia coli S88] gi|218558234|ref|YP_002391147.1|; PP_02035 5e-16 Click
621851674..1855153 PHAGE_Entero_HK630: tail fiber J; PP_02036; phage(gi428782808) 0.0 Click
631855235..1855366 outer membrane protein Lom [Escherichia coli O157:H7 str. TW14359] gi|254793960|ref|YP_003078797.1|; PP_02037 9e-05 Click
64complement(1856068..1856469) PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_02038; phage(gi399528893) 7e-06 Click
651856505..1856639 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_02039 5e-18 Click
661856600..1858405 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_02040; phage(gi16129506) 2e-103 Click
671858405..1858989 PHAGE_Entero_HK630: tail fiber assembly protein; PP_02041; phage(gi428782810) 3e-105 Click
68complement(1859044..1859217) hypothetical protein SSON_2178 [Shigella sonnei Ss046] gi|74312645|ref|YP_311064.1|; PP_02042 3e-25 Click
691859769..1860038 PHAGE_Entero_HK630: tail fiber assembly protein; PP_02043; phage(gi428782810) 2e-21 Click
701860153..1860323 PHAGE_Entero_phiP27: hypothetical protein P27p57; PP_02044; phage(gi18249921) 3e-10 Click
711860641..1860663 attR    TGGTACATGGATATCGATACCAC 0.0 Click

Region 5, total : 80 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12166348..2166983 PHAGE_Stx2_c_II: putative antirepressor protein AntB; PP_02390; phage(gi302393111) 2e-79 Click
2complement(2167010..2167132) hypothetical; PP_02391 0.0 Click
32167249..2167533 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; PP_02392; phage(gi302393109) 1e-40 Click
42167520..2168356 PHAGE_Entero_HK633: hypothetical protein; PP_02393; phage(gi428782552) 4e-60 Click
52167924..2167938 attL    CCAATGGCGGCCAGA 0.0 Click
62168358..2168873 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp06; PP_02394; phage(gi209447131) 1e-101 Click
72168870..2169373 PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp26; PP_02395; phage(gi221328643) 1e-31 Click
8complement(2169375..2169650) hypothetical protein O3K_12640 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482069|ref|YP_006779218.1|; PP_02396 2e-44 Click
9complement(2169774..2174060) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip050; PP_02397; phage(gi20065846) 0.0 Click
10complement(2174132..2178088) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp23; PP_02398; phage(gi302393103) 0.0 Click
11complement(2178157..2178639) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; PP_02400; phage(gi302393102) 3e-65 Click
122178655..2178801 hypothetical; PP_02399 0.0 Click
13complement(2178780..2179421) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; PP_02401; phage(gi302393102) 2e-80 Click
14complement(2179432..2179683) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; PP_02402; phage(gi302393101) 8e-36 Click
15complement(2179693..2179944) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; PP_02403; phage(gi302393100) 7e-35 Click
16complement(2179947..2180603) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; PP_02404; phage(gi302393099) 7e-119 Click
17complement(2180696..2181073) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; PP_02405; phage(gi302393098) 2e-64 Click
18complement(2181530..2182267) PHAGE_Stx2_c_II: outer membrane protein Lom precursor; PP_02406; phage(gi302393096) 4e-92 Click
19complement(2182347..2182964) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; PP_02407; phage(gi302393095) 3e-117 Click
20complement(2182970..2183248) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; PP_02408; phage(gi302393094) 5e-48 Click
21complement(2183263..2184252) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; PP_02409; phage(gi302393093) 0.0 Click
22complement(2184225..2185793) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; PP_02410; phage(gi302393092) 0.0 Click
23complement(2185819..2185932) hypothetical; PP_02411 0.0 Click
24complement(2186374..2186919) PHAGE_Salmon_SSU5: putative receptor-recognising phage tail fiber adhesin; PP_02412; phage(gi410491432) 4e-45 Click
25complement(2187002..2188909) PHAGE_Escher_P13374: phage tail fibre; PP_02413; phage(gi410491660) 0.0 Click
26complement(2188906..2189556) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; PP_02414; phage(gi302393089) 2e-111 Click
27complement(2189556..2190119) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; PP_02415; phage(gi302393088) 1e-82 Click
28complement(2190103..2190468) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; PP_02416; phage(gi302393087) 6e-57 Click
29complement(2190614..2191003) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; PP_02417; phage(gi302393086) 1e-64 Click
30complement(2191058..2192272) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; PP_02418; phage(gi302393085) 0.0 Click
31complement(2192295..2193302) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; PP_02419; phage(gi302393084) 1e-169 Click
32complement(2193460..2195604) PHAGE_Stx2_c_II: portal protein; PP_02420; phage(gi302393083) 0.0 Click
33complement(2195604..2196020) PHAGE_Stx2_c_II: terminase, large subunit; PP_02421; phage(gi302393082) 1e-78 Click
34complement(2196211..2196663) PHAGE_Stx2_c_II: terminase, large subunit; PP_02422; phage(gi302393082) 2e-74 Click
35complement(2196660..2197118) PHAGE_Stx2_c_II: terminase, large subunit; PP_02424; phage(gi302393082) 3e-61 Click
362197113..2197271 hypothetical; PP_02423 0.0 Click
37complement(2197291..2198106) PHAGE_Stx2_c_II: terminase, small subunit; PP_02425; phage(gi302393081) 5e-108 Click
38complement(2198748..2198867) hypothetical; PP_02426 0.0 Click
392199018..2199290 lipopolysaccharide core heptose(II)-phosphate phosphatase [Escherichia coli O104:H4 str. 2011C-3493] gi|407482045|ref|YP_006779194.1|; PP_02427 1e-47 Click
40complement(2199371..2199829) PHAGE_Entero_mEp235: lysis protein Rz; PP_02428; phage(gi428781868) 9e-59 Click
41complement(2199831..2199944) hypothetical protein ECO26_1133 [Escherichia coli O26:H11 str. 11368] gi|260854298|ref|YP_003228189.1|; PP_02429 4e-13 Click
42complement(2200165..2200698) PHAGE_Stx2_c_II: endolysin; PP_02430; phage(gi302393165) 3e-93 Click
43complement(2200703..2200918) PHAGE_Stx2_c_II: holin; PP_02431; phage(gi302393164) 7e-35 Click
44complement(2200995..2201240) PHAGE_Escher_P13374: hypothetical protein; PP_02432; phage(gi410491644) 2e-35 Click
45complement(2201266..2201448) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; PP_02433; phage(gi302393162) 1e-24 Click
46complement(2201587..2203497) PHAGE_Escher_P13374: hypothetical protein; PP_02434; phage(gi410491642) 0.0 Click
47complement(2204263..2204697) PHAGE_Stx2_c_II: antitermination protein Q; PP_02435; phage(gi302393156) 7e-82 Click
482204720..2204854 hypothetical; PP_02436 0.0 Click
49complement(2204884..2205246) PHAGE_Entero_HK542: Holliday-junction resolvase; PP_02437; phage(gi428783393) 2e-60 Click
50complement(2205243..2205536) PHAGE_Entero_HK629: hypothetical protein; PP_02438; phage(gi428782069) 1e-50 Click
51complement(2205745..2206155) PHAGE_Escher_HK75: NinB; PP_02439; phage(gi356870721) 8e-69 Click
52complement(2206210..2206881) PHAGE_Stx2_c_II: putative antirepressor-like protein; PP_02440; phage(gi302393152) 2e-52 Click
532207226..2207480 hypothetical protein O3K_12445 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482030|ref|YP_006779179.1|; PP_02441 9e-42 Click
542207588..2207905 DNA-binding protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482029|ref|YP_006779178.1|; PP_02442 5e-53 Click
55complement(2207956..2208441) bacteriophage protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482028|ref|YP_006779177.1|; PP_02443 8e-88 Click
56complement(2208460..2208639) bacteriophage protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482027|ref|YP_006779176.1|; PP_02444 3e-27 Click
57complement(2209250..2209399) hypothetical protein G2583_1713 [Escherichia coli O55:H7 str. CB9615] gi|291282458|ref|YP_003499276.1|; PP_02445 1e-18 Click
58complement(2209470..2210054) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp33; PP_02446; phage(gi302393116) 2e-11 Click
59complement(2210111..2210506) PHAGE_Entero_HK225: putative Ren exclusion protein; PP_02447; phage(gi428782427) 9e-05 Click
60complement(2210522..2211292) hypothetical protein O3K_12405 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482022|ref|YP_006779171.1|; PP_02448 1e-138 Click
61complement(2211318..2212058) PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_02449; phage(gi169257280) 1e-76 Click
62complement(2212102..2212491) PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_02450; phage(gi18249881) 2e-17 Click
63complement(2212541..2213032) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_02451; phage(gi423261989) 9e-18 Click
64complement(2213134..2213352) hypothetical protein O3K_12390 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482019|ref|YP_006779168.1|; PP_02452 7e-39 Click
65complement(2213367..2213663) PHAGE_Stx2_c_86: regulatory protein CII; PP_02453; phage(gi116222057) 4e-38 Click
66complement(2213802..2214002) PHAGE_Entero_HK544: Cro protein; PP_02454; phage(gi428783258) 3e-31 Click
672214103..2214816 PHAGE_Entero_mEp234: prophage repressor; PP_02455; phage(gi428782293) 4e-134 Click
682215233..2215406 hypothetical protein O3K_12370 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482015|ref|YP_006779164.1|; PP_02456 4e-28 Click
692215575..2216171 hypothetical protein O3K_12365 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482014|ref|YP_006779163.1|; PP_02457 1e-106 Click
70complement(2216313..2216438) hypothetical; PP_02458 0.0 Click
712216666..2217049 PHAGE_Stx2_c_I: N protein; PP_02459; phage(gi20065909) 2e-67 Click
722217053..2217766 PHAGE_Entero_phiP27: hypothetical protein P27p20; PP_02460; phage(gi18249884) 3e-08 Click
732217798..2218157 PHAGE_Cronob_phiES15: hypothetical protein; PP_02461; phage(gi401817573) 2e-06 Click
74complement(2218126..2218335) hypothetical protein O3K_12345 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482010|ref|YP_006779159.1|; PP_02462 7e-32 Click
752218792..2219013 PHAGE_Escher_P13374: host killing protein; PP_02463; phage(gi410491620) 6e-05 Click
762219097..2219483 hypothetical protein O3K_12335 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482008|ref|YP_006779157.1|; PP_02464 3e-69 Click
772219591..2221663 PHAGE_Salmon_SPN3UB: RecE; PP_02465; phage(gi423262421) 8e-56 Click
782221660..2222751 PHAGE_Stx2_c_II: recombination protein Bet; PP_02466; phage(gi302393129) 5e-144 Click
792222748..2223428 PHAGE_Stx2_c_II: exonuclease; PP_02467; phage(gi302393128) 1e-129 Click
802223476..2223727 PHAGE_Escher_TL_2011c: putative bacteriophage protein; PP_02468; phage(gi418487053) 2e-39 Click
812223989..2225152 PHAGE_Salmon_epsilon34: Tyrosine integrase; PP_02469; phage(gi221328640) 5e-180 Click
822239497..2239511 attR    CCAATGGCGGCCAGA 0.0 Click

Region 6, total : 56 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12356678..2356693 attL    AAAGAAAAAAGGCCGC 0.0 Click
2complement(2357215..2357439) PHAGE_Yersin_413C: Int; PP_02616; phage(gi30065733) 5e-24 Click
3complement(2357405..2358190) PHAGE_Yersin_413C: Int; PP_02617; phage(gi30065733) 4e-50 Click
42358688..2358921 DNA-binding protein [Escherichia coli O26:H11 str. 11368] gi|260855537|ref|YP_003229428.1|; PP_02618 1e-36 Click
52358936..2359274 hypothetical protein O3K_11650 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481872|ref|YP_006779021.1|; PP_02619 6e-60 Click
62359285..2359572 hypothetical protein O3K_11645 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481871|ref|YP_006779020.1|; PP_02620 7e-47 Click
72359584..2359826 hypothetical protein SSON53_08345 [Shigella sonnei 53G] gi|383178214|ref|YP_005456219.1|; PP_02621 1e-38 Click
82359823..2359936 hypothetical protein O3K_11635 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481869|ref|YP_006779018.1|; PP_02622 5e-13 Click
92360025..2360345 hypothetical protein O3K_11630 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481868|ref|YP_006779017.1|; PP_02623 6e-53 Click
102360335..2360538 hypothetical protein O3K_11625 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481867|ref|YP_006779016.1|; PP_02624 2e-31 Click
112360535..2360780 hypothetical protein O3K_11620 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481866|ref|YP_006779015.1|; PP_02625 6e-41 Click
122360777..2361076 PHAGE_Entero_mEp213: hypothetical protein; PP_02626; phage(gi428782624) 4e-08 Click
132361399..2361629 hypothetical protein O3K_11610 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481864|ref|YP_006779013.1|; PP_02627 7e-36 Click
142361732..2362091 hypothetical protein O3K_11605 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481863|ref|YP_006779012.1|; PP_02628 6e-65 Click
152362088..2364592 PHAGE_Yersin_413C: gpA; PP_02629; phage(gi30065742) 3e-78 Click
162364724..2364927 replication protein for prophage CP-933T [Shigella sonnei 53G] gi|383178209|ref|YP_005456214.1|; PP_02630 6e-30 Click
172365004..2365963 prophage stability/partitioning protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481861|ref|YP_006779010.1|; PP_02631 0.0 Click
182365968..2366282 stability/partitioning protein phage encoded [Escherichia coli O104:H4 str. 2011C-3493] gi|407481860|ref|YP_006779009.1|; PP_02632 1e-53 Click
192366302..2366733 PHAGE_Salmon_ST64B: hypothetical protein sb31; PP_02633; phage(gi23505475) 3e-14 Click
202366735..2366998 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_02634; phage(gi399498823) 3e-23 Click
212367313..2367441 hypothetical protein ECOK1_2572 [Escherichia coli IHE3034] gi|386600215|ref|YP_006101721.1|; PP_02635 4e-14 Click
22complement(2367510..2368556) PHAGE_Erwini_ENT90: phage portal protein; PP_02636; phage(gi431810941) 7e-92 Click
23complement(2368556..2369863) PHAGE_Ralsto_phiRSA1: terminase; PP_02637; phage(gi145708080) 3e-106 Click
24complement(2369905..2370312) PHAGE_Yersin_413C: gpP; PP_02638; phage(gi30065706) 2e-22 Click
252370467..2371303 PHAGE_Salmon_RE_2010: capsid scaffolding protein; PP_02639; phage(gi418489698) 6e-45 Click
262371327..2372379 PHAGE_Yersin_413C: gpN; PP_02640; phage(gi30065708) 1e-71 Click
272372425..2373225 PHAGE_Ralsto_phiRSA1: terminase; PP_02641; phage(gi145708083) 6e-36 Click
282373327..2373821 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); PP_02642; phage(gi134288689) 1e-25 Click
292373821..2374021 PHAGE_Yersin_413C: gpX; PP_02643; phage(gi30065711) 1e-10 Click
302374024..2374347 PHAGE_Aeromo_phiO18P: putative holin; PP_02644; phage(gi148727161) 1e-09 Click
312374344..2374736 PHAGE_Entero_phiP27: putative endolysin; PP_02645; phage(gi18249894) 1e-52 Click
322374733..2375107 hypothetical protein O3K_11530 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481848|ref|YP_006778997.1|; PP_02646 2e-51 Click
332375278..2377158 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_02647; phage(gi209427766) 0.0 Click
342377266..2377649 PHAGE_Yersin_413C: gpR; PP_02648; phage(gi30065716) 8e-12 Click
352377633..2378070 PHAGE_Yersin_413C: gpS; PP_02649; phage(gi30065717) 6e-06 Click
362378100..2378279 PHAGE_Ralsto_phiRSA1: tail completion protein gpS; PP_02650; phage(gi145708091) 1e-05 Click
372378276..2378722 PHAGE_Salmon_RE_2010: baseplate assembly protein V; PP_02651; phage(gi418489709) 4e-22 Click
382378742..2378858 PHAGE_Yersin_413C: gpV; PP_02652; phage(gi30065718) 1e-05 Click
392378855..2379205 PHAGE_Yersin_413C: gpW; PP_02653; phage(gi30065719) 3e-21 Click
402379209..2380105 PHAGE_Yersin_413C: gpJ; PP_02654; phage(gi30065720) 9e-85 Click
412380137..2380628 PHAGE_Yersin_413C: gpI; PP_02655; phage(gi30065721) 4e-60 Click
422380631..2382763 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_02656; phage(gi16129506) 3e-132 Click
432382763..2383341 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_02657; phage(gi16129505) 2e-99 Click
44complement(2383385..2383957) acetyltransferase [Escherichia coli O104:H4 str. 2011C-3493] gi|407481838|ref|YP_006778987.1|; PP_02658 9e-108 Click
45complement(2384114..2384602) PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_02659; phage(gi29143763) 1e-38 Click
46complement(2384615..2387422) PHAGE_Yersin_413C: gpT; PP_02660; phage(gi30065729) 4e-108 Click
47complement(2387409..2387537) PHAGE_Yersin_413C: gpE+E'; PP_02661; phage(gi30065728) 2e-06 Click
48complement(2387573..2387938) PHAGE_Burkho_phiE202: gp28, phage tail protein E; PP_02662; phage(gi134288780) 5e-06 Click
49complement(2387993..2388505) PROPHAGE_Salmon_Ty2: major tail tube protein; PP_02663; phage(gi29143759) 4e-35 Click
50complement(2388505..2389689) PHAGE_Erwini_ENT90: tail sheath protein; PP_02664; phage(gi431810939) 3e-101 Click
51complement(2389686..2389826) hypothetical; PP_02665 0.0 Click
522389847..2390956 PHAGE_Yersin_413C: gpD; PP_02666; phage(gi30065731) 4e-94 Click
53complement(2391048..2392217) hypothetical protein O3K_11440 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481830|ref|YP_006778979.1|; PP_02667 0.0 Click
542392475..2393455 PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_02668; phage(gi16129935) 0.0 Click
552393649..2393909 PHAGE_Yersin_413C: Ogr; PP_02669; phage(gi30065732) 6e-07 Click
562394100..2394240 PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_02670; phage(gi410491667) 1e-15 Click
572394500..2394515 attR    AAAGAAAAAAGGCCGC 0.0 Click
58complement(2394542..2394850) PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; PP_02671; phage(gi9630187) 5e-15 Click

Region 7, total : 76 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12537904..2537916 attL    TGCCGGATGCGGC 0.0 Click
2complement(2547430..2549202) PHAGE_Acanth_moumouvirus: asparaginyl t-RNA synthetase; PP_02851; phage(gi441432571) 3e-07 Click
32549512..2550078 hydrolase [Escherichia coli O104:H4 str. 2011C-3493] gi|407481665|ref|YP_006778814.1|; PP_02852 6e-104 Click
4complement(2550161..2550337) PHAGE_Entero_phiP27: hypothetical protein P27p58; PP_02853; phage(gi18249922) 9e-13 Click
52550434..2550682 PHAGE_Entero_mEp460: DinI-like protein; PP_02854; phage(gi428782337) 1e-41 Click
62550835..2550948 hypothetical; PP_02855 0.0 Click
72550945..2551145 hypothetical; PP_02856 0.0 Click
8complement(2551221..2551829) PHAGE_Entero_phiP27: hypothetical protein P27p57; PP_02857; phage(gi18249921) 4e-26 Click
9complement(2552449..2553375) PHAGE_Stx2_c_1717: putative tail fiber protein; PP_02858; phage(gi209447198) 8e-137 Click
10complement(2553448..2553633) PHAGE_Entero_mEp460: Lom protein; PP_02859; phage(gi428782335) 2e-08 Click
11complement(2553641..2553946) PHAGE_Entero_mEp460: Lom protein; PP_02860; phage(gi428782335) 6e-28 Click
12complement(2553976..2557371) PHAGE_Entero_mEp460: host specificity protein; PP_02861; phage(gi428782334) 0.0 Click
13complement(2557432..2559537) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; PP_02862; phage(gi15832203) 0.0 Click
14complement(2559518..2559907) PROPHAGE_Escher_Sakai: putative minor tail protein; PP_02863; phage(gi15832204) 2e-40 Click
15complement(2559958..2560380) PROPHAGE_Escher_Sakai: putative minor tail protein; PP_02864; phage(gi15832205) 4e-74 Click
16complement(2560394..2561146) PHAGE_Entero_HK630: major tail protein V; PP_02865; phage(gi428782800) 1e-112 Click
17complement(2561154..2561549) PHAGE_Entero_HK630: minor tail protein U; PP_02866; phage(gi428782799) 8e-59 Click
18complement(2561546..2562121) PHAGE_Entero_HK630: minor tail protein Z; PP_02867; phage(gi428782798) 3e-58 Click
19complement(2562136..2562489) PHAGE_Entero_HK630: head-tail connector Fii; PP_02868; phage(gi428782797) 2e-43 Click
20complement(2562482..2562601) putative DNA packaging protein [Escherichia coli O111:H- str. 11128] gi|260868581|ref|YP_003234983.1|; PP_02869 9e-15 Click
21complement(2562661..2562795) hypothetical protein i02_1327 [Escherichia coli str. 'clone D i2'] gi|386628811|ref|YP_006148531.1|; PP_02870 2e-05 Click
22complement(2562917..2563945) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; PP_02871; phage(gi169257230) 2e-176 Click
23complement(2564003..2564350) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; PP_02872; phage(gi169257231) 5e-43 Click
24complement(2564387..2565670) PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; PP_02873; phage(gi169257232) 1e-151 Click
25complement(2565667..2565891) PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; PP_02874; phage(gi169257232) 3e-15 Click
26complement(2565881..2567428) PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; PP_02875; phage(gi169257233) 0.0 Click
27complement(2567471..2567677) PHAGE_Entero_mEp237: head-tail connector; PP_02876; phage(gi435439268) 1e-13 Click
28complement(2567661..2568134) PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; PP_02877; phage(gi169257235) 3e-61 Click
29complement(2568247..2569404) PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; PP_02878; phage(gi169257235) 0.0 Click
30complement(2569565..2570113) PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; PP_02879; phage(gi169257236) 4e-66 Click
31complement(2570209..2570352) prophage Qin DNA packaging protein NU1-like protein [Escherichia coli APEC O1] gi|117623496|ref|YP_852409.1|; PP_02880 2e-16 Click
322570378..2570491 hypothetical protein O3K_10465 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481639|ref|YP_006778788.1|; PP_02881 4e-13 Click
332570567..2570692 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_02882; phage(gi209427772) 4e-08 Click
34complement(2570825..2570965) hypothetical protein ECS88_0566 [Escherichia coli S88] gi|218557476|ref|YP_002390389.1|; PP_02883 2e-18 Click
35complement(2571052..2571174) hypothetical protein CE10_1466 [Escherichia coli O7:K1 str. CE10] gi|386623829|ref|YP_006143557.1|; PP_02884 9e-15 Click
36complement(2571316..2571846) PHAGE_Entero_4795: putative endopeptidase Rz; PP_02885; phage(gi157166036) 5e-69 Click
37complement(2571861..2572007) hypothetical protein O3K_10440 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481634|ref|YP_006778783.1|; PP_02886 1e-18 Click
38complement(2572200..2572733) PHAGE_Entero_mEp460: endolysin; PP_02887; phage(gi428782372) 6e-99 Click
392572862..2573176 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; PP_02888; phage(gi116221998) 1e-57 Click
40complement(2573186..2573992) PHAGE_Entero_mEp460: hypothetical protein; PP_02889; phage(gi428782371) 5e-19 Click
41complement(2573997..2574212) PHAGE_Stx2_c_II: holin; PP_02890; phage(gi302393164) 1e-34 Click
42complement(2574363..2576216) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_02891; phage(gi209427766) 0.0 Click
432576598..2576777 hypothetical; PP_02892 0.0 Click
44complement(2576707..2576783) tRNA 0.0 Click
45complement(2576797..2576873) tRNA 0.0 Click
46complement(2576883..2576958) tRNA 0.0 Click
47complement(2577008..2578057) PHAGE_Entero_mEp460: DNA methylase; PP_02893; phage(gi428782369) 2e-175 Click
482578141..2578278 hypothetical; PP_02894 0.0 Click
492578676..2579602 hypothetical protein O3K_10400 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481626|ref|YP_006778775.1|; PP_02895 4e-176 Click
502579589..2580146 hypothetical protein O3K_10395 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481625|ref|YP_006778774.1|; PP_02896 7e-99 Click
51complement(2580149..2580490) PHAGE_Entero_cdtI: antitermination protein Q; PP_02897; phage(gi148609434) 6e-34 Click
52complement(2580508..2581497) PHAGE_Entero_mEp460: hypothetical protein; PP_02898; phage(gi428782365) 0.0 Click
53complement(2581505..2582182) PHAGE_Entero_mEp460: KilA-N domain protein; PP_02899; phage(gi428782364) 9e-86 Click
54complement(2582367..2582762) PHAGE_Entero_mEp460: holliday junction resolvase; PP_02900; phage(gi428782363) 1e-67 Click
55complement(2582759..2583085) PHAGE_Entero_mEp460: LexA DNA binding domain protein; PP_02901; phage(gi428782362) 3e-55 Click
56complement(2583082..2583735) PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; PP_02902; phage(gi428782361) 4e-126 Click
57complement(2583735..2584121) PHAGE_Entero_mEp460: hypothetical protein; PP_02903; phage(gi428782360) 7e-58 Click
58complement(2584118..2584930) PHAGE_Entero_mEp460: replication protein; PP_02904; phage(gi428782359) 9e-155 Click
59complement(2584933..2585157) PHAGE_Entero_mEp460: hypothetical protein; PP_02905; phage(gi428782358) 4e-38 Click
60complement(2585154..2586299) PHAGE_Entero_mEp460: regulatory protein Rha; PP_02906; phage(gi428782357) 2e-173 Click
61complement(2586296..2586853) PHAGE_Entero_mEp460: hypothetical protein; PP_02907; phage(gi428782356) 2e-95 Click
62complement(2586846..2587106) PHAGE_Entero_mEp460: putative antirepressor Cro; PP_02908; phage(gi428782355) 2e-43 Click
632587249..2587896 PHAGE_Entero_mEp460: prophage repressor; PP_02909; phage(gi428782354) 2e-118 Click
642588599..2588961 PHAGE_Entero_mEp460: hypothetical protein; PP_02910; phage(gi428782351) 2e-59 Click
652589027..2589176 PHAGE_Entero_mEp460: hypothetical protein; PP_02911; phage(gi428782350) 2e-20 Click
662589287..2589850 PHAGE_Entero_mEp460: hypothetical protein; PP_02912; phage(gi428782350) 2e-100 Click
672589978..2590514 PHAGE_Entero_mEp460: hypothetical protein; PP_02913; phage(gi428782349) 1e-100 Click
682590526..2590867 PHAGE_Entero_mEp460: hypothetical protein; PP_02914; phage(gi428782348) 7e-64 Click
692590864..2591067 PHAGE_Entero_mEp460: hypothetical protein; PP_02915; phage(gi428782347) 1e-33 Click
702591060..2591299 PHAGE_Entero_mEp460: hypothetical protein; PP_02916; phage(gi428782346) 1e-35 Click
712591296..2591844 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp07; PP_02917; phage(gi209447132) 4e-61 Click
722591846..2592361 PHAGE_Escher_TL_2011c: hypothetical protein; PP_02918; phage(gi418487082) 1e-99 Click
732592358..2593116 PHAGE_Escher_P13374: hypothetical protein; PP_02919; phage(gi410491607) 3e-110 Click
742593300..2593443 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; PP_02920; phage(gi157165989) 9e-16 Click
75complement(2593420..2593569) hypothetical; PP_02921 0.0 Click
762593602..2593838 PHAGE_Entero_phiP27: putative excisionase; PP_02922; phage(gi18249866) 9e-42 Click
772593894..2595204 PHAGE_Entero_phiP27: putative integrase; PP_02923; phage(gi18249865) 0.0 Click
782595231..2595956 hypothetical protein ECBD_1770 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773175|ref|YP_003036006.1|; PP_02924 5e-141 Click
792596009..2596404 hypothetical protein ECO26_2721 [Escherichia coli O26:H11 str. 11368] gi|260855809|ref|YP_003229700.1|; PP_02925 3e-71 Click
802596445..2597188 PHAGE_Synech_S_CRM01: methyltransferase domain-containing protein; PP_02926; phage(gi333798309) 1e-24 Click
812598171..2598183 attR    TGCCGGATGCGGC 0.0 Click

Region 8, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12659136..2659148 attL    TGCTGATTATGGA 0.0 Click
2complement(2673719..2674414) PHAGE_Marseillevirus: metal dependent phosphohydrolase; PP_03031; phage(gi284504106) 2e-06 Click
3complement(2674454..2674756) inner membrane protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481510|ref|YP_006778659.1|; PP_03032 1e-53 Click
42674871..2675005 hypothetical; PP_03033 0.0 Click
52675384..2675776 Outer membrane protein N [Escherichia coli P12b] gi|386704253|ref|YP_006168100.1|; PP_03034 4e-60 Click
62675770..2676444 porin [Escherichia coli KO11FL] gi|378712599|ref|YP_005277492.1|; PP_03035 3e-128 Click
7complement(2676766..2677917) PROPHAGE_Escher_MG1655: IS30 transposase; PP_03036; phage(gi16132105) 0.0 Click
82678279..2678503 PROPHAGE_Escher_CFT073: transposase insF; PP_03037; phage(gi26249410) 1e-38 Click
9complement(2679009..2679386) PHAGE_Entero_P1: InsB; PP_03038; phage(gi46401642) 4e-70 Click
10complement(2679431..2679658) PHAGE_Entero_P1: InsA; PP_03039; phage(gi46401643) 3e-39 Click
112679838..2680575 chaperone protein HchA [Escherichia coli O104:H4 str. 2011C-3493] gi|407481503|ref|YP_006778652.1|; PP_03040 1e-142 Click
12complement(2680673..2682031) PHAGE_Ectoca_1: EsV-1-65; PP_03041; phage(gi13242537) 7e-08 Click
13complement(2682031..2682813) PHAGE_Ectoca_1: EsV-1-65; PP_03042; phage(gi13242537) 2e-06 Click
142682835..2683248 hypothetical protein SSON_2029 [Shigella sonnei Ss046] gi|74312509|ref|YP_310928.1|; PP_03043 4e-74 Click
152683357..2684361 sulfite oxidase subunit YedY [Escherichia coli O26:H11 str. 11368] gi|260855940|ref|YP_003229831.1|; PP_03044 0.0 Click
162684362..2684997 sulfite oxidase subunit YedZ [Escherichia coli O26:H11 str. 11368] gi|260855941|ref|YP_003229832.1|; PP_03045 6e-117 Click
172685254..2685904 zinc/cadmium-binding protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481497|ref|YP_006778646.1|; PP_03046 6e-125 Click
18complement(2686291..2686443) hypothetical protein ETEC_0313 [Escherichia coli ETEC H10407] gi|387610787|ref|YP_006113903.1|; PP_03047 4e-16 Click
19complement(2686574..2686663) tRNA 0.0 Click
202686757..2687554 DgsA anti-repressor MtfA [Escherichia coli O104:H4 str. 2011C-3493] gi|407481496|ref|YP_006778645.1|; PP_03048 1e-154 Click
212687655..2687730 tRNA 0.0 Click
222687892..2689154 PROPHAGE_Escher_CFT073: prophage P4 integrase; PP_03049; phage(gi26248270) 0.0 Click
232697363..2697375 attR    TGCTGATTATGGA 0.0 Click

Region 9, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3009816..3011360) PHAGE_Yersin_phiR1_37: DNA-gyrase A-subunit; PP_03376; phage(gi358356812) 9e-31 Click
2complement(3011344..3011685) PHAGE_Cyanop_S_TIM5: DNA gyrase subunit A; PP_03377; phage(gi422936149) 8e-14 Click
3complement(3011666..3011884) DNA gyrase subunit A [Shigella sonnei Ss046] gi|74312751|ref|YP_311170.1|; PP_03378 6e-20 Click
4complement(3011987..3012160) DNA gyrase subunit A [Yersinia pseudotuberculosis YPIII] gi|170025070|ref|YP_001721575.1|; PP_03379 4e-16 Click
53012307..3013029 PHAGE_Microm_12T: hypothetical protein; PP_03380; phage(gi472342811) 2e-08 Click
6complement(3013157..3016897) PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_03381; phage(gi414087138) 2e-14 Click
73017588..3017881 PHAGE_Synech_S_ShM2: ribonucleotide reductase class Ia alpha subunit; PP_03382; phage(gi326782457) 5e-24 Click
83017913..3018275 PHAGE_Synech_S_ShM2: ribonucleotide reductase class Ia alpha subunit; PP_03383; phage(gi326782457) 6e-31 Click
93018285..3019868 PHAGE_Salmon_SSU5: putative ribonucleotide-diphosphate reductase, alpha subunit; PP_03384; phage(gi410491488) 0.0 Click
103019957..3021087 PHAGE_Salmon_SSU5: putative ribonucleotide-diphosphate reductase, beta subunit; PP_03385; phage(gi410491489) 4e-125 Click
113021087..3021341 PHAGE_Pseudo_OBP: putative 2Fe-2S ferredoxin; PP_03386; phage(gi371671579) 3e-25 Click
12complement(3021395..3022045) hypothetical protein ECBD_1423 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253772840|ref|YP_003035671.1|; PP_03387 3e-125 Click
13complement(3022125..3022241) hypothetical; PP_03388 0.0 Click
14complement(3022378..3022578) PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_03389; phage(gi16131377) 2e-30 Click
15complement(3022560..3023279) PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_03390; phage(gi16131377) 8e-109 Click
163023459..3023665 hypothetical protein O3K_08285 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481213|ref|YP_006778362.1|; PP_03391 4e-31 Click
17complement(3023707..3024783) PHAGE_Staphy_JD007: glycerophosphoryl diester phosphodiesterase; PP_03392; phage(gi428783010) 4e-10 Click

Region 10, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13132603..3132618 attL    TTGCAGGTTCGATTCC 0.0 Click
23132794..3133951 PHAGE_Entero_HK620: integrase; PP_03508; phage(gi13559824) 0.0 Click
33134180..3136090 PHAGE_Salmon_c341: O-polysaccharide acetyltransferase protein; PP_03509; phage(gi255252697) 5e-65 Click
4complement(3136161..3138140) PHAGE_Entero_HK620: tail spike protein; PP_03510; phage(gi13559880) 6e-59 Click
5complement(3138241..3139119) PHAGE_Salmon_vB_SemP_Emek: antirepressor; PP_03511; phage(gi399498814) 6e-96 Click
6complement(3139182..3139346) hypothetical; PP_03512 0.0 Click
7complement(3139352..3139492) PHAGE_Salmon_vB_SemP_Emek: Arc; PP_03513; phage(gi399498812) 2e-05 Click
83139846..3140160 hypothetical protein O3K_07725 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481103|ref|YP_006778252.1|; PP_03514 7e-53 Click
93140186..3140671 lipoprotein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481102|ref|YP_006778251.1|; PP_03515 6e-86 Click
10complement(3140686..3142530) PHAGE_Entero_P22: injection protein; PP_03516; phage(gi51236731) 0.0 Click
11complement(3142530..3143996) PHAGE_Bacter_2: injection gp20; PP_03517; phage(gi212499730) 1e-152 Click
12complement(3144006..3144698) PHAGE_Entero_HK620: DNA transfer protein; PP_03518; phage(gi13559875) 1e-113 Click
13complement(3144701..3145156) PHAGE_Entero_HK620: head assembly protein; PP_03519; phage(gi13559874) 7e-86 Click
14complement(3145156..3146004) PHAGE_Entero_HK620: DNA stabilization protein; PP_03520; phage(gi13559873) 7e-38 Click
15complement(3146004..3147422) PHAGE_Entero_HK620: DNA stabilization protein; PP_03521; phage(gi13559872) 0.0 Click
16complement(3147431..3147913) PHAGE_Entero_HK620: DNA stabilization protein; PP_03522; phage(gi13559871) 1e-88 Click
17complement(3147888..3148073) PHAGE_Entero_HK620: hypothetical protein HK620p47; PP_03523; phage(gi13559870) 7e-29 Click
18complement(3148116..3149387) PHAGE_Entero_HK620: capsid protein; PP_03524; phage(gi13559869) 0.0 Click
19complement(3149399..3150283) PHAGE_Entero_HK620: scaffold protein; PP_03525; phage(gi13559868) 3e-166 Click
20complement(3150297..3152423) PHAGE_Entero_HK620: portal protein; PP_03526; phage(gi13559867) 0.0 Click
21complement(3152426..3153838) PHAGE_Entero_HK620: terminase large subunit; PP_03527; phage(gi13559866) 0.0 Click
22complement(3153835..3154275) PHAGE_Riemer_RAP44: hypothetical protein; PP_03528; phage(gi418489899) 2e-29 Click
23complement(3154278..3154520) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_03529; phage(gi399498861) 6e-39 Click
24complement(3154826..3155020) PROPHAGE_Escher_MG1655: IS1 transposase B; PP_03530; phage(gi16131317) 1e-29 Click
25complement(3155065..3155292) PHAGE_Entero_P1: InsA; PP_03531; phage(gi46401643) 5e-40 Click
263155686..3155838 PHAGE_Escher_HK75: kil protein; PP_03532; phage(gi356870711) 4e-23 Click
273155914..3156084 PHAGE_Entero_mEp234: hypothetical protein; PP_03533; phage(gi428782284) 2e-26 Click
283156095..3156700 PHAGE_Entero_HK542: essential recombination function protein; PP_03534; phage(gi428783375) 3e-112 Click
293156700..3157083 PHAGE_Entero_HK542: hypothetical protein; PP_03535; phage(gi428783374) 8e-68 Click
303157107..3157403 PHAGE_Entero_HK620: hypothetical protein HK620p10; PP_03536; phage(gi13559833) 2e-52 Click
313157414..3157704 PHAGE_Entero_HK446: hypothetical protein; PP_03537; phage(gi428782222) 9e-48 Click
323157701..3157868 PHAGE_Entero_HK620: hypothetical protein HK620p09; PP_03538; phage(gi13559832) 3e-24 Click
333157865..3158536 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; PP_03539; phage(gi89152464) 4e-85 Click
343159105..3159734 PHAGE_Entero_HK620: hypothetical protein HK620p05; PP_03540; phage(gi13559828) 2e-57 Click
353159831..3160010 PHAGE_Entero_HK620: hypothetical protein HK620p04; PP_03541; phage(gi13559827) 3e-31 Click
363160107..3160122 attR    TTGCAGGTTCGATTCC 0.0 Click
373160142..3160342 PHAGE_Entero_HK620: hypothetical protein HK620p03; PP_03542; phage(gi13559826) 3e-34 Click