Tetrathiobacter kashmirensis WT001 TKWG_2, whole genome shotgun [asmbl_id: NC_000000].4427528, GC%: 54.76%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13514175..3515755 PHAGE_Synech_S_CBS3: group 2 RNA polymerase sigma factor; PP_03790; phage(gi331028036) 3e-37 Click
23515913..3515989 tRNA 0.0 Click
33516090..3516120 attL    ATGGAAAAGTAGGGCGTTGTTTTTAGGATAA 0.0 Click
4complement(3516578..3516823) phage protein DNA packaging protein [Advenella kashmirensis WT001] gi|389872351|ref|YP_006379770.1|; PP_03791 4e-39 Click
5complement(3516846..3517169) PHAGE_Geobac_E2: putative head-tail adaptor; PP_03792; phage(gi148747735) 1e-13 Click
6complement(3517355..3518857) PHAGE_Escher_HK75: terminase large subunit; PP_03793; phage(gi356870679) 0.0 Click
7complement(3518854..3519315) PHAGE_Escher_HK75: terminase small subunit; PP_03794; phage(gi356870678) 4e-19 Click
8complement(3519302..3519415) hypothetical; PP_03795 0.0 Click
9complement(3519730..3520887) PHAGE_Klebsi_phiKO2: putative portal protein; PP_03796; phage(gi46402090) 7e-51 Click
10complement(3520884..3521408) PHAGE_Entero_EFRM31: prohead protease; PP_03797; phage(gi327198114) 4e-28 Click
11complement(3521421..3522620) PHAGE_Synech_S_CBS3: major capsid protein; PP_03798; phage(gi331028011) 8e-42 Click
12complement(3522876..3523076) hypothetical protein TKWG_13290 [Advenella kashmirensis WT001] gi|389872345|ref|YP_006379764.1|; PP_03799 1e-32 Click
133523763..3523888 hypothetical; PP_03800 0.0 Click
14complement(3523863..3524063) PHAGE_Stenot_S1: putative repressor protein; PP_03801; phage(gi213163928) 5e-05 Click
15complement(3524176..3524880) hypothetical protein TKWG_13270 [Advenella kashmirensis WT001] gi|389872341|ref|YP_006379760.1|; PP_03802 1e-131 Click
16complement(3524981..3525139) hypothetical; PP_03803 0.0 Click
17complement(3525463..3526761) PHAGE_Erwini_PEp14: putative integrase; PP_03804; phage(gi374531881) 6e-17 Click
183526824..3526836 attL    GGTTACCCTTTGG 0.0 Click
193526919..3526999 tRNA 0.0 Click
20complement(3527036..3527314) PHAGE_Escher_HK75: phage integrase family protein; PP_03805; phage(gi356870702) 4e-19 Click
213537628..3537640 attR    GGTTACCCTTTGG 0.0 Click
223537664..3537694 attR    ATGGAAAAGTAGGGCGTTGTTTTTAGGATAA 0.0 Click