Escherichia coli O104:H4 str. H112180280 s whole [asmbl_id: NC_000000].5381621, GC%: 50.63%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 61 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11145466..1145480 attL    GCTTTTTTATACTAA 0.0 Click
2complement(1145554..1146624) PHAGE_Entero_lambda: integration protein; PP_01118; phage(gi9626273) 0.0 Click
3complement(1146860..1147027) PHAGE_Entero_lambda: hypothetical protein lambdap35; PP_01119; phage(gi19263393) 4e-28 Click
41147329..1147451 hypothetical protein EC55989_0757 [Escherichia coli 55989] gi|218694192|ref|YP_002401859.1|; PP_01120 6e-16 Click
51147723..1147872 hypothetical protein O3K_17790 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483083|ref|YP_006780232.1|; PP_01121 5e-22 Click
6complement(1148403..1148618) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_01122; phage(gi20065893) 2e-34 Click
7complement(1148695..1148808) PHAGE_Entero_lambda: hypothetical protein lambdap38; PP_01123; phage(gi9626278) 1e-13 Click
8complement(1149038..1149718) PHAGE_Entero_2008: putative exonuclease; PP_01124; phage(gi209427739) 7e-131 Click
9complement(1149715..1150500) PHAGE_Entero_lambda: bet; PP_01125; phage(gi9626281) 7e-151 Click
10complement(1150506..1150802) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_01126; phage(gi116222045) 3e-52 Click
11complement(1150878..1151084) PHAGE_Entero_HK225: Kil protein; PP_01127; phage(gi428782413) 6e-30 Click
12complement(1151682..1152296) PHAGE_Entero_ST104: CI; PP_01128; phage(gi46358671) 3e-89 Click
131152477..1152707 PHAGE_Escher_HK639: cro; PP_01129; phage(gi356870651) 2e-19 Click
141152777..1153316 PHAGE_Entero_mEp237: CII protein; PP_01130; phage(gi435439306) 3e-64 Click
151153313..1154332 PHAGE_Entero_lambda: DNA replication protein; PP_01131; phage(gi9626295) 1e-110 Click
161154329..1155030 PHAGE_Entero_lambda: DNA replication protein; PP_01132; phage(gi9626296) 1e-127 Click
171155027..1155329 PHAGE_Entero_lambda: ren exclusion protein; PP_01133; phage(gi9626297) 4e-42 Click
181155575..1156369 putative phage recombinase [Escherichia coli O104:H4 str. 2011C-3493] gi|407483066|ref|YP_006780215.1|; PP_01134 2e-147 Click
191157297..1157548 hypothetical protein O3K_17695 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483064|ref|YP_006780213.1|; PP_01135 7e-42 Click
201157743..1158198 PHAGE_Cronob_phiES15: hypothetical protein; PP_01136; phage(gi401817579) 3e-61 Click
211158198..1158368 PHAGE_Escher_HK639: NinE; PP_01137; phage(gi356870663) 6e-15 Click
221158361..1158651 PHAGE_Entero_mEp237: hypothetical protein; PP_01138; phage(gi435439317) 3e-48 Click
231158782..1159009 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_01139; phage(gi435439318) 7e-34 Click
241159006..1159146 PHAGE_Entero_mEp237: hypothetical protein; PP_01140; phage(gi435439319) 5e-11 Click
251159232..1159615 PHAGE_Entero_2008: antitermination protein Q; PP_01141; phage(gi209427762) 5e-56 Click
26complement(1159804..1160886) outer membrane porin, DLP12 prophage [Escherichia coli O104:H4 str. 2011C-3493] gi|407483057|ref|YP_006780206.1|; PP_01142 0.0 Click
271161475..1161690 PHAGE_Stx2_c_II: holin; PP_01143; phage(gi302393164) 5e-28 Click
281161690..1162187 PHAGE_Entero_cdtI: lysin; PP_01144; phage(gi148609440) 1e-91 Click
291162184..1162621 PHAGE_Escher_HK75: Rz; PP_01145; phage(gi356870731) 8e-73 Click
301162826..1163347 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_01146; phage(gi399498859) 1e-100 Click
31complement(1164164..1164337) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_01147; phage(gi209427772) 3e-10 Click
321164503..1164646 hypothetical protein ECIAI1_1590 [Escherichia coli IAI1] gi|218554109|ref|YP_002387022.1|; PP_01148 5e-19 Click
331164786..1165331 PHAGE_Entero_lambda: DNA packaging protein; PP_01149; phage(gi9626244) 4e-98 Click
341165306..1166967 PHAGE_Entero_lambda: DNA packaging protein; PP_01150; phage(gi9626245) 0.0 Click
351167012..1167230 PHAGE_Entero_lambda: DNA packaging protein; PP_01151; phage(gi9626245) 7e-35 Click
361167227..1167433 PHAGE_Entero_lambda: head-tail joining protein; PP_01152; phage(gi9626246) 4e-32 Click
371167430..1169031 PHAGE_Entero_lambda: capsid component; PP_01153; phage(gi9626247) 0.0 Click
381169012..1170331 PHAGE_Entero_lambda: capsid component; PP_01154; phage(gi9626248) 0.0 Click
391170341..1170673 PHAGE_Entero_lambda: head-DNA stabilization protein; PP_01155; phage(gi9626250) 2e-57 Click
401170729..1171754 PHAGE_Entero_lambda: capsid component; PP_01156; phage(gi9626251) 0.0 Click
411171796..1172191 PHAGE_Entero_lambda: DNA packaging protein; PP_01157; phage(gi9626252) 2e-57 Click
421172203..1172556 PHAGE_Entero_lambda: head-tail joining protein; PP_01158; phage(gi9626253) 4e-61 Click
431172568..1173146 PHAGE_Entero_lambda: tail component; PP_01159; phage(gi9626254) 2e-101 Click
441173143..1173538 PHAGE_Entero_lambda: tail component; PP_01160; phage(gi9626255) 3e-71 Click
451173546..1174286 PHAGE_Entero_lambda: tail component; PP_01161; phage(gi9626256) 4e-135 Click
461174302..1174724 PHAGE_Entero_lambda: tail component; PP_01162; phage(gi9626257) 2e-63 Click
471174706..1175140 PHAGE_Entero_lambda: tail component; PP_01163; phage(gi9626258) 4e-81 Click
481175133..1177694 PHAGE_Entero_lambda: tail component; PP_01164; phage(gi9626259) 0.0 Click
491177691..1178020 PHAGE_Entero_lambda: tail component; PP_01165; phage(gi9626260) 4e-60 Click
501178020..1178718 PHAGE_Entero_lambda: tail component; PP_01166; phage(gi9626261) 7e-134 Click
511178868..1179467 PHAGE_Entero_lambda: tail component; PP_01167; phage(gi9626262) 1e-116 Click
521179464..1180036 PHAGE_Entero_lambda: tail component; PP_01168; phage(gi9626263) 2e-101 Click
531180097..1183594 PHAGE_Entero_lambda: tail:host specificity protein; PP_01169; phage(gi9626264) 0.0 Click
541183665..1184264 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_01170; phage(gi148609401) 1e-112 Click
55complement(1184265..1184438) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; PP_01171; phage(gi157166059) 7e-29 Click
56complement(1184826..1185623) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01173; phage(gi9626267) 5e-55 Click
571185599..1185733 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_01172 1e-15 Click
581185694..1187403 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01174; phage(gi16129506) 0.0 Click
591187403..1187987 PHAGE_Entero_lambda: Putative fiber assembly protein; PP_01175; phage(gi9626269) 4e-106 Click
60complement(1188061..1189392) PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; PP_01176; phage(gi399529005) 3e-05 Click
611190033..1190047 attR    GCTTTTTTATACTAA 0.0 Click
62complement(1190138..1190614) kinase inhibitor protein [Shigella sonnei Ss046] gi|74311317|ref|YP_309736.1|; PP_01177 1e-91 Click
63complement(1190673..1191905) PHAGE_Mycoba_Myrna: gp183; PP_01178; phage(gi203454746) 2e-06 Click

Region 2, total : 72 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11452768..1452779 attL    ACCGCCTGCTTT 0.0 Click
2complement(1452905..1454215) PHAGE_Escher_P13374: phage integrase; PP_01419; phage(gi410491596) 0.0 Click
3complement(1454268..1454552) PHAGE_Escher_P13374: excisionase; PP_01420; phage(gi410491597) 1e-51 Click
4complement(1454598..1454849) PHAGE_Escher_TL_2011c: putative bacteriophage protein; PP_01421; phage(gi418487053) 4e-41 Click
5complement(1455214..1455567) PHAGE_Escher_P13374: hypothetical protein; PP_01422; phage(gi410491600) 3e-62 Click
6complement(1455603..1455815) PHAGE_Escher_P13374: hypothetical protein; PP_01423; phage(gi410491601) 1e-32 Click
7complement(1455775..1456401) PHAGE_Escher_P13374: methylase; PP_01424; phage(gi410491602) 2e-122 Click
8complement(1456398..1456754) PHAGE_Escher_P13374: regulatory protein; PP_01425; phage(gi410491603) 7e-63 Click
9complement(1456885..1457523) PHAGE_Escher_P13374: antirepressor antB; PP_01426; phage(gi410491605) 1e-120 Click
10complement(1457879..1458775) PHAGE_Escher_P13374: hypothetical protein; PP_01427; phage(gi410491607) 2e-174 Click
11complement(1458778..1458912) PHAGE_Escher_P13374: hypothetical protein; PP_01428; phage(gi410491608) 2e-17 Click
12complement(1458971..1459378) PHAGE_Escher_P13374: hypothetical protein; PP_01429; phage(gi410491609) 5e-73 Click
13complement(1459375..1460100) PHAGE_Escher_P13374: hypothetical protein; PP_01430; phage(gi410491610) 4e-132 Click
14complement(1460251..1460646) PHAGE_Escher_P13374: hypothetical protein; PP_01431; phage(gi410491611) 7e-72 Click
15complement(1460723..1461544) PHAGE_Escher_P13374: hypothetical protein; PP_01432; phage(gi410491612) 7e-152 Click
16complement(1461608..1461955) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01433; phage(gi418487086) 8e-62 Click
17complement(1462030..1462617) PHAGE_Escher_P13374: hypothetical protein; PP_01434; phage(gi410491615) 2e-110 Click
18complement(1462617..1463306) PHAGE_Escher_P13374: exonuclease; PP_01435; phage(gi410491616) 8e-135 Click
19complement(1463303..1464253) PHAGE_Escher_P13374: recombinase; PP_01436; phage(gi410491617) 0.0 Click
20complement(1464270..1464551) PHAGE_Escher_P13374: hypothetical protein; PP_01437; phage(gi410491618) 2e-50 Click
21complement(1464572..1464793) PHAGE_Escher_P13374: hypothetical protein; PP_01438; phage(gi410491619) 5e-37 Click
22complement(1464865..1465077) PHAGE_Escher_P13374: host killing protein; PP_01439; phage(gi410491620) 1e-34 Click
23complement(1465148..1465621) PHAGE_Escher_P13374: antitermination; PP_01440; phage(gi410491621) 5e-87 Click
24complement(1466078..1466851) PHAGE_Escher_P13374: regulatory protein; PP_01441; phage(gi410491624) 6e-145 Click
25complement(1467480..1468433) PHAGE_Escher_P13374: restriction endonuclease; PP_01442; phage(gi410491625) 0.0 Click
26complement(1468430..1469899) PHAGE_Escher_P13374: DNA methylase; PP_01443; phage(gi410491626) 0.0 Click
27complement(1469994..1470707) PHAGE_Escher_P13374: prophage repressor CI; PP_01444; phage(gi410491627) 2e-134 Click
281470803..1471006 PHAGE_Escher_P13374: cro repressor; PP_01445; phage(gi410491628) 2e-32 Click
291471784..1471915 PHAGE_Escher_P13374: hypothetical protein; PP_01446; phage(gi410491630) 2e-18 Click
301471909..1473429 PHAGE_Escher_P13374: helicase; PP_01447; phage(gi410491631) 0.0 Click
311473440..1474390 PHAGE_Escher_P13374: primase; PP_01448; phage(gi410491632) 0.0 Click
321474390..1474839 PHAGE_Escher_P13374: hypothetical protein; PP_01449; phage(gi410491633) 1e-84 Click
331474847..1475410 PHAGE_Escher_P13374: recombination endonuclease; PP_01450; phage(gi410491634) 2e-108 Click
341475407..1475601 PHAGE_Escher_P13374: hypothetical protein; PP_01451; phage(gi410491635) 2e-32 Click
351475594..1476028 PHAGE_Escher_P13374: antiterminator Q; PP_01452; phage(gi410491636) 1e-82 Click
361476277..1476429 PHAGE_Stx2_c_86: DNA modification methylase; PP_01453; phage(gi116222073) 8e-22 Click
371476470..1476545 tRNA 0.0 Click
381476555..1476631 tRNA 0.0 Click
391476645..1476721 tRNA 0.0 Click
401476989..1477771 PHAGE_Escher_P13374: shiga toxin 2 subunit A; PP_01454; phage(gi410491638) 3e-146 Click
411477783..1478052 PHAGE_Escher_P13374: shiga toxin 2 subunit B; PP_01455; phage(gi410491639) 1e-46 Click
421478538..1480475 PHAGE_Escher_P13374: hypothetical protein; PP_01456; phage(gi410491642) 0.0 Click
431480612..1480791 PHAGE_Escher_P13374: hypothetical protein; PP_01457; phage(gi410491643) 2e-28 Click
441480832..1481077 PHAGE_Escher_P13374: hypothetical protein; PP_01458; phage(gi410491644) 6e-39 Click
451481155..1481370 PHAGE_Escher_P13374: lysis protein, holin; PP_01459; phage(gi410491645) 9e-35 Click
461481375..1481908 PHAGE_Escher_P13374: lysis protein, lysozyme; PP_01460; phage(gi410491646) 4e-103 Click
471482182..1482751 PHAGE_Escher_P13374: antirepressor; PP_01461; phage(gi410491647) 9e-107 Click
481482766..1482900 PHAGE_Escher_P13374: hypothetical protein; PP_01462; phage(gi410491648) 1e-17 Click
491482912..1483340 PHAGE_Escher_P13374: endopeptidase; PP_01463; phage(gi410491649) 8e-75 Click
501483543..1484094 PHAGE_Escher_P13374: regulatory protein; PP_01464; phage(gi410491650) 4e-103 Click
511484218..1484331 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; PP_01465; phage(gi20065959) 6e-17 Click
521484387..1485193 PHAGE_Escher_P13374: phage terminase small subunit; PP_01466; phage(gi410491651) 5e-151 Click
531485219..1486880 PHAGE_Escher_P13374: phage terminase large subunit; PP_01467; phage(gi410491652) 0.0 Click
541486880..1489024 PHAGE_Escher_P13374: phage portal protein; PP_01468; phage(gi410491653) 0.0 Click
551489182..1490189 PHAGE_Escher_P13374: hypothetical protein; PP_01469; phage(gi410491654) 0.0 Click
561490213..1491427 PHAGE_Escher_P13374: structural protein; PP_01470; phage(gi410491655) 0.0 Click
571491483..1491872 PHAGE_Escher_P13374: hypothetical protein; PP_01471; phage(gi410491656) 2e-66 Click
581491922..1492383 PHAGE_Escher_P13374: hypothetical protein; PP_01472; phage(gi410491657) 1e-82 Click
591492367..1492930 PHAGE_Escher_P13374: hypothetical protein; PP_01473; phage(gi410491658) 2e-104 Click
601492930..1493580 PHAGE_Escher_P13374: hypothetical protein; PP_01474; phage(gi410491659) 1e-122 Click
611493577..1495769 PHAGE_Escher_P13374: phage tail fibre; PP_01475; phage(gi410491660) 0.0 Click
621495985..1496368 PHAGE_Escher_P13374: tail fibre adesine; PP_01476; phage(gi410491661) 2e-70 Click
631496536..1498227 PHAGE_Escher_TL_2011c: hypothetical protein; PP_01477; phage(gi418487111) 0.0 Click
641498224..1499492 PHAGE_Escher_P13374: phage tail fibre tip; PP_01478; phage(gi410491664) 0.0 Click
651499791..1500408 PHAGE_Escher_P13374: hypothetical protein; PP_01479; phage(gi410491665) 4e-122 Click
661500499..1501233 PHAGE_Escher_P13374: outer membrane lom precursor; PP_01480; phage(gi410491666) 4e-140 Click
671501466..1501606 PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_01481; phage(gi410491667) 1e-21 Click
681501687..1502064 PHAGE_Escher_P13374: hypothetical protein; PP_01482; phage(gi410491668) 1e-69 Click
691502158..1502814 PHAGE_Escher_P13374: hypothetical protein; PP_01483; phage(gi410491669) 5e-122 Click
701502817..1503263 PHAGE_Escher_P13374: hypothetical protein; PP_01484; phage(gi410491670) 1e-80 Click
711503273..1503524 PHAGE_Escher_P13374: hypothetical protein; PP_01485; phage(gi410491671) 2e-40 Click
721503535..1504800 PHAGE_Escher_P13374: hypothetical protein; PP_01486; phage(gi410491672) 0.0 Click
731504870..1513251 PHAGE_Escher_P13374: hypothetical protein; PP_01487; phage(gi410491673) 0.0 Click
74complement(1513317..1513433) PHAGE_Escher_P13374: hypothetical protein; PP_01488; phage(gi410491674) 1e-16 Click
751514214..1514372 hypothetical protein i02_1042 [Escherichia coli str. 'clone D i2'] gi|386628531|ref|YP_006148251.1|; PP_01489 4e-19 Click
76complement(1514439..1515767) PHAGE_Lactob_KC5a: putative minor tail protein; PP_01490; phage(gi90592623) 6e-06 Click
771521505..1521516 attR    ACCGCCTGCTTT 0.0 Click

Region 3, total : 59 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11828982..1829004 attL    TGGTACATGGATATCGATACCAC 0.0 Click
2complement(1829141..1830271) PHAGE_Entero_HK630: integrase; PP_01827; phage(gi428782814) 8e-49 Click
3complement(1830562..1833033) PHAGE_Entero_mEp460: putative exonuclease; PP_01828; phage(gi428782342) 3e-56 Click
4complement(1833126..1833317) hypothetical protein NRG857_07890 [Escherichia coli O83:H1 str. NRG 857C] gi|387616914|ref|YP_006119936.1|; PP_01829 3e-29 Click
51833444..1833701 hypothetical protein APECO1_1046 [Escherichia coli APEC O1] gi|117624151|ref|YP_853064.1|; PP_01830 7e-44 Click
61834129..1834263 hypothetical protein O3K_14335 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482404|ref|YP_006779553.1|; PP_01831 4e-17 Click
7complement(1834252..1834590) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01832; phage(gi418487085) 4e-08 Click
8complement(1834602..1834835) PHAGE_Salico_CGphi29: hypothetical protein; PP_01833; phage(gi472340166) 7e-10 Click
9complement(1835051..1835470) PHAGE_Entero_HK022: regulatory protein cI; PP_01834; phage(gi19343388) 3e-21 Click
101835550..1835804 PHAGE_Escher_HK75: regulatory protein cro; PP_01835; phage(gi356870715) 2e-18 Click
111835801..1836226 PHAGE_Escher_HK639: cII; PP_01836; phage(gi356870652) 3e-05 Click
121836249..1837211 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_01837; phage(gi18249881) 2e-33 Click
131837252..1837677 phage protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482397|ref|YP_006779546.1|; PP_01838 7e-74 Click
141837951..1838517 hypothetical protein CE10_1450 [Escherichia coli O7:K1 str. CE10] gi|386623816|ref|YP_006143544.1|; PP_01839 4e-111 Click
15complement(1838952..1839131) hypothetical protein O3K_14285 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482394|ref|YP_006779543.1|; PP_01840 6e-27 Click
161839352..1840398 PHAGE_Entero_mEp460: hypothetical protein; PP_01841; phage(gi428782365) 7e-111 Click
171840411..1840785 PHAGE_Escher_HK75: RusA-like protein; PP_01842; phage(gi356870726) 3e-37 Click
181840782..1841603 PHAGE_Entero_HK225: late gene regulator Q; PP_01843; phage(gi428782441) 2e-90 Click
191841830..1842027 PHAGE_Entero_phiP27: hypothetical protein P27p23; PP_01844; phage(gi18249887) 2e-30 Click
201842178..1843227 PHAGE_Entero_phiP27: putative DNA methylase; PP_01845; phage(gi18249888) 0.0 Click
211843277..1843352 tRNA 0.0 Click
221843360..1843436 tRNA 0.0 Click
231843450..1843526 tRNA 0.0 Click
241844026..1844157 hypothetical protein SDY_1443 [Shigella dysenteriae Sd197] gi|82776726|ref|YP_403075.1|; PP_01846 9e-18 Click
25complement(1844438..1844623) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; PP_01847; phage(gi209447168) 8e-22 Click
26complement(1844899..1845048) hypothetical protein i02_1307 [Escherichia coli str. 'clone D i2'] gi|386628791|ref|YP_006148511.1|; PP_01848 3e-19 Click
271845034..1846887 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; PP_01849; phage(gi116221995) 0.0 Click
281847047..1847253 PHAGE_Escher_P13374: lysis protein, holin; PP_01850; phage(gi410491645) 2e-33 Click
291847258..1848064 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; PP_01851; phage(gi116221997) 6e-146 Click
301848107..1848640 PHAGE_Entero_4795: putative R protein; PP_01852; phage(gi157166033) 3e-102 Click
311848933..1849064 PHAGE_Escher_P13374: hypothetical protein; PP_01853; phage(gi410491648) 5e-11 Click
321849067..1849183 hypothetical protein G2583_2456 [Escherichia coli O55:H7 str. CB9615] gi|291283181|ref|YP_003499999.1|; PP_01854 2e-12 Click
331849283..1849750 PHAGE_Entero_HK620: endopeptidase; PP_01855; phage(gi13559860) 4e-67 Click
341849747..1849890 PHAGE_Entero_mEp460: hypothetical protein; PP_01856; phage(gi428782374) 4e-21 Click
351849969..1850256 hypothetical protein O3K_14205 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482378|ref|YP_006779527.1|; PP_01857 2e-52 Click
361850941..1851114 hypothetical protein O3K_14195 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482376|ref|YP_006779525.1|; PP_01858 5e-24 Click
371851161..1851433 hypothetical protein O3K_14190 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482375|ref|YP_006779524.1|; PP_01859 6e-48 Click
381851515..1852063 PHAGE_Entero_HK630: terminase small subunit nu1; PP_01860; phage(gi428782788) 8e-51 Click
391852215..1853963 PHAGE_Entero_HK630: terminase large subunit A; PP_01861; phage(gi428782789) 0.0 Click
401853947..1854153 PHAGE_Entero_HK630: head-tail connector W; PP_01862; phage(gi428782790) 1e-11 Click
411854150..1855742 PHAGE_Entero_HK630: portal protein B; PP_01863; phage(gi428782791) 0.0 Click
421855732..1857237 PHAGE_Entero_HK630: head maturation protease C; PP_01864; phage(gi428782792) 6e-106 Click
431857274..1857621 PHAGE_Entero_HK630: head decoration protein D; PP_01865; phage(gi428782794) 1e-24 Click
441857679..1858707 PHAGE_Entero_HK630: major head subunit E; PP_01866; phage(gi428782795) 4e-114 Click
451858759..1859127 PHAGE_Entero_HK225: head assembly protein Fi; PP_01867; phage(gi428782384) 4e-05 Click
461859120..1859473 PHAGE_Entero_HK630: head-tail connector Fii; PP_01868; phage(gi428782797) 1e-43 Click
471859488..1860063 PHAGE_Entero_HK630: minor tail protein Z; PP_01869; phage(gi428782798) 8e-57 Click
481860060..1860455 PHAGE_Entero_HK630: minor tail protein U; PP_01870; phage(gi428782799) 8e-59 Click
491860463..1861215 PHAGE_Entero_HK630: major tail protein V; PP_01871; phage(gi428782800) 1e-111 Click
501861229..1861660 PHAGE_Entero_HK630: minor tail protein G; PP_01872; phage(gi428782801) 2e-45 Click
511861711..1862100 PHAGE_Entero_HK630: tail assembly protein GT; PP_01873; phage(gi428782802) 4e-43 Click
521862081..1863622 PHAGE_Entero_HK630: tail length tape measure protein H; PP_01874; phage(gi428782803) 0.0 Click
531863606..1864148 PHAGE_Entero_HK630: tail component I; PP_01875; phage(gi428782807) 5e-76 Click
541864435..1864560 hypothetical protein ECS88_1384 [Escherichia coli S88] gi|218558234|ref|YP_002391147.1|; PP_01876 5e-16 Click
551864627..1868106 PHAGE_Entero_HK630: tail fiber J; PP_01877; phage(gi428782808) 0.0 Click
561868174..1868773 PHAGE_Entero_mEp460: Lom protein; PP_01878; phage(gi428782335) 4e-99 Click
57complement(1869422..1869823) PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_01879; phage(gi399528893) 7e-06 Click
581869859..1869993 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_01880 5e-18 Click
591869954..1871759 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01881; phage(gi16129506) 2e-103 Click
601871759..1872343 PHAGE_Entero_HK630: tail fiber assembly protein; PP_01882; phage(gi428782810) 3e-105 Click
61complement(1872398..1872571) hypothetical protein SSON_2178 [Shigella sonnei Ss046] gi|74312645|ref|YP_311064.1|; PP_01883 3e-25 Click
621873123..1873392 PHAGE_Entero_HK630: tail fiber assembly protein; PP_01884; phage(gi428782810) 2e-21 Click
631873507..1873677 PHAGE_Entero_phiP27: hypothetical protein P27p57; PP_01885; phage(gi18249921) 3e-10 Click
641873993..1874015 attR    TGGTACATGGATATCGATACCAC 0.0 Click

Region 4, total : 75 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12181084..2181719 PHAGE_Stx2_c_II: putative antirepressor protein AntB; PP_02168; phage(gi302393111) 2e-79 Click
2complement(2181746..2181868) hypothetical; PP_02169 0.0 Click
32181985..2182269 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; PP_02170; phage(gi302393109) 1e-40 Click
42182256..2183092 PHAGE_Entero_HK633: hypothetical protein; PP_02171; phage(gi428782552) 4e-60 Click
52182660..2182674 attL    CCAATGGCGGCCAGA 0.0 Click
62183094..2183609 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp06; PP_02172; phage(gi209447131) 1e-101 Click
72183606..2184109 PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp26; PP_02173; phage(gi221328643) 1e-31 Click
8complement(2184111..2184386) hypothetical protein O3K_12640 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482069|ref|YP_006779218.1|; PP_02174 2e-44 Click
9complement(2184510..2192861) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp35; PP_02175; phage(gi116222027) 0.0 Click
10complement(2192930..2194195) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; PP_02176; phage(gi302393102) 0.0 Click
11complement(2194206..2194457) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; PP_02177; phage(gi302393101) 8e-36 Click
12complement(2194467..2194913) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; PP_02178; phage(gi302393100) 5e-78 Click
13complement(2194916..2195572) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; PP_02179; phage(gi302393099) 7e-119 Click
14complement(2195664..2196041) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; PP_02180; phage(gi302393098) 2e-64 Click
15complement(2196122..2196262) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp17; PP_02181; phage(gi302393097) 5e-21 Click
16complement(2196497..2197234) PHAGE_Stx2_c_II: outer membrane protein Lom precursor; PP_02182; phage(gi302393096) 4e-92 Click
17complement(2197314..2197931) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; PP_02183; phage(gi302393095) 3e-117 Click
18complement(2197937..2198215) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; PP_02184; phage(gi302393094) 5e-48 Click
19complement(2198230..2199498) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; PP_02185; phage(gi302393093) 0.0 Click
20complement(2199495..2201120) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; PP_02186; phage(gi302393092) 0.0 Click
21complement(2201146..2201259) hypothetical; PP_02187 0.0 Click
22complement(2201701..2202246) PHAGE_Salmon_SSU5: putative receptor-recognising phage tail fiber adhesin; PP_02188; phage(gi410491432) 4e-45 Click
23complement(2202329..2204236) PHAGE_Escher_P13374: phage tail fibre; PP_02189; phage(gi410491660) 0.0 Click
24complement(2204233..2204883) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; PP_02190; phage(gi302393089) 2e-111 Click
25complement(2204883..2205446) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; PP_02191; phage(gi302393088) 1e-82 Click
26complement(2205430..2205891) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; PP_02192; phage(gi302393087) 2e-75 Click
27complement(2205942..2206331) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; PP_02193; phage(gi302393086) 1e-64 Click
28complement(2206386..2207600) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; PP_02194; phage(gi302393085) 0.0 Click
29complement(2207623..2208630) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; PP_02195; phage(gi302393084) 1e-169 Click
30complement(2208788..2210932) PHAGE_Stx2_c_II: portal protein; PP_02196; phage(gi302393083) 0.0 Click
31complement(2210932..2212593) PHAGE_Stx2_c_II: terminase, large subunit; PP_02197; phage(gi302393082) 0.0 Click
32complement(2212619..2213434) PHAGE_Stx2_c_II: terminase, small subunit; PP_02198; phage(gi302393081) 5e-108 Click
33complement(2214076..2214195) hypothetical; PP_02199 0.0 Click
342214463..2214618 lipopolysaccharide core heptose(II)-phosphate phosphatase [Escherichia coli O104:H4 str. 2011C-3493] gi|407482045|ref|YP_006779194.1|; PP_02200 2e-24 Click
35complement(2214699..2215157) PHAGE_Entero_mEp235: lysis protein Rz; PP_02201; phage(gi428781868) 9e-59 Click
36complement(2215159..2215272) hypothetical protein ECO26_1133 [Escherichia coli O26:H11 str. 11368] gi|260854298|ref|YP_003228189.1|; PP_02202 4e-13 Click
37complement(2215493..2216026) PHAGE_Stx2_c_II: endolysin; PP_02203; phage(gi302393165) 3e-93 Click
38complement(2216031..2216246) PHAGE_Stx2_c_II: holin; PP_02204; phage(gi302393164) 7e-35 Click
39complement(2216323..2216568) PHAGE_Escher_P13374: hypothetical protein; PP_02205; phage(gi410491644) 2e-35 Click
40complement(2216594..2216776) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; PP_02206; phage(gi302393162) 1e-24 Click
41complement(2216915..2218825) PHAGE_Escher_P13374: hypothetical protein; PP_02207; phage(gi410491642) 0.0 Click
42complement(2219590..2220024) PHAGE_Stx2_c_II: antitermination protein Q; PP_02208; phage(gi302393156) 7e-82 Click
43complement(2220017..2220211) PHAGE_Stx2_c_II: NinH protein; PP_02209; phage(gi302393155) 5e-21 Click
44complement(2220211..2220573) PHAGE_Entero_HK542: Holliday-junction resolvase; PP_02210; phage(gi428783393) 2e-60 Click
45complement(2220570..2220863) PHAGE_Entero_HK629: hypothetical protein; PP_02211; phage(gi428782069) 1e-50 Click
46complement(2221072..2221482) PHAGE_Escher_HK75: NinB; PP_02212; phage(gi356870721) 8e-69 Click
47complement(2221537..2222208) PHAGE_Stx2_c_II: putative antirepressor-like protein; PP_02213; phage(gi302393152) 2e-52 Click
482222553..2222807 hypothetical protein O3K_12445 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482030|ref|YP_006779179.1|; PP_02214 9e-42 Click
492222915..2223232 DNA-binding protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482029|ref|YP_006779178.1|; PP_02215 5e-53 Click
50complement(2223283..2223768) bacteriophage protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482028|ref|YP_006779177.1|; PP_02216 8e-88 Click
51complement(2223787..2223966) bacteriophage protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482027|ref|YP_006779176.1|; PP_02217 3e-27 Click
52complement(2224577..2224726) hypothetical protein G2583_1713 [Escherichia coli O55:H7 str. CB9615] gi|291282458|ref|YP_003499276.1|; PP_02218 1e-18 Click
53complement(2224797..2225381) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp33; PP_02219; phage(gi302393116) 2e-11 Click
54complement(2225438..2225833) PHAGE_Entero_HK225: putative Ren exclusion protein; PP_02220; phage(gi428782427) 9e-05 Click
55complement(2225849..2226619) hypothetical protein O3K_12405 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482022|ref|YP_006779171.1|; PP_02221 1e-138 Click
56complement(2226645..2227385) PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_02222; phage(gi169257280) 1e-76 Click
57complement(2227392..2228393) PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_02223; phage(gi18249881) 4e-31 Click
58complement(2228495..2228713) hypothetical protein O3K_12390 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482019|ref|YP_006779168.1|; PP_02224 7e-39 Click
59complement(2228728..2229024) PHAGE_Stx2_c_86: regulatory protein CII; PP_02225; phage(gi116222057) 4e-38 Click
60complement(2229163..2229363) PHAGE_Entero_HK544: Cro protein; PP_02226; phage(gi428783258) 3e-31 Click
612229464..2230177 PHAGE_Entero_mEp234: prophage repressor; PP_02227; phage(gi428782293) 4e-134 Click
622230407..2230766 hypothetical protein O3K_12370 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482015|ref|YP_006779164.1|; PP_02228 2e-68 Click
632230754..2231530 PHAGE_Burkho_2: gp47, conserved hypothetical protein; PP_02229; phage(gi134288670) 2e-08 Click
64complement(2231672..2231797) hypothetical; PP_02230 0.0 Click
652232025..2232408 PHAGE_Stx2_c_I: N protein; PP_02231; phage(gi20065909) 2e-67 Click
662232412..2233125 PHAGE_Entero_phiP27: hypothetical protein P27p20; PP_02232; phage(gi18249884) 3e-08 Click
672233157..2233516 PHAGE_Cronob_phiES15: hypothetical protein; PP_02233; phage(gi401817573) 2e-06 Click
68complement(2233485..2233694) hypothetical protein O3K_12345 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482010|ref|YP_006779159.1|; PP_02234 7e-32 Click
692234151..2234372 PHAGE_Escher_P13374: host killing protein; PP_02235; phage(gi410491620) 6e-05 Click
702234456..2234842 hypothetical protein O3K_12335 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482008|ref|YP_006779157.1|; PP_02236 3e-69 Click
712234950..2237022 PHAGE_Salmon_SPN3UB: RecE; PP_02237; phage(gi423262421) 8e-56 Click
722237019..2237315 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_02238; phage(gi116222045) 5e-45 Click
732237321..2238106 PHAGE_Stx2_c_II: recombination protein Bet; PP_02239; phage(gi302393129) 3e-144 Click
742238103..2238783 PHAGE_Stx2_c_II: exonuclease; PP_02240; phage(gi302393128) 1e-129 Click
752238831..2239082 PHAGE_Escher_TL_2011c: putative bacteriophage protein; PP_02241; phage(gi418487053) 2e-39 Click
762239344..2240507 PHAGE_Salmon_epsilon34: Tyrosine integrase; PP_02242; phage(gi221328640) 5e-180 Click
772254851..2254865 attR    CCAATGGCGGCCAGA 0.0 Click

Region 5, total : 52 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12372420..2372435 attL    AAAGAAAAAAGGCCGC 0.0 Click
2complement(2372957..2373892) PHAGE_Yersin_413C: Int; PP_02371; phage(gi30065733) 4e-78 Click
32374429..2374662 DNA-binding protein [Escherichia coli O26:H11 str. 11368] gi|260855537|ref|YP_003229428.1|; PP_02372 1e-36 Click
42374677..2375015 hypothetical protein O3K_11650 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481872|ref|YP_006779021.1|; PP_02373 6e-60 Click
52375026..2375313 hypothetical protein O3K_11645 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481871|ref|YP_006779020.1|; PP_02374 7e-47 Click
62375325..2375567 hypothetical protein SSON53_08345 [Shigella sonnei 53G] gi|383178214|ref|YP_005456219.1|; PP_02375 1e-38 Click
72375564..2375677 hypothetical protein O3K_11635 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481869|ref|YP_006779018.1|; PP_02376 5e-13 Click
82375766..2376086 hypothetical protein O3K_11630 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481868|ref|YP_006779017.1|; PP_02377 6e-53 Click
92376076..2376279 hypothetical protein O3K_11625 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481867|ref|YP_006779016.1|; PP_02378 2e-31 Click
102376276..2376521 hypothetical protein O3K_11620 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481866|ref|YP_006779015.1|; PP_02379 6e-41 Click
112376518..2376817 PHAGE_Entero_mEp213: hypothetical protein; PP_02380; phage(gi428782624) 4e-08 Click
122377140..2377370 hypothetical protein O3K_11610 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481864|ref|YP_006779013.1|; PP_02381 7e-36 Click
132377473..2377832 hypothetical protein O3K_11605 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481863|ref|YP_006779012.1|; PP_02382 6e-65 Click
142377829..2380669 PHAGE_Yersin_413C: gpA; PP_02383; phage(gi30065742) 7e-79 Click
152380746..2381705 prophage stability/partitioning protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481861|ref|YP_006779010.1|; PP_02384 0.0 Click
162381710..2382024 stability/partitioning protein phage encoded [Escherichia coli O104:H4 str. 2011C-3493] gi|407481860|ref|YP_006779009.1|; PP_02385 1e-53 Click
172382044..2382475 PHAGE_Salmon_ST64B: hypothetical protein sb31; PP_02386; phage(gi23505475) 3e-14 Click
182382477..2382740 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_02387; phage(gi399498823) 3e-23 Click
192383055..2383183 hypothetical protein ECOK1_2572 [Escherichia coli IHE3034] gi|386600215|ref|YP_006101721.1|; PP_02388 4e-14 Click
20complement(2383252..2384298) PHAGE_Erwini_ENT90: phage portal protein; PP_02389; phage(gi431810941) 7e-92 Click
21complement(2384298..2386049) PHAGE_Yersin_413C: gpP; PP_02390; phage(gi30065706) 2e-132 Click
222386204..2387040 PHAGE_Salmon_RE_2010: capsid scaffolding protein; PP_02391; phage(gi418489698) 6e-45 Click
232387064..2388116 PHAGE_Yersin_413C: gpN; PP_02392; phage(gi30065708) 1e-71 Click
242388162..2388962 PHAGE_Ralsto_phiRSA1: terminase; PP_02393; phage(gi145708083) 6e-36 Click
252389064..2389558 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); PP_02394; phage(gi134288689) 1e-25 Click
262389558..2389758 PHAGE_Yersin_413C: gpX; PP_02395; phage(gi30065711) 1e-10 Click
272389761..2390084 PHAGE_Aeromo_phiO18P: putative holin; PP_02396; phage(gi148727161) 1e-09 Click
282390081..2390473 PHAGE_Entero_phiP27: putative endolysin; PP_02397; phage(gi18249894) 1e-52 Click
292390470..2390877 hypothetical protein O3K_11530 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481848|ref|YP_006778997.1|; PP_02398 4e-71 Click
302390849..2391019 hypothetical protein ECNA114_0868 [Escherichia coli NA114] gi|386618385|ref|YP_006137965.1|; PP_02399 3e-27 Click
312391016..2392896 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_02400; phage(gi209427766) 0.0 Click
322393004..2393387 PHAGE_Yersin_413C: gpR; PP_02401; phage(gi30065716) 8e-12 Click
332393380..2394015 PHAGE_Pseudo_phiCTX: predicted tail completion; PP_02402; phage(gi17313233) 1e-19 Click
342394012..2394593 PHAGE_Yersin_413C: gpV; PP_02403; phage(gi30065718) 1e-43 Click
352394590..2394940 PHAGE_Yersin_413C: gpW; PP_02404; phage(gi30065719) 3e-21 Click
362394944..2395840 PHAGE_Yersin_413C: gpJ; PP_02405; phage(gi30065720) 9e-85 Click
372395833..2396363 PHAGE_Yersin_413C: gpI; PP_02406; phage(gi30065721) 6e-62 Click
382396366..2398498 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_02407; phage(gi16129506) 3e-132 Click
392398498..2399076 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_02408; phage(gi16129505) 2e-99 Click
40complement(2399120..2399692) acetyltransferase [Escherichia coli O104:H4 str. 2011C-3493] gi|407481838|ref|YP_006778987.1|; PP_02409 9e-108 Click
41complement(2399849..2400337) PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_02410; phage(gi29143763) 1e-38 Click
42complement(2400350..2403157) PHAGE_Yersin_413C: gpT; PP_02411; phage(gi30065729) 4e-108 Click
43complement(2403144..2403299) PHAGE_Yersin_413C: gpE+E'; PP_02412; phage(gi30065728) 1e-07 Click
44complement(2403308..2403673) PHAGE_Burkho_phiE202: gp28, phage tail protein E; PP_02413; phage(gi134288780) 5e-06 Click
45complement(2403728..2404240) PROPHAGE_Salmon_Ty2: major tail tube protein; PP_02414; phage(gi29143759) 4e-35 Click
46complement(2404240..2405424) PHAGE_Erwini_ENT90: tail sheath protein; PP_02415; phage(gi431810939) 3e-101 Click
47complement(2405421..2405561) hypothetical; PP_02416 0.0 Click
482405582..2406691 PHAGE_Yersin_413C: gpD; PP_02417; phage(gi30065731) 4e-94 Click
49complement(2406783..2407952) hypothetical protein O3K_11440 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481830|ref|YP_006778979.1|; PP_02418 0.0 Click
502408210..2409190 PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_02419; phage(gi16129935) 0.0 Click
512409383..2409643 PHAGE_Yersin_413C: Ogr; PP_02420; phage(gi30065732) 6e-07 Click
522409834..2409974 PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_02421; phage(gi410491667) 1e-15 Click
532410234..2410249 attR    AAAGAAAAAAGGCCGC 0.0 Click
54complement(2410276..2410575) PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; PP_02422; phage(gi9630187) 4e-15 Click

Region 6, total : 72 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12556836..2556848 attL    TGCCGGATGCGGC 0.0 Click
2complement(2566363..2568096) PHAGE_Acanth_moumouvirus: asparaginyl t-RNA synthetase; PP_02585; phage(gi441432571) 3e-07 Click
32568445..2569011 hydrolase [Escherichia coli O104:H4 str. 2011C-3493] gi|407481665|ref|YP_006778814.1|; PP_02586 6e-104 Click
4complement(2569093..2569269) PHAGE_Entero_phiP27: hypothetical protein P27p58; PP_02587; phage(gi18249922) 9e-13 Click
52569366..2569614 PHAGE_Entero_mEp460: DinI-like protein; PP_02588; phage(gi428782337) 1e-41 Click
62569767..2569880 hypothetical; PP_02589 0.0 Click
72569877..2570077 hypothetical; PP_02590 0.0 Click
8complement(2570153..2570761) PHAGE_Entero_phiP27: hypothetical protein P27p57; PP_02591; phage(gi18249921) 4e-26 Click
9complement(2570770..2572308) PHAGE_Stx2_c_1717: putative tail fiber protein; PP_02592; phage(gi209447198) 0.0 Click
10complement(2572461..2573060) PHAGE_Entero_mEp460: Lom protein; PP_02593; phage(gi428782335) 4e-99 Click
11complement(2573128..2576523) PHAGE_Entero_mEp460: host specificity protein; PP_02594; phage(gi428782334) 0.0 Click
12complement(2576584..2578719) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; PP_02595; phage(gi15832203) 0.0 Click
13complement(2578700..2579089) PROPHAGE_Escher_Sakai: putative minor tail protein; PP_02596; phage(gi15832204) 2e-40 Click
14complement(2579140..2579562) PROPHAGE_Escher_Sakai: putative minor tail protein; PP_02597; phage(gi15832205) 4e-74 Click
15complement(2579576..2580328) PHAGE_Entero_HK630: major tail protein V; PP_02598; phage(gi428782800) 1e-112 Click
16complement(2580336..2580731) PHAGE_Entero_HK630: minor tail protein U; PP_02599; phage(gi428782799) 8e-59 Click
17complement(2580728..2581303) PHAGE_Entero_HK630: minor tail protein Z; PP_02600; phage(gi428782798) 3e-58 Click
18complement(2581318..2581671) PHAGE_Entero_HK630: head-tail connector Fii; PP_02601; phage(gi428782797) 2e-43 Click
19complement(2581664..2582047) PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; PP_02602; phage(gi169257229) 5e-12 Click
20complement(2582099..2583127) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; PP_02603; phage(gi169257230) 2e-176 Click
21complement(2583185..2583532) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; PP_02604; phage(gi169257231) 5e-43 Click
22complement(2583569..2585074) PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; PP_02605; phage(gi169257232) 2e-175 Click
23complement(2585064..2586656) PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; PP_02606; phage(gi169257233) 0.0 Click
24complement(2586653..2586859) PHAGE_Entero_mEp237: head-tail connector; PP_02607; phage(gi435439268) 1e-13 Click
25complement(2586843..2588771) PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; PP_02608; phage(gi169257235) 0.0 Click
26complement(2588743..2589159) PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; PP_02609; phage(gi169257236) 7e-49 Click
27complement(2589373..2589531) putative phage protein [Escherichia coli 042] gi|387606811|ref|YP_006095667.1|; PP_02610 1e-19 Click
282589557..2589670 hypothetical protein O3K_10465 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481639|ref|YP_006778788.1|; PP_02611 4e-13 Click
292589686..2589871 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_02612; phage(gi209427772) 2e-19 Click
30complement(2590004..2590144) hypothetical protein ECS88_0566 [Escherichia coli S88] gi|218557476|ref|YP_002390389.1|; PP_02613 2e-18 Click
31complement(2590231..2590353) hypothetical protein CE10_1466 [Escherichia coli O7:K1 str. CE10] gi|386623829|ref|YP_006143557.1|; PP_02614 9e-15 Click
32complement(2590495..2590953) PHAGE_Entero_4795: putative endopeptidase Rz; PP_02615; phage(gi157166036) 8e-68 Click
33complement(2590965..2591096) PHAGE_Escher_P13374: hypothetical protein; PP_02616; phage(gi410491648) 5e-12 Click
34complement(2591111..2591257) hypothetical protein O3K_10440 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481634|ref|YP_006778783.1|; PP_02617 1e-18 Click
35complement(2591450..2591983) PHAGE_Entero_mEp460: endolysin; PP_02618; phage(gi428782372) 6e-99 Click
362592112..2592426 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; PP_02619; phage(gi116221998) 1e-57 Click
37complement(2592436..2593242) PHAGE_Entero_mEp460: hypothetical protein; PP_02620; phage(gi428782371) 5e-19 Click
38complement(2593247..2593462) PHAGE_Stx2_c_II: holin; PP_02621; phage(gi302393164) 1e-34 Click
39complement(2593613..2595466) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_02622; phage(gi209427766) 0.0 Click
40complement(2595957..2596033) tRNA 0.0 Click
41complement(2596047..2596123) tRNA 0.0 Click
42complement(2596133..2596208) tRNA 0.0 Click
43complement(2596258..2597307) PHAGE_Entero_mEp460: DNA methylase; PP_02623; phage(gi428782369) 2e-175 Click
442597391..2597528 hypothetical; PP_02624 0.0 Click
45complement(2597706..2597840) hypothetical protein APECO78_04765 [Escherichia coli APEC O78] gi|443616278|ref|YP_007380134.1|; PP_02625 2e-18 Click
462597927..2598853 hypothetical protein O3K_10400 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481626|ref|YP_006778775.1|; PP_02626 4e-176 Click
472598840..2599388 hypothetical protein O3K_10395 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481625|ref|YP_006778774.1|; PP_02627 7e-99 Click
48complement(2599401..2599742) PHAGE_Entero_cdtI: antitermination protein Q; PP_02628; phage(gi148609434) 6e-34 Click
49complement(2599760..2600749) PHAGE_Entero_mEp460: hypothetical protein; PP_02629; phage(gi428782365) 0.0 Click
50complement(2600757..2601572) PHAGE_Entero_mEp460: KilA-N domain protein; PP_02630; phage(gi428782364) 4e-96 Click
51complement(2601735..2602130) PHAGE_Entero_mEp460: holliday junction resolvase; PP_02631; phage(gi428782363) 1e-67 Click
52complement(2602127..2602453) PHAGE_Entero_mEp460: LexA DNA binding domain protein; PP_02632; phage(gi428782362) 3e-55 Click
53complement(2602450..2603103) PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; PP_02633; phage(gi428782361) 4e-126 Click
54complement(2603096..2603230) hypothetical; PP_02634 0.0 Click
55complement(2603594..2604406) PHAGE_Entero_mEp460: replication protein; PP_02635; phage(gi428782359) 9e-155 Click
56complement(2604409..2604633) PHAGE_Entero_mEp460: hypothetical protein; PP_02636; phage(gi428782358) 4e-38 Click
57complement(2604630..2605775) PHAGE_Entero_mEp460: regulatory protein Rha; PP_02637; phage(gi428782357) 2e-173 Click
58complement(2605772..2606329) PHAGE_Entero_mEp460: hypothetical protein; PP_02638; phage(gi428782356) 2e-95 Click
59complement(2606322..2606582) PHAGE_Entero_mEp460: putative antirepressor Cro; PP_02639; phage(gi428782355) 2e-43 Click
602606725..2607372 PHAGE_Entero_mEp460: prophage repressor; PP_02640; phage(gi428782354) 2e-118 Click
612608075..2608437 PHAGE_Entero_mEp460: hypothetical protein; PP_02641; phage(gi428782351) 2e-59 Click
622608503..2609327 PHAGE_Entero_mEp460: hypothetical protein; PP_02642; phage(gi428782350) 8e-151 Click
632609455..2609991 PHAGE_Entero_mEp460: hypothetical protein; PP_02643; phage(gi428782349) 1e-100 Click
642610003..2610344 PHAGE_Entero_mEp460: hypothetical protein; PP_02644; phage(gi428782348) 7e-64 Click
652610341..2610544 PHAGE_Entero_mEp460: hypothetical protein; PP_02645; phage(gi428782347) 1e-33 Click
662610537..2610776 PHAGE_Entero_mEp460: hypothetical protein; PP_02646; phage(gi428782346) 1e-35 Click
672610773..2611321 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp07; PP_02647; phage(gi209447132) 4e-61 Click
682611323..2611838 PHAGE_Escher_TL_2011c: hypothetical protein; PP_02648; phage(gi418487082) 1e-99 Click
692611835..2612593 PHAGE_Escher_P13374: hypothetical protein; PP_02649; phage(gi410491607) 3e-110 Click
702612777..2612920 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; PP_02650; phage(gi157165989) 9e-16 Click
712612924..2613070 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF3; PP_02651; phage(gi157165988) 6e-20 Click
72complement(2613210..2613326) hypothetical; PP_02652 0.0 Click
732613371..2614681 PHAGE_Entero_phiP27: putative integrase; PP_02653; phage(gi18249865) 0.0 Click
742614708..2615433 hypothetical protein ECBD_1770 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773175|ref|YP_003036006.1|; PP_02654 5e-141 Click
752615486..2615881 hypothetical protein ECO26_2721 [Escherichia coli O26:H11 str. 11368] gi|260855809|ref|YP_003229700.1|; PP_02655 3e-71 Click
762615922..2616665 PHAGE_Synech_S_CRM01: methyltransferase domain-containing protein; PP_02656; phage(gi333798309) 1e-24 Click
772617648..2617660 attR    TGCCGGATGCGGC 0.0 Click

Region 7, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13158470..3158485 attL    TTGCAGGTTCGATTCC 0.0 Click
23158661..3159818 PHAGE_Entero_HK620: integrase; PP_03167; phage(gi13559824) 0.0 Click
33160047..3161957 PHAGE_Salmon_c341: O-polysaccharide acetyltransferase protein; PP_03168; phage(gi255252697) 5e-65 Click
4complement(3162028..3164007) PHAGE_Entero_HK620: tail spike protein; PP_03169; phage(gi13559880) 6e-59 Click
5complement(3164108..3164986) PHAGE_Salmon_vB_SemP_Emek: antirepressor; PP_03170; phage(gi399498814) 6e-96 Click
6complement(3165049..3165213) hypothetical; PP_03171 0.0 Click
7complement(3165219..3165359) PHAGE_Salmon_vB_SemP_Emek: Arc; PP_03172; phage(gi399498812) 2e-05 Click
83165713..3166027 hypothetical protein O3K_07725 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481103|ref|YP_006778252.1|; PP_03173 7e-53 Click
93166053..3166538 lipoprotein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481102|ref|YP_006778251.1|; PP_03174 6e-86 Click
10complement(3166553..3168397) PHAGE_Entero_P22: injection protein; PP_03175; phage(gi51236731) 0.0 Click
11complement(3168397..3169863) PHAGE_Bacter_2: injection gp20; PP_03176; phage(gi212499730) 1e-152 Click
12complement(3169873..3170565) PHAGE_Entero_HK620: DNA transfer protein; PP_03177; phage(gi13559875) 1e-113 Click
13complement(3170568..3171023) PHAGE_Entero_HK620: head assembly protein; PP_03178; phage(gi13559874) 7e-86 Click
14complement(3171023..3171871) PHAGE_Entero_HK620: DNA stabilization protein; PP_03179; phage(gi13559873) 7e-38 Click
15complement(3171871..3173265) PHAGE_Entero_HK620: DNA stabilization protein; PP_03180; phage(gi13559872) 0.0 Click
16complement(3173298..3173780) PHAGE_Entero_HK620: DNA stabilization protein; PP_03181; phage(gi13559871) 1e-88 Click
17complement(3173755..3173940) PHAGE_Entero_HK620: hypothetical protein HK620p47; PP_03182; phage(gi13559870) 7e-29 Click
18complement(3173983..3175254) PHAGE_Entero_HK620: capsid protein; PP_03183; phage(gi13559869) 0.0 Click
19complement(3175266..3176150) PHAGE_Entero_HK620: scaffold protein; PP_03184; phage(gi13559868) 3e-166 Click
20complement(3176164..3178290) PHAGE_Entero_HK620: portal protein; PP_03185; phage(gi13559867) 0.0 Click
21complement(3178293..3179705) PHAGE_Entero_HK620: terminase large subunit; PP_03186; phage(gi13559866) 0.0 Click
22complement(3179702..3180142) PHAGE_Riemer_RAP44: hypothetical protein; PP_03187; phage(gi418489899) 2e-29 Click
23complement(3180145..3180387) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_03188; phage(gi399498861) 6e-39 Click
24complement(3180507..3181010) PROPHAGE_Escher_MG1655: IS1 transposase B; PP_03189; phage(gi16131317) 9e-94 Click
253181550..3181702 PHAGE_Escher_HK75: kil protein; PP_03190; phage(gi356870711) 4e-23 Click
263181684..3181869 PHAGE_Escher_HK75: hypothetical protein; PP_03191; phage(gi356870710) 4e-27 Click
273181823..3181948 PHAGE_Entero_mEp234: hypothetical protein; PP_03192; phage(gi428782284) 2e-18 Click
283181959..3182564 PHAGE_Entero_HK542: essential recombination function protein; PP_03193; phage(gi428783375) 3e-112 Click
293182564..3182947 PHAGE_Entero_HK542: hypothetical protein; PP_03194; phage(gi428783374) 8e-68 Click
303182971..3183267 PHAGE_Entero_HK620: hypothetical protein HK620p10; PP_03195; phage(gi13559833) 2e-52 Click
313183278..3183568 PHAGE_Entero_HK446: hypothetical protein; PP_03196; phage(gi428782222) 9e-48 Click
323183565..3183732 PHAGE_Entero_HK620: hypothetical protein HK620p09; PP_03197; phage(gi13559832) 3e-24 Click
333183729..3184400 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; PP_03198; phage(gi89152464) 4e-85 Click
343184969..3185598 PHAGE_Entero_HK620: hypothetical protein HK620p05; PP_03199; phage(gi13559828) 2e-57 Click
353185695..3185874 PHAGE_Entero_HK620: hypothetical protein HK620p04; PP_03200; phage(gi13559827) 3e-31 Click
363185971..3185986 attR    TTGCAGGTTCGATTCC 0.0 Click
373186006..3186206 PHAGE_Entero_HK620: hypothetical protein HK620p03; PP_03201; phage(gi13559826) 3e-34 Click