Escherichia coli O104:H4 str. TY-2482 , whole genome shotgun [asmbl_id: NC_000000].5291054, GC%: 50.55%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(290018..291688) PHAGE_Acanth_moumouvirus: glucose-methanol-choline oxidoreductase; PP_00266; phage(gi441432558) 4e-30 Click
2complement(291702..292808) betaine aldehyde dehydrogenase, NAD-dependent [Escherichia coli W] gi|386607678|ref|YP_006123164.1|; PP_00267 0.0 Click
3293014..293193 PHAGE_Escher_TL_2011c: hypothetical protein; PP_00268; phage(gi418487111) 4e-27 Click
4293244..293402 PHAGE_Escher_TL_2011c: hypothetical protein; PP_00269; phage(gi418487112) 8e-22 Click
5complement(293460..294527) PHAGE_Escher_TL_2011c: hypothetical protein; PP_00270; phage(gi418487112) 0.0 Click
6294582..294716 hypothetical; PP_00271 0.0 Click
7complement(295008..295124) hypothetical; PP_00272 0.0 Click
8complement(295371..295910) isopentenyl-diphosphate delta-isomerase [Erwinia amylovora ATCC 49946] gi|292898956|ref|YP_003538325.1|; PP_00273 7e-42 Click
9complement(295914..296942) hypothetical; PP_00274 0.0 Click
10complement(297084..297320) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; PP_00275; phage(gi24111655) 1e-27 Click
11297378..297878 PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; PP_00276; phage(gi17546156) 2e-16 Click

Region 2, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1487020..489860 PHAGE_Yersin_413C: gpA; PP_00475; phage(gi30065742) 7e-79 Click
2489937..490896 prophage stability/partitioning protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481861|ref|YP_006779010.1|; PP_00476 0.0 Click
3490901..491215 stability/partitioning protein phage encoded [Escherichia coli O104:H4 str. 2011C-3493] gi|407481860|ref|YP_006779009.1|; PP_00477 1e-53 Click
4491235..491666 PHAGE_Salmon_ST64B: hypothetical protein sb31; PP_00478; phage(gi23505475) 3e-14 Click
5491668..491931 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_00479; phage(gi399498823) 3e-23 Click
6492246..492374 hypothetical protein ECOK1_2572 [Escherichia coli IHE3034] gi|386600215|ref|YP_006101721.1|; PP_00480 4e-14 Click
7complement(492443..493489) PHAGE_Erwini_ENT90: phage portal protein; PP_00481; phage(gi431810941) 7e-92 Click
8complement(493489..495240) PHAGE_Yersin_413C: gpP; PP_00482; phage(gi30065706) 2e-132 Click
9495395..496231 PHAGE_Salmon_RE_2010: capsid scaffolding protein; PP_00483; phage(gi418489698) 6e-45 Click
10496255..497307 PHAGE_Yersin_413C: gpN; PP_00484; phage(gi30065708) 1e-71 Click
11497353..498153 PHAGE_Ralsto_phiRSA1: terminase; PP_00485; phage(gi145708083) 6e-36 Click
12498255..498749 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); PP_00486; phage(gi134288689) 1e-25 Click
13498749..498949 PHAGE_Yersin_413C: gpX; PP_00487; phage(gi30065711) 1e-10 Click
14498937..499275 PHAGE_Aeromo_phiO18P: putative holin; PP_00488; phage(gi148727161) 1e-09 Click
15499272..499664 PHAGE_Entero_phiP27: putative endolysin; PP_00489; phage(gi18249894) 1e-52 Click
16499661..500068 hypothetical protein O3K_11530 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481848|ref|YP_006778997.1|; PP_00490 4e-71 Click
17500040..500210 hypothetical protein ECNA114_0868 [Escherichia coli NA114] gi|386618385|ref|YP_006137965.1|; PP_00491 3e-27 Click
18500207..500734 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_00492; phage(gi209427766) 2e-51 Click

Region 3, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1568202..568216 attL    AACGCCTTGATTATC 0.0 Click
2complement(573274..573615) PHAGE_Entero_cdtI: antitermination protein Q; PP_00541; phage(gi148609434) 6e-34 Click
3complement(573633..574550) PHAGE_Entero_mEp460: hypothetical protein; PP_00542; phage(gi428782365) 0.0 Click
4complement(574653..575447) PHAGE_Entero_mEp460: KilA-N domain protein; PP_00543; phage(gi428782364) 2e-85 Click
5complement(575610..576005) PHAGE_Entero_mEp460: holliday junction resolvase; PP_00544; phage(gi428782363) 1e-67 Click
6complement(576002..576328) PHAGE_Entero_mEp460: LexA DNA binding domain protein; PP_00545; phage(gi428782362) 3e-55 Click
7complement(576325..576978) PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; PP_00546; phage(gi428782361) 4e-126 Click
8complement(576971..577105) hypothetical; PP_00547 0.0 Click
9complement(577469..578281) PHAGE_Entero_mEp460: replication protein; PP_00548; phage(gi428782359) 9e-155 Click
10complement(578505..579650) PHAGE_Entero_mEp460: regulatory protein Rha; PP_00549; phage(gi428782357) 2e-173 Click
11complement(579647..580204) PHAGE_Entero_mEp460: hypothetical protein; PP_00550; phage(gi428782356) 2e-95 Click
12complement(580197..580457) PHAGE_Entero_mEp460: putative antirepressor Cro; PP_00551; phage(gi428782355) 2e-43 Click
13580600..581247 PHAGE_Entero_mEp460: prophage repressor; PP_00552; phage(gi428782354) 2e-118 Click
14581950..582312 PHAGE_Entero_mEp460: hypothetical protein; PP_00553; phage(gi428782351) 2e-59 Click
15582378..583202 PHAGE_Entero_mEp460: hypothetical protein; PP_00554; phage(gi428782350) 8e-151 Click
16583330..583866 PHAGE_Entero_mEp460: hypothetical protein; PP_00555; phage(gi428782349) 1e-100 Click
17583878..584219 PHAGE_Entero_mEp460: hypothetical protein; PP_00556; phage(gi428782348) 7e-64 Click
18584216..584419 PHAGE_Entero_mEp460: hypothetical protein; PP_00557; phage(gi428782347) 1e-33 Click
19584412..584651 PHAGE_Entero_mEp460: hypothetical protein; PP_00558; phage(gi428782346) 1e-35 Click
20584648..585196 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp07; PP_00559; phage(gi209447132) 4e-61 Click
21585274..586434 hypothetical protein O3K_15465 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482623|ref|YP_006779772.1|; PP_00560 0.0 Click
22586431..587336 hypothetical protein O3K_15460 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482622|ref|YP_006779771.1|; PP_00561 6e-172 Click
23587333..588169 PHAGE_Rhodot_RM378: hypothetical protein Rm378p022; PP_00562; phage(gi30044012) 1e-07 Click
24588427..589095 PROPHAGE_Brucel_1330: transposase, putative; PP_00563; phage(gi23501616) 9e-19 Click
25589142..589846 PROPHAGE_Brucel_1330: transposase, putative; PP_00564; phage(gi23502708) 6e-43 Click
26589958..590716 P pilus assembly protein, chaperone PapD [Serratia marcescens FGI94] gi|440232419|ref|YP_007346212.1|; PP_00565 2e-61 Click
27590730..593258 P pilus assembly protein, porin PapC [Serratia marcescens FGI94] gi|440232418|ref|YP_007346211.1|; PP_00566 0.0 Click
28complement(594946..597912) PROPHAGE_Xantho_33913: Tn5041 transposase; PP_00567; phage(gi21231545) 8e-41 Click
29complement(597915..598475) PHAGE_Vibrio_PWH3a_P1: resolvase domain-containing protein; PP_00568; phage(gi472342379) 3e-28 Click
30complement(598601..598801) transposition modulator TnpM [Salmonella enterica subsp. enterica serovar Typhimurium str. T000240] gi|378986461|ref|YP_005249617.1|; PP_00569 4e-34 Click
31complement(599154..600167) PHAGE_Salmon_RE_2010: integrase; PP_00570; phage(gi418489683) 2e-08 Click
32606562..606576 attR    AACGCCTTGATTATC 0.0 Click

Region 4, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12962114..2962127 attL    TCTGCTTTACGCTT 0.0 Click
22976928..2977170 PHAGE_Entero_Sf6: hypothetical protein Sf6p67; PP_02875; phage(gi41057340) 6e-39 Click
32977173..2977613 PHAGE_Riemer_RAP44: hypothetical protein; PP_02876; phage(gi418489899) 2e-29 Click
42977610..2979022 PHAGE_Entero_Sf6: gene 2 protein; PP_02877; phage(gi41057280) 0.0 Click
52979025..2981151 PHAGE_Entero_Sf6: gene 3 protein; PP_02878; phage(gi41057281) 0.0 Click
62981165..2982049 PHAGE_Entero_Sf6: gene 4 protein; PP_02879; phage(gi41057282) 4e-167 Click
72982061..2983332 PHAGE_Entero_Sf6: gene 5 protein; PP_02880; phage(gi41057283) 0.0 Click
82983375..2983560 PHAGE_Entero_Sf6: gene 6 protein; PP_02881; phage(gi41057284) 7e-29 Click
92983535..2984017 PHAGE_Entero_Sf6: gene 7 protein; PP_02882; phage(gi41057285) 4e-89 Click
102984026..2985444 PHAGE_Entero_Sf6: gene 8 protein; PP_02883; phage(gi41057286) 0.0 Click
112985444..2986292 PHAGE_Entero_Sf6: gene 9 protein; PP_02884; phage(gi41057287) 5e-151 Click
122986292..2986747 PHAGE_Entero_Sf6: head assembly protein; PP_02885; phage(gi41057288) 1e-86 Click
132986750..2987442 PHAGE_Entero_Sf6: gene 11 protein; PP_02886; phage(gi41057289) 5e-126 Click
142987482..2988918 PHAGE_Entero_Sf6: gene 12 protein; PP_02887; phage(gi41057290) 3e-111 Click
152988918..2990762 PHAGE_Entero_P22: injection protein; PP_02888; phage(gi51236731) 0.0 Click
16complement(2990777..2991160) lipoprotein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481102|ref|YP_006778251.1|; PP_02889 7e-66 Click
17complement(2991288..2991602) hypothetical protein O3K_07725 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481103|ref|YP_006778252.1|; PP_02890 7e-53 Click
182991956..2992096 PHAGE_Salmon_vB_SemP_Emek: Arc; PP_02891; phage(gi399498812) 2e-05 Click
192992102..2992266 hypothetical; PP_02892 0.0 Click
202992329..2993207 PHAGE_Salmon_vB_SemP_Emek: antirepressor; PP_02893; phage(gi399498814) 6e-96 Click
212993308..2995287 PHAGE_Entero_Sf6: gene 14 protein; PP_02894; phage(gi41057292) 3e-57 Click
22complement(2995358..2996026) hypothetical protein O3K_07750 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481108|ref|YP_006778257.1|; PP_02895 1e-130 Click
23complement(2996041..2997273) PHAGE_Salmon_c341: O-polysaccharide acetyltransferase protein; PP_02896; phage(gi255252697) 5e-63 Click
24complement(2997502..2998659) PHAGE_Entero_Sf6: gene 16 protein; PP_02897; phage(gi41057294) 0.0 Click
252999032..2999045 attR    TCTGCTTTACGCTT 0.0 Click

Region 5, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13504870..3506036 PHAGE_Stx2_c_1717: penicillin-binding protein 6b; PP_03413; phage(gi209447203) 0.0 Click
23506155..3506628 DNA gyrase inhibitor [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773060|ref|YP_003035891.1|; PP_03414 6e-91 Click
33506826..3507506 inner membrane protein YeeA [Escherichia coli O104:H4 str. 2011C-3493] gi|407481429|ref|YP_006778578.1|; PP_03415 2e-125 Click
43507570..3508550 PROPHAGE_Escher_CFT073: transposase; PP_03416; phage(gi26248352) 4e-11 Click
53508741..3509163 membrane protein-like protein [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773061|ref|YP_003035892.1|; PP_03417 1e-75 Click
63509335..3509664 hypothetical protein SSON_2077 [Shigella sonnei Ss046] gi|74312549|ref|YP_310968.1|; PP_03418 2e-54 Click
7complement(3509765..3509989) hypothetical protein ECS88_2104 [Escherichia coli S88] gi|218558887|ref|YP_002391800.1|; PP_03419 3e-35 Click
83510156..3510590 PHAGE_Stx2_c_1717: truncated transposase; PP_03420; phage(gi209447151) 5e-10 Click
93510587..3510883 PHAGE_Stx2_c_1717: transposase; PP_03421; phage(gi209447152) 2e-31 Click
103510867..3511034 PHAGE_Stx2_c_1717: transposase; PP_03422; phage(gi209447153) 8e-14 Click
113511043..3512389 PHAGE_Vibrio_VHML: ORF37; PP_03423; phage(gi27311204) 1e-10 Click
123512569..3512919 hypothetical protein i02_2305 [Escherichia coli str. 'clone D i2'] gi|386629771|ref|YP_006149491.1|; PP_03424 7e-63 Click
13complement(3512886..3514823) PHAGE_Entero_mEp460: host specificity protein; PP_03425; phage(gi428782334) 0.0 Click

Region 6, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13834610..3835566 PHAGE_Entero_HK630: terminase large subunit A; PP_03753; phage(gi428782789) 1e-104 Click
23835550..3835756 PHAGE_Entero_HK630: head-tail connector W; PP_03754; phage(gi428782790) 1e-11 Click
33835753..3837345 PHAGE_Entero_HK630: portal protein B; PP_03755; phage(gi428782791) 0.0 Click
43837335..3838840 PHAGE_Entero_HK630: head maturation protease C; PP_03756; phage(gi428782792) 2e-106 Click
53838877..3839224 PHAGE_Entero_HK630: head decoration protein D; PP_03757; phage(gi428782794) 1e-24 Click
63839282..3839707 PHAGE_Entero_HK630: major head subunit E; PP_03758; phage(gi428782795) 6e-41 Click
73840020..3840271 PHAGE_Stx2_c_1717: transposase; PP_03759; phage(gi209447152) 1e-26 Click
83840302..3841048 PHAGE_Stx2_c_1717: transposase; PP_03760; phage(gi209447153) 2e-68 Click
93841079..3841921 transposase, IS110 family protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407484122|ref|YP_006781272.1|; PP_03761 9e-148 Click
10complement(3841918..3842406) hypothetical protein P12B_c2104 [Escherichia coli P12b] gi|386705274|ref|YP_006169121.1|; PP_03762 4e-94 Click
11complement(3842736..3842867) hypothetical protein O3K_15455 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482621|ref|YP_006779770.1|; PP_03764 4e-15 Click
123842859..3842990 hypothetical; PP_03763 0.0 Click
133842990..3843262 antirestriction protein [Escherichia coli 55989] gi|218697845|ref|YP_002405512.1|; PP_03765 9e-45 Click
143843410..3844231 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_03766; phage(gi414086954) 2e-45 Click
15complement(3844920..3846053) rhsD element protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482180|ref|YP_006779329.1|; PP_03767 0.0 Click
16complement(3846393..3847022) VgrE protein [Escherichia coli O26:H11 str. 11368] gi|260855181|ref|YP_003229072.1|; PP_03768 3e-102 Click
17complement(3847036..3847788) PHAGE_Entero_HK630: major tail protein V; PP_03769; phage(gi428782800) 3e-111 Click
18complement(3847796..3848191) PHAGE_Entero_HK630: minor tail protein U; PP_03770; phage(gi428782799) 8e-59 Click
19complement(3848188..3848763) PHAGE_Entero_HK630: minor tail protein Z; PP_03771; phage(gi428782798) 1e-58 Click
20complement(3848778..3849065) PHAGE_Entero_HK630: head-tail connector Fii; PP_03772; phage(gi428782797) 2e-37 Click
21complement(3849095..3849346) PHAGE_Stx2_c_1717: transposase; PP_03773; phage(gi209447152) 1e-25 Click
22complement(3849343..3849501) hypothetical protein ECSF_4247 [Escherichia coli SE15] gi|387832300|ref|YP_003352237.1|; PP_03775 4e-21 Click
233849491..3849688 hypothetical; PP_03774 0.0 Click
24complement(3851153..3852718) glutamate decarboxylase [Escherichia coli O127:H6 str. E2348/69] gi|215486712|ref|YP_002329143.1|; PP_03776 0.0 Click
25complement(3852807..3852962) phage protein [Escherichia coli SE15] gi|387829945|ref|YP_003349882.1|; PP_03777 2e-11 Click
263853052..3854725 PHAGE_Escher_P13374: phage tail fibre; PP_03778; phage(gi410491660) 0.0 Click
273854793..3855047 hypothetical; PP_03779 0.0 Click
28complement(3855124..3856572) PHAGE_Entero_HK630: tail fiber J; PP_03780; phage(gi428782808) 0.0 Click
293856595..3856786 PHAGE_Escher_TL_2011c: putative late gene regulator Q; PP_03781; phage(gi418487066) 6e-31 Click
303857140..3857216 tRNA 0.0 Click
313857363..3858598 regulator of arylsulfatase activity [Escherichia coli O104:H4 str. 2011C-3493] gi|407484472|ref|YP_006781622.1|; PP_03782 0.0 Click
32complement(3858682..3858843) hypothetical protein SSON53_22815 [Shigella sonnei 53G] gi|383181046|ref|YP_005459051.1|; PP_03783 1e-22 Click
33complement(3858986..3859123) hypothetical protein EcHS_A4021 [Escherichia coli HS] gi|157163274|ref|YP_001460592.1|; PP_03784 7e-17 Click
34complement(3859522..3860718) putative protoheme IX biogenesis protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407484470|ref|YP_006781620.1|; PP_03785 0.0 Click
35complement(3860721..3861938) PHAGE_Pseudo_virus: immunodominant envelope protein; PP_03786; phage(gi289183823) 2e-05 Click
36complement(3861960..3862700) uroporphyrinogen-III synthase [Escherichia coli O26:H11 str. 11368] gi|260857793|ref|YP_003231684.1|; PP_03787 1e-138 Click
37complement(3862697..3863638) hydroxymethylbilane synthase [Escherichia coli W] gi|386611180|ref|YP_006126666.1|; PP_03788 1e-173 Click
383864025..3866571 adenylate cyclase [Shigella sonnei Ss046] gi|74314317|ref|YP_312736.1|; PP_03789 0.0 Click
39complement(3866611..3866931) frataxin-like protein [Shigella sonnei Ss046] gi|74314319|ref|YP_312737.1|; PP_03790 1e-58 Click
40complement(3866979..3868304) hypothetical protein O3K_24840 [Escherichia coli O104:H4 str. 2011C-3493] gi|407484464|ref|YP_006781614.1|; PP_03791 0.0 Click
41complement(3868301..3869809) hypothetical protein ECIAI1_3996 [Escherichia coli IAI1] gi|218556368|ref|YP_002389282.1|; PP_03792 0.0 Click
423870086..3871213 PROPHAGE_Escher_Sakai: putative transposase; PP_03793; phage(gi38704244) 0.0 Click
433871253..3872524 PHAGE_Escher_P13374: hypothetical protein; PP_03794; phage(gi410491673) 0.0 Click
443872563..3872802 hypothetical protein ECO26_5485 [Escherichia coli O26:H11 str. 11368] gi|260858460|ref|YP_003232351.1|; PP_03795 6e-35 Click
453873346..3873534 PHAGE_Escher_TL_2011c: hypothetical protein; PP_03796; phage(gi418487081) 7e-16 Click
463873780..3874079 PHAGE_Pseudo_YuA: hypothetical protein; PP_03797; phage(gi162135127) 3e-05 Click
47complement(3874180..3874500) hypothetical protein ECBD_3159 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253774513|ref|YP_003037344.1|; PP_03798 2e-42 Click
483874564..3874917 PHAGE_Entero_HK630: tail component K; PP_03799; phage(gi428782806) 2e-67 Click
493874922..3875236 PHAGE_Escher_P13374: hypothetical protein; PP_03800; phage(gi410491668) 2e-56 Click
503875330..3875986 PHAGE_Escher_P13374: hypothetical protein; PP_03801; phage(gi410491669) 5e-122 Click
51complement(3875946..3876224) hypothetical protein O3K_00280 [Escherichia coli O104:H4 str. 2011C-3493] gi|407479643|ref|YP_006776792.1|; PP_03802 2e-35 Click
52complement(3876287..3876454) putative radC-like protein yeeS [Escherichia coli str. 'clone D i2'] gi|386630796|ref|YP_006150516.1|; PP_03803 6e-24 Click
53complement(3876426..3876575) PHAGE_Entero_HK630: tail fiber J; PP_03804; phage(gi428782808) 2e-16 Click
54complement(3876636..3876809) PHAGE_Entero_HK630: tail component I; PP_03805; phage(gi428782807) 9e-24 Click

Region 7, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14065127..4066131 PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_03993; phage(gi16129935) 0.0 Click
2complement(4066210..4067790) PHAGE_Escher_P13374: phage portal protein; PP_03994; phage(gi410491653) 0.0 Click
34067772..4068335 PHAGE_Escher_P13374: hypothetical protein; PP_03995; phage(gi410491654) 3e-92 Click
44068359..4069573 PHAGE_Escher_P13374: structural protein; PP_03996; phage(gi410491655) 0.0 Click
5complement(4069748..4071103) PHAGE_Escher_P13374: hypothetical protein; PP_03997; phage(gi410491673) 0.0 Click
64071161..4071721 PHAGE_Entero_HK630: tail length tape measure protein H; PP_03998; phage(gi428782803) 1e-87 Click
7complement(4071687..4071923) hypothetical protein O3K_00265 [Escherichia coli O104:H4 str. 2011C-3493] gi|407479640|ref|YP_006776789.1|; PP_03999 2e-37 Click
8complement(4071946..4072209) PHAGE_Entero_HK630: Bet protein; PP_04000; phage(gi428782823) 1e-37 Click
9complement(4072273..4072947) porin [Escherichia coli KO11FL] gi|378712599|ref|YP_005277492.1|; PP_04001 3e-128 Click
10complement(4072941..4073333) Outer membrane protein N [Escherichia coli P12b] gi|386704253|ref|YP_006168100.1|; PP_04002 4e-60 Click
11complement(4073712..4073846) hypothetical; PP_04003 0.0 Click
124073961..4074263 inner membrane protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407481510|ref|YP_006778659.1|; PP_04004 1e-53 Click
134074303..4074998 PHAGE_Marseillevirus: metal dependent phosphohydrolase; PP_04005; phage(gi284504106) 2e-06 Click
144075065..4076483 PHAGE_Burkho_KL3: gp47; PP_04006; phage(gi327198092) 1e-101 Click
154076464..4076934 PHAGE_Burkho_KL3: gp46; PP_04007; phage(gi327198091) 3e-35 Click
16complement(4076923..4077843) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; PP_04008; phage(gi163932195) 9e-05 Click

Region 8, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14094858..4095289 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; PP_04037; phage(gi311992758) 3e-06 Click
24095522..4096073 putative kinase inhibitor [Escherichia coli O104:H4 str. 2011C-3493] gi|407481538|ref|YP_006778687.1|; PP_04038 3e-105 Click
34096083..4096880 putative transcriptional regulator [Escherichia coli SE15] gi|387829839|ref|YP_003349776.1|; PP_04039 2e-152 Click
44097646..4097891 PROPHAGE_Escher_MG1655: IS1 transposase B; PP_04040; phage(gi16131317) 9e-43 Click
5complement(4097854..4098123) PHAGE_Entero_HK630: minor tail protein L; PP_04041; phage(gi428782805) 8e-39 Click
64098232..4098429 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04042; phage(gi418487081) 1e-33 Click
74098785..4099348 PHAGE_Escher_P13374: antirepressor antB; PP_04043; phage(gi410491605) 1e-100 Click
84099430..4100104 DNA helicase I [Escherichia coli UTI89] gi|91206383|ref|YP_538737.1|; PP_04044 2e-114 Click
94100109..4103822 PHAGE_Acinet_Acj9: Dda DNA helicase; PP_04045; phage(gi311993295) 5e-06 Click
104103898..4104035 DNA helicase I [Escherichia coli UTI89] gi|91206383|ref|YP_538737.1|; PP_04046 1e-16 Click
114104055..4104801 PHAGE_Xantho_Cf1c: hypothetical protein Cf1cp5; PP_04047; phage(gi17975752) 2e-13 Click

Region 9, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14263238..4263729 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; PP_04236; phage(gi116221995) 2e-14 Click
24263753..4264220 PHAGE_Yersin_413C: gpR; PP_04237; phage(gi30065716) 5e-17 Click
34264213..4264848 PHAGE_Pseudo_phiCTX: predicted tail completion; PP_04238; phage(gi17313233) 1e-19 Click
44264845..4265426 PHAGE_Yersin_413C: gpV; PP_04239; phage(gi30065718) 1e-43 Click
54265423..4265773 PHAGE_Yersin_413C: gpW; PP_04240; phage(gi30065719) 3e-21 Click
64265777..4266673 PHAGE_Yersin_413C: gpJ; PP_04241; phage(gi30065720) 9e-85 Click
74266666..4267196 PHAGE_Yersin_413C: gpI; PP_04242; phage(gi30065721) 6e-62 Click
84267199..4268983 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_04243; phage(gi16129506) 4e-91 Click
9complement(4269554..4269724) hypothetical; PP_04244 0.0 Click
104269874..4270551 PHAGE_Stx2_c_1717: truncated transposase; PP_04245; phage(gi209447151) 4e-20 Click
114270551..4270898 PHAGE_Stx2_c_1717: transposase; PP_04246; phage(gi209447152) 2e-45 Click
124270918..4272540 PHAGE_Stx2_c_1717: transposase; PP_04247; phage(gi209447153) 6e-142 Click
13complement(4272812..4273516) PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_04248; phage(gi148609400) 2e-129 Click

Region 10, total : 242 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14277492..4277503 attL    AGGGGACGCCAC 0.0 Click
2complement(4277595..4277882) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_04261; phage(gi157166067) 9e-43 Click
3complement(4277882..4278007) PHAGE_Stx2_c_II: putative transposase; PP_04262; phage(gi302393161) 5e-16 Click
4complement(4278209..4278445) hypothetical protein O3K_09515 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481455|ref|YP_006778604.1|; PP_04263 7e-37 Click
54278671..4279312 ImpA family type VI secretion-associated protein [Escherichia coli APEC O78] gi|443617516|ref|YP_007381372.1|; PP_04264 4e-62 Click
64279373..4279810 PHAGE_Entero_4795: putative tail fiber protein; PP_04265; phage(gi157166060) 2e-59 Click
74280101..4280379 hypothetical protein ECSF_4171 [Escherichia coli SE15] gi|387832224|ref|YP_003352161.1|; PP_04266 5e-46 Click
8complement(4280430..4281506) PHAGE_Brocho_BL3: gp26; PP_04267; phage(gi327409418) 2e-25 Click
94281577..4281702 hypothetical protein ECSF_4169 [Escherichia coli SE15] gi|387832222|ref|YP_003352159.1|; PP_04268 1e-15 Click
10complement(4281996..4282292) transcriptional regulator [Escherichia coli SE15] gi|387832220|ref|YP_003352157.1|; PP_04269 1e-47 Click
11complement(4282552..4282671) hypothetical protein EC55989_4907 [Escherichia coli 55989] gi|218698097|ref|YP_002405764.1|; PP_04270 2e-14 Click
124283285..4283572 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_04271; phage(gi414086954) 3e-06 Click
13complement(4283678..4284322) PROPHAGE_Escher_CFT073: transposase; PP_04272; phage(gi26248346) 5e-57 Click
144284302..4284649 PHAGE_Stx2_c_1717: transposase; PP_04273; phage(gi209447153) 7e-64 Click
15complement(4284894..4285142) PHAGE_Entero_mEp460: side tail fiber protein; PP_04274; phage(gi428782336) 2e-31 Click
164285582..4285842 ImpA family type VI secretion-associated protein [Escherichia coli W] gi|386608817|ref|YP_006124303.1|; PP_04275 1e-36 Click
174285811..4286122 Vgr protein [Shigella sonnei Ss046] gi|74311105|ref|YP_309524.1|; PP_04276 1e-35 Click
18complement(4286127..4286202) tRNA 0.0 Click
19complement(4286230..4286439) PHAGE_Escher_P13374: hypothetical protein; PP_04277; phage(gi410491673) 3e-29 Click
20complement(4286474..4286683) PHAGE_Escher_P13374: hypothetical protein; PP_04278; phage(gi410491673) 2e-27 Click
214286943..4287042 tRNA 0.0 Click
224287071..4287157 tRNA 0.0 Click
23complement(4287232..4287420) antigen 43 (Ag43) phase-variable biofilm formation autotransporter, CP4-44 prophage [Escherichia coli O104:H4 str. 2011C-3493] gi|407480425|ref|YP_006777574.1|; PP_04279 1e-26 Click
24complement(4287699..4288103) rhs core protein with extension [Shigella sonnei Ss046] gi|74312183|ref|YP_310602.1|; PP_04280 3e-46 Click
254288130..4288339 antirestriction protein of plasmid origin [Escherichia coli S88] gi|218558882|ref|YP_002391795.1|; PP_04281 3e-19 Click
26complement(4288685..4289047) PHAGE_Escher_P13374: hypothetical protein; PP_04282; phage(gi410491670) 8e-44 Click
27complement(4289034..4289327) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip045; PP_04283; phage(gi20065841) 9e-43 Click
284289454..4289627 hypothetical protein i02_1111 [Escherichia coli str. 'clone D i2'] gi|386628598|ref|YP_006148318.1|; PP_04284 1e-24 Click
29complement(4289777..4289947) 2-dehydro-3-deoxyphosphooctonate aldolase [Shigella sonnei Ss046] gi|74312446|ref|YP_310865.1|; PP_04285 3e-25 Click
30complement(4289916..4290329) rhsD element protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407483323|ref|YP_006780472.1|; PP_04286 2e-57 Click
31complement(4290366..4290620) Rhs element protein [Shigella sonnei Ss046] gi|74312186|ref|YP_310605.1|; PP_04287 2e-26 Click
324290596..4290994 antigen 43 precursor (AG43) (Fluffing protein) [Escherichia coli S88] gi|218561452|ref|YP_002394365.1|; PP_04288 2e-53 Click
334291209..4291367 hypothetical protein i02_3354 [Escherichia coli str. 'clone D i2'] gi|386630794|ref|YP_006150514.1|; PP_04289 2e-18 Click
34complement(4291633..4291818) PHAGE_Stx2_c_1717: transposase; PP_04290; phage(gi209447153) 2e-17 Click
354291909..4292166 PROPHAGE_Escher_CFT073: transposase insF; PP_04291; phage(gi26250329) 7e-19 Click
36complement(4292335..4292469) hypothetical protein EC55989_4657 [Escherichia coli 55989] gi|218697863|ref|YP_002405530.1|; PP_04292 2e-16 Click
374292489..4292695 hypothetical; PP_04293 0.0 Click
38complement(4293098..4293958) PHAGE_Entero_mEp460: tail assembly protein; PP_04294; phage(gi428782333) 2e-42 Click
394293933..4294139 RADC family DNA repair protein [Shigella flexneri 2a str. 301] gi|24114260|ref|NP_708770.1|; PP_04295 5e-31 Click
40complement(4294172..4294387) hypothetical protein i02_0241, partial [Escherichia coli str. 'clone D i2'] gi|386627742|ref|YP_006147462.1|; PP_04296 5e-13 Click
41complement(4295103..4295216) hypothetical; PP_04297 0.0 Click
42complement(4295253..4295741) PHAGE_Escher_P13374: hypothetical protein; PP_04298; phage(gi410491673) 1e-61 Click
434295792..4296289 PHAGE_Escher_P13374: hypothetical protein; PP_04299; phage(gi410491607) 2e-28 Click
44complement(4296199..4296274) tRNA 0.0 Click
45complement(4296317..4296393) tRNA 0.0 Click
46complement(4296419..4296631) hypothetical; PP_04300 0.0 Click
474296598..4296897 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_04301; phage(gi414086954) 1e-11 Click
484296928..4297296 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_04302; phage(gi157166063) 8e-49 Click
494297566..4297751 PHAGE_Entero_mEp460: Lom protein; PP_04303; phage(gi428782335) 9e-19 Click
504297903..4298538 PHAGE_Entero_mEp460: side tail fiber protein; PP_04304; phage(gi428782336) 2e-79 Click
51complement(4298665..4298808) CP4-44 prophage YeeV-YeeU toxin-antitoxin system toxin [Escherichia coli O104:H4 str. 2011C-3493] gi|407482613|ref|YP_006779762.1|; PP_04305 4e-21 Click
524299067..4299606 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_04306; phage(gi16129505) 2e-68 Click
534299618..4299902 hypothetical protein O3K_04250 [Escherichia coli O104:H4 str. 2011C-3493] gi|407480431|ref|YP_006777580.1|; PP_04307 3e-49 Click
544299940..4300053 hypothetical; PP_04308 0.0 Click
554300050..4300883 PHAGE_Erwini_phiEaH2: hypothetical protein; PP_04309; phage(gi431810676) 6e-08 Click
564301158..4301319 PHAGE_Stx2_c_1717: truncated transposase; PP_04310; phage(gi209447151) 5e-23 Click
574301316..4301663 PHAGE_Stx2_c_1717: transposase; PP_04311; phage(gi209447152) 2e-62 Click
584301713..4302855 PHAGE_Stx2_c_1717: transposase; PP_04312; phage(gi209447153) 0.0 Click
59complement(4302930..4303124) hypothetical protein ECS88_4892 [Escherichia coli S88] gi|218561453|ref|YP_002394366.1|; PP_04313 9e-31 Click
60complement(4303274..4303603) PHAGE_Entero_HK630: minor tail protein M; PP_04314; phage(gi428782804) 2e-51 Click
61complement(4303710..4304039) PHAGE_Entero_HK630: minor tail protein M; PP_04315; phage(gi428782804) 4e-60 Click
62complement(4304091..4304426) PHAGE_Escher_P13374: hypothetical protein; PP_04316; phage(gi410491642) 5e-43 Click
634304603..4304716 hypothetical protein ECS88_4897 [Escherichia coli S88] gi|218561458|ref|YP_002394371.1|; PP_04317 4e-14 Click
64complement(4304995..4305438) hypothetical protein O3K_13210 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482181|ref|YP_006779330.1|; PP_04318 6e-84 Click
65complement(4305435..4305797) PHAGE_Escher_P13374: hypothetical protein; PP_04319; phage(gi410491673) 8e-62 Click
66complement(4305755..4306297) PHAGE_Escher_P13374: hypothetical protein; PP_04320; phage(gi410491673) 4e-75 Click
674306419..4306808 PHAGE_Stx2_c_1717: transposase; PP_04321; phage(gi209447153) 5e-43 Click
684306771..4307382 PHAGE_Escher_P13374: hypothetical protein; PP_04322; phage(gi410491654) 4e-87 Click
694307379..4307792 PHAGE_Escher_P13374: hypothetical protein; PP_04323; phage(gi410491654) 6e-63 Click
704307823..4308224 hypothetical protein O3O_25190 [Escherichia coli O104:H4 str. 2009EL-2071] gi|407471665|ref|YP_006781892.1|; PP_04324 1e-76 Click
71complement(4308243..4308446) PHAGE_Entero_Sf6: putative transposase OrfB; PP_04325; phage(gi41057343) 3e-30 Click
72complement(4308770..4308907) hypothetical protein ETEC_2134 [Escherichia coli ETEC H10407] gi|387612580|ref|YP_006115696.1|; PP_04326 2e-05 Click
73complement(4308983..4309255) PHAGE_Stx2_c_1717: transposase; PP_04327; phage(gi209447153) 1e-30 Click
74complement(4309360..4309794) PHAGE_Entero_phiP27: putative DNA methylase; PP_04328; phage(gi18249888) 1e-64 Click
754309835..4310029 hypothetical; PP_04329 0.0 Click
76complement(4310054..4310173) hypothetical protein SPAB_05365 [Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7] gi|161617506|ref|YP_001591471.1|; PP_04330 1e-05 Click
77complement(4310211..4310333) hypothetical; PP_04331 0.0 Click
78complement(4310344..4310595) PHAGE_Escher_P13374: hypothetical protein; PP_04332; phage(gi410491671) 2e-40 Click
79complement(4310605..4310874) PHAGE_Escher_P13374: hypothetical protein; PP_04333; phage(gi410491670) 4e-40 Click
80complement(4310881..4311132) PHAGE_Escher_P13374: hypothetical protein; PP_04334; phage(gi410491671) 8e-36 Click
81complement(4311142..4311336) PHAGE_Escher_P13374: hypothetical protein; PP_04335; phage(gi410491670) 1e-28 Click
82complement(4311341..4311823) PHAGE_Marino_P12026: putative DNA modification methylase; PP_04336; phage(gi399528347) 4e-06 Click
83complement(4312324..4312533) hypothetical; PP_04337 0.0 Click
844312624..4313055 PROPHAGE_Escher_CFT073: transposase; PP_04338; phage(gi26248360) 1e-56 Click
854313091..4313225 hypothetical protein EC042_0618 [Escherichia coli 042] gi|387606082|ref|YP_006094938.1|; PP_04339 7e-13 Click
864313408..4313560 regulatory peptide MokC [Shigella sonnei 53G] gi|383177147|ref|YP_005455152.1|; PP_04340 3e-20 Click
874313691..4313939 fragment of prepilin, shufflon protein (C-ter part), partial [Escherichia coli ED1a] gi|218691164|ref|YP_002399376.1|; PP_04341 2e-26 Click
88complement(4314015..4314719) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; PP_04342; phage(gi15832203) 7e-94 Click
894314756..4314914 hypothetical; PP_04343 0.0 Click
904315075..4315227 PHAGE_Stx2_c_86: DNA modification methylase; PP_04344; phage(gi116222073) 8e-22 Click
91complement(4315242..4315778) PHAGE_Escher_P13374: lysis protein, lysozyme; PP_04345; phage(gi410491646) 5e-88 Click
92complement(4315881..4316360) PHAGE_Escher_P13374: hypothetical protein; PP_04346; phage(gi410491642) 2e-24 Click
93complement(4316503..4316694) hypothetical; PP_04347 0.0 Click
944316865..4317113 hypothetical protein i02_2323 [Escherichia coli str. 'clone D i2'] gi|386629788|ref|YP_006149508.1|; PP_04348 5e-38 Click
954317132..4317290 hypothetical; PP_04349 0.0 Click
96complement(4317375..4317494) hypothetical; PP_04350 0.0 Click
97complement(4318125..4318292) PROPHAGE_Escher_Sakai: integrase; PP_04351; phage(gi15833097) 3e-27 Click
98complement(4318336..4318464) hypothetical protein ECNA114_4521 [Escherichia coli NA114] gi|386622064|ref|YP_006141644.1|; PP_04352 5e-07 Click
99complement(4318643..4318906) hypothetical protein O3K_21975 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483908|ref|YP_006781057.1|; PP_04353 1e-47 Click
100complement(4319050..4319592) PHAGE_Escher_P13374: phage portal protein; PP_04354; phage(gi410491653) 3e-81 Click
101complement(4319618..4320118) PHAGE_Rhodoc_RER2: antirestriction protein; PP_04355; phage(gi372449960) 6e-13 Click
1024320160..4320846 PHAGE_Escher_P13374: hypothetical protein; PP_04356; phage(gi410491642) 6e-50 Click
1034320887..4321000 PHAGE_Escher_P13374: hypothetical protein; PP_04357; phage(gi410491656) 2e-14 Click
1044321050..4321673 PHAGE_Escher_P13374: hypothetical protein; PP_04358; phage(gi410491657) 5e-82 Click
1054321724..4322209 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04359; phage(gi418487104) 8e-75 Click
1064322169..4322507 PROPHAGE_Escher_MG1655: IS150 transposase B; PP_04360; phage(gi16131429) 3e-38 Click
107complement(4323277..4323486) hypothetical protein O3K_00365 [Escherichia coli O104:H4 str. 2011C-3493] gi|407479660|ref|YP_006776809.1|; PP_04361 9e-34 Click
108complement(4323483..4323662) hypothetical protein O3K_00360 [Escherichia coli O104:H4 str. 2011C-3493] gi|407479659|ref|YP_006776808.1|; PP_04362 6e-12 Click
109complement(4323747..4324169) hypothetical; PP_04363 0.0 Click
1104324169..4324291 hypothetical; PP_04364 0.0 Click
1114324288..4324602 PHAGE_Escher_P13374: hypothetical protein; PP_04365; phage(gi410491668) 2e-53 Click
112complement(4324643..4325008) hypothetical; PP_04366 0.0 Click
113complement(4324974..4326401) PHAGE_Stx2_c_1717: putative tail fiber protein; PP_04367; phage(gi209447198) 2e-119 Click
114complement(4326401..4326649) PHAGE_Entero_HK630: tail fiber assembly protein; PP_04368; phage(gi428782810) 2e-36 Click
115complement(4326649..4327245) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_04369; phage(gi16129506) 1e-60 Click
1164327260..4327901 PHAGE_Escher_TL_2011c: putative portal protein; PP_04370; phage(gi418487074) 9e-124 Click
1174327996..4328796 PHAGE_Escher_P13374: phage portal protein; PP_04371; phage(gi410491653) 4e-125 Click
118complement(4328800..4328925) hypothetical protein ECS88_1384 [Escherichia coli S88] gi|218558234|ref|YP_002391147.1|; PP_04373 5e-16 Click
1194328979..4329110 hypothetical; PP_04372 0.0 Click
120complement(4329212..4329340) PHAGE_Entero_mEp460: tail assembly protein; PP_04374; phage(gi428782333) 1e-16 Click
121complement(4329342..4330001) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; PP_04375; phage(gi116221997) 4e-117 Click
122complement(4330006..4330137) PHAGE_Escher_P13374: lysis protein, holin; PP_04376; phage(gi410491645) 2e-15 Click
1234330186..4330380 hypothetical protein ECS88_2103 [Escherichia coli S88] gi|218558886|ref|YP_002391799.1|; PP_04377 1e-28 Click
1244330393..4330506 hypothetical protein O3K_09400 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481434|ref|YP_006778583.1|; PP_04378 7e-13 Click
1254330844..4331749 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; PP_04379; phage(gi169257235) 2e-154 Click
1264331730..4332563 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; PP_04380; phage(gi169257235) 1e-153 Click
127complement(4332533..4333363) PHAGE_Stx2_c_1717: transposase; PP_04381; phage(gi209447153) 7e-102 Click
128complement(4333341..4333619) PHAGE_Escher_P13374: antitermination; PP_04382; phage(gi410491621) 6e-47 Click
129complement(4333849..4333962) PHAGE_Escher_P13374: antirepressor antB; PP_04383; phage(gi410491622) 3e-16 Click
130complement(4334094..4334402) PHAGE_Entero_HK630: tail fiber assembly protein; PP_04384; phage(gi428782810) 2e-36 Click
131complement(4334402..4335034) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_04385; phage(gi16129506) 2e-117 Click
1324335105..4335596 hypothetical protein O3K_15405 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482611|ref|YP_006779760.1|; PP_04386 2e-88 Click
1334335608..4335805 hypothetical protein O3K_15400 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482610|ref|YP_006779759.1|; PP_04387 5e-30 Click
134complement(4335809..4335937) hypothetical; PP_04388 0.0 Click
135complement(4335888..4336727) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp35; PP_04389; phage(gi116222027) 2e-157 Click
1364336743..4338536 rhsD element protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407483323|ref|YP_006780472.1|; PP_04390 4e-166 Click
1374338821..4339468 hypothetical; PP_04391 0.0 Click
1384339461..4340444 PHAGE_Escher_P13374: hypothetical protein; PP_04392; phage(gi410491642) 2e-67 Click
139complement(4341032..4341187) hypothetical; PP_04393 0.0 Click
140complement(4341566..4342108) rhsC element core protein RshC [Escherichia coli P12b] gi|386703870|ref|YP_006167717.1|; PP_04394 1e-108 Click
1414342308..4342508 hypothetical protein O3K_09520 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481456|ref|YP_006778605.1|; PP_04395 8e-33 Click
142complement(4343354..4343494) PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_04396; phage(gi410491667) 1e-15 Click
143complement(4343685..4343945) PHAGE_Yersin_413C: Ogr; PP_04397; phage(gi30065732) 6e-07 Click
144complement(4344032..4345114) PHAGE_Escher_P13374: hypothetical protein; PP_04399; phage(gi410491673) 1e-162 Click
1454345129..4345365 putative mercury resistance protein [Salmonella enterica subsp. enterica serovar Typhimurium str. T000240] gi|378986475|ref|YP_005249631.1|; PP_04398 3e-38 Click
1464345362..4346162 hypothetical protein STMDT12_C39340 [Salmonella enterica subsp. enterica serovar Typhimurium str. T000240] gi|378986474|ref|YP_005249630.1|; PP_04400 1e-122 Click
1474346201..4346851 PHAGE_Aeromo_vB_AsaM_56: putative methylase; PP_04401; phage(gi422937523) 5e-12 Click
148complement(4347240..4347371) hypothetical protein SDY_1443 [Shigella dysenteriae Sd197] gi|82776726|ref|YP_403075.1|; PP_04402 9e-18 Click
1494347700..4347816 hypothetical; PP_04403 0.0 Click
150complement(4347871..4347947) tRNA 0.0 Click
151complement(4347961..4348037) tRNA 0.0 Click
1524348356..4348493 hypothetical protein EcHS_A2133 [Escherichia coli HS] gi|157161487|ref|YP_001458805.1|; PP_04404 3e-16 Click
153complement(4348838..4348978) haemolysin expression modulating protein Hha [Escherichia coli O26:H11 str. 11368] gi|260858453|ref|YP_003232344.1|; PP_04405 1e-18 Click
1544349290..4349448 IS66 transposase [Escherichia coli O104:H4 str. 2011C-3493] gi|407482625|ref|YP_006779774.1|; PP_04406 2e-21 Click
1554350241..4351503 PHAGE_Entero_Mu: tail fiber fragment; PP_04407; phage(gi19584574) 7e-62 Click
1564351886..4352317 hypothetical protein SSON_2178 [Shigella sonnei Ss046] gi|74312645|ref|YP_311064.1|; PP_04408 5e-77 Click
157complement(4352275..4352403) hypothetical; PP_04409 0.0 Click
1584352408..4353226 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip021; PP_04410; phage(gi20065817) 3e-31 Click
1594353289..4353507 PHAGE_Escher_P13374: phage tail fibre; PP_04411; phage(gi410491660) 2e-24 Click
1604353830..4353946 PHAGE_Escher_P13374: hypothetical protein; PP_04412; phage(gi410491674) 1e-16 Click
161complement(4354012..4354602) PHAGE_Escher_P13374: hypothetical protein; PP_04413; phage(gi410491673) 5e-106 Click
1624354758..4355312 hypothetical protein O3K_24830 [Escherichia coli O104:H4 str. 2011C-3493] gi|407484462|ref|YP_006781612.1|; PP_04414 2e-107 Click
163complement(4355629..4356813) PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_04415; phage(gi148609400) 0.0 Click
164complement(4356874..4357209) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; PP_04416; phage(gi209447168) 3e-46 Click
165complement(4357335..4357484) hypothetical protein i02_1307 [Escherichia coli str. 'clone D i2'] gi|386628791|ref|YP_006148511.1|; PP_04417 3e-19 Click
1664357470..4357934 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_04418; phage(gi209427766) 6e-83 Click
167complement(4357920..4358393) PHAGE_Stx2_c_86: lysozyme protein R; PP_04419; phage(gi116221999) 4e-88 Click
1684358522..4358836 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; PP_04420; phage(gi116221998) 1e-57 Click
169complement(4358846..4359358) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; PP_04421; phage(gi116221997) 6e-39 Click
1704359397..4359522 hypothetical; PP_04422 0.0 Click
171complement(4360294..4361394) PHAGE_Acanth_1: hypothetical protein ATCV1_Z752L; PP_04423; phage(gi155371699) 1e-14 Click
1724361529..4362680 PROPHAGE_Escher_MG1655: IS30 transposase; PP_04424; phage(gi16132105) 0.0 Click
173complement(4362737..4363387) PHAGE_Escher_P13374: hypothetical protein; PP_04425; phage(gi410491659) 2e-111 Click
174complement(4363387..4363950) PHAGE_Escher_P13374: hypothetical protein; PP_04426; phage(gi410491658) 1e-82 Click
175complement(4364035..4364685) PHAGE_Escher_P13374: hypothetical protein; PP_04427; phage(gi410491659) 1e-122 Click
176complement(4364685..4365248) PHAGE_Escher_P13374: hypothetical protein; PP_04428; phage(gi410491658) 2e-104 Click
177complement(4365501..4366070) hypothetical protein O3K_18130 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483151|ref|YP_006780300.1|; PP_04429 2e-106 Click
178complement(4366067..4366267) RhsC core protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407483152|ref|YP_006780301.1|; PP_04430 4e-33 Click
179complement(4366786..4367904) PROPHAGE_Escher_MG1655: IS186 transposase; PP_04431; phage(gi90111427) 0.0 Click
180complement(4367942..4368397) PHAGE_Escher_P13374: endopeptidase; PP_04432; phage(gi410491649) 3e-47 Click
181complement(4368354..4368467) hypothetical protein ECO26_1133 [Escherichia coli O26:H11 str. 11368] gi|260854298|ref|YP_003228189.1|; PP_04433 4e-13 Click
182complement(4368603..4368731) endolysin [Escherichia coli O55:H7 str. CB9615] gi|291282468|ref|YP_003499286.1|; PP_04434 4e-10 Click
183complement(4368688..4369221) PHAGE_Stx2_c_II: endolysin; PP_04435; phage(gi302393165) 3e-93 Click
1844369327..4370232 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; PP_04436; phage(gi169257230) 6e-150 Click
1854370236..4370652 PHAGE_Entero_HK225: head assembly protein Fi; PP_04437; phage(gi428782384) 5e-05 Click
1864370833..4371258 PHAGE_Pseudo_YuA: hypothetical protein; PP_04438; phage(gi162135127) 8e-14 Click
1874371305..4371727 hypothetical protein SeHA_A0048 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447295|ref|YP_002043886.1|; PP_04439 2e-71 Click
1884371724..4371915 hypothetical protein ECH74115_B0058 [Escherichia coli O157:H7 str. EC4115] gi|209395559|ref|YP_002268439.1|; PP_04440 1e-28 Click
189complement(4372106..4372276) phage head-Tail Attachment [Escherichia coli O55:H7 str. CB9615] gi|291283169|ref|YP_003499987.1|; PP_04441 7e-13 Click
190complement(4372269..4372652) PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; PP_04442; phage(gi169257229) 5e-12 Click
191complement(4372704..4373585) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; PP_04443; phage(gi169257230) 2e-151 Click
192complement(4373557..4374408) adhesin [Escherichia coli O26:H11 str. 11368] gi|260858461|ref|YP_003232352.1|; PP_04444 1e-151 Click
193complement(4374587..4374979) adhesin [Escherichia coli O26:H11 str. 11368] gi|260858461|ref|YP_003232352.1|; PP_04445 3e-67 Click
194complement(4374976..4375146) hypothetical; PP_04446 0.0 Click
1954375136..4375615 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip050; PP_04447; phage(gi20065846) 1e-84 Click
1964375739..4376014 hypothetical protein O3K_12640 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482069|ref|YP_006779218.1|; PP_04448 2e-44 Click
197complement(4376016..4376519) PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp26; PP_04449; phage(gi221328643) 1e-31 Click
198complement(4376516..4378030) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp35; PP_04450; phage(gi116222027) 0.0 Click
199complement(4378023..4379606) PHAGE_Escher_P13374: hypothetical protein; PP_04451; phage(gi410491673) 0.0 Click
2004379697..4380308 PHAGE_Salisa_1: hypothetical protein; PP_04452; phage(gi388570712) 5e-20 Click
201complement(4380315..4380494) hypothetical protein SFxv_5049 [Shigella flexneri 2002017] gi|384546186|ref|YP_005712098.1|; PP_04453 2e-07 Click
202complement(4380491..4380709) hypothetical protein SFxv_4931 [Shigella flexneri 2002017] gi|384546068|ref|YP_005711980.1|; PP_04454 2e-29 Click
2034381139..4382908 PHAGE_Escher_P13374: phage terminase large subunit; PP_04455; phage(gi410491652) 0.0 Click
204complement(4383858..4384916) PHAGE_Escher_P13374: hypothetical protein; PP_04456; phage(gi410491662) 6e-109 Click
205complement(4385084..4385596) PHAGE_Escher_P13374: tail fibre adesine; PP_04457; phage(gi410491661) 2e-96 Click
206complement(4385683..4386162) PHAGE_Escher_P13374: phage tail fibre; PP_04458; phage(gi410491660) 3e-69 Click
2074386465..4387823 hypothetical protein O3K_21995 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483912|ref|YP_006781061.1|; PP_04459 0.0 Click
208complement(4388167..4389009) hypothetical protein ECBD_0136 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253771567|ref|YP_003034398.1|; PP_04460 2e-156 Click
209complement(4389114..4389497) hypothetical protein ECW_m3869 [Escherichia coli W] gi|386610965|ref|YP_006126451.1|; PP_04461 2e-68 Click
210complement(4389739..4390182) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip047; PP_04462; phage(gi20065843) 5e-07 Click
2114390142..4391407 PHAGE_Escher_P13374: hypothetical protein; PP_04463; phage(gi410491672) 0.0 Click
2124391476..4392336 PHAGE_Escher_P13374: hypothetical protein; PP_04464; phage(gi410491673) 2e-121 Click
213complement(4392933..4394198) PHAGE_Escher_P13374: hypothetical protein; PP_04465; phage(gi410491672) 0.0 Click
2144394418..4394591 PROPHAGE_Shigel_301: serine protease; PP_04466; phage(gi24114949) 2e-21 Click
2154394723..4394923 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; PP_04467; phage(gi422937526) 2e-05 Click
2164395204..4395320 hypothetical; PP_04468 0.0 Click
2174395374..4395532 PROPHAGE_Escher_CFT073: putative transposase; PP_04469; phage(gi26246170) 8e-20 Click
2184395649..4396053 PROPHAGE_Escher_EDL933: putative transposase; PP_04470; phage(gi15803522) 5e-52 Click
219complement(4396211..4396792) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip030; PP_04471; phage(gi20065826) 6e-95 Click
220complement(4397133..4397255) PHAGE_Stx2_c_86: phage superinfection exclusion protein Cor like protein; PP_04472; phage(gi116222015) 1e-19 Click
221complement(4397373..4397918) PHAGE_Salmon_SSU5: putative receptor-recognising phage tail fiber adhesin; PP_04473; phage(gi410491432) 4e-45 Click
222complement(4398001..4398330) PHAGE_Escher_P13374: phage tail fibre; PP_04474; phage(gi410491660) 2e-40 Click
223complement(4398356..4399120) PHAGE_Escher_P13374: phage terminase small subunit; PP_04475; phage(gi410491651) 3e-92 Click
224complement(4399762..4399881) hypothetical; PP_04476 0.0 Click
2254400032..4400304 lipopolysaccharide core heptose(II)-phosphate phosphatase [Escherichia coli O104:H4 str. 2011C-3493] gi|407482045|ref|YP_006779194.1|; PP_04477 1e-47 Click
2264400397..4400516 hypothetical; PP_04478 0.0 Click
2274400521..4400691 hypothetical protein O3K_21945 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483902|ref|YP_006781051.1|; PP_04479 7e-25 Click
2284400863..4401060 hypothetical protein EC55989_4980 [Escherichia coli 55989] gi|218698159|ref|YP_002405826.1|; PP_04480 2e-33 Click
229complement(4401207..4401335) hypothetical protein ECNA114_2096 [Escherichia coli NA114] gi|386619620|ref|YP_006139200.1|; PP_04481 2e-16 Click
2304401892..4402569 hypothetical protein O3K_21940 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483901|ref|YP_006781050.1|; PP_04482 6e-127 Click
2314402736..4402849 hypothetical protein O3K_10465 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481639|ref|YP_006778788.1|; PP_04483 4e-13 Click
2324402865..4403050 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_04484; phage(gi209427772) 2e-19 Click
233complement(4403183..4403323) hypothetical protein ECS88_0566 [Escherichia coli S88] gi|218557476|ref|YP_002390389.1|; PP_04485 2e-18 Click
234complement(4403410..4403532) hypothetical protein CE10_1466 [Escherichia coli O7:K1 str. CE10] gi|386623829|ref|YP_006143557.1|; PP_04486 9e-15 Click
235complement(4403519..4403686) PHAGE_Entero_Sakai: hypothetical protein VT2-Sap50; PP_04487; phage(gi9633444) 4e-18 Click
236complement(4403674..4404132) PHAGE_Entero_4795: putative endopeptidase Rz; PP_04488; phage(gi157166036) 8e-68 Click
237complement(4404144..4404275) PHAGE_Escher_P13374: hypothetical protein; PP_04489; phage(gi410491648) 5e-12 Click
238complement(4404290..4404436) hypothetical protein O3K_10440 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481634|ref|YP_006778783.1|; PP_04490 1e-18 Click
239complement(4404629..4404754) PHAGE_Escher_P13374: lysis protein, lysozyme; PP_04491; phage(gi410491646) 8e-20 Click
240complement(4404732..4404845) PHAGE_Escher_P13374: hypothetical protein; PP_04492; phage(gi410491668) 5e-09 Click
241complement(4404902..4405042) PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_04493; phage(gi410491667) 5e-21 Click
242complement(4405277..4406014) PHAGE_Escher_P13374: outer membrane lom precursor; PP_04494; phage(gi410491666) 4e-92 Click
243complement(4406094..4406711) PHAGE_Escher_P13374: hypothetical protein; PP_04495; phage(gi410491665) 3e-117 Click
244complement(4406717..4406860) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp27; PP_04496; phage(gi116222019) 4e-23 Click
245complement(4407141..4407281) PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_04497; phage(gi410491667) 1e-21 Click
246complement(4407514..4408248) PHAGE_Escher_P13374: outer membrane lom precursor; PP_04498; phage(gi410491666) 4e-140 Click
247complement(4408339..4408956) PHAGE_Escher_P13374: hypothetical protein; PP_04499; phage(gi410491665) 4e-122 Click
248complement(4408962..4409105) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip035; PP_04500; phage(gi20065831) 3e-24 Click
249complement(4409382..4409582) PROPHAGE_Escher_MG1655: predicted transposase; PP_04501; phage(gi16131356) 1e-14 Click
250complement(4409626..4410372) PROPHAGE_Escher_MG1655: predicted transposase; PP_04502; phage(gi16131356) 9e-84 Click
2514415780..4415791 attR    AGGGGACGCCAC 0.0 Click

Region 11, total : 64 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14413964..4414015 attL    CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGT 0.0 Click
24418870..4419301 PHAGE_Entero_HK630: minor tail protein G; PP_04515; phage(gi428782801) 2e-45 Click
34419328..4419741 PHAGE_Entero_HK630: tail assembly protein GT; PP_04516; phage(gi428782802) 9e-49 Click
44419722..4421308 PHAGE_Entero_HK630: tail length tape measure protein H; PP_04517; phage(gi428782803) 0.0 Click
54421312..4421734 PROPHAGE_Escher_Sakai: putative minor tail protein; PP_04518; phage(gi15832205) 4e-74 Click
64421761..4422174 PHAGE_Entero_HK630: tail assembly protein GT; PP_04519; phage(gi428782802) 3e-45 Click
74422155..4423801 PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; PP_04520; phage(gi15832203) 0.0 Click
84423827..4426385 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_04521; phage(gi414087138) 2e-16 Click
94426375..4428963 PROPHAGE_Escher_CFT073: Pic serine protease precursor; PP_04522; phage(gi26246250) 0.0 Click
10complement(4429258..4431663) PHAGE_Synech_S_CBS4: tail fiber protein; PP_04523; phage(gi374531790) 2e-12 Click
11complement(4431741..4431866) hypothetical; PP_04524 0.0 Click
12complement(4432036..4432161) hypothetical protein i02_3350 [Escherichia coli str. 'clone D i2'] gi|386630790|ref|YP_006150510.1|; PP_04525 2e-15 Click
13complement(4432145..4432897) PHAGE_Escher_P13374: phage terminase small subunit; PP_04526; phage(gi410491651) 4e-135 Click
14complement(4432953..4433066) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; PP_04527; phage(gi20065959) 6e-17 Click
15complement(4433190..4433741) PHAGE_Escher_P13374: regulatory protein; PP_04528; phage(gi410491650) 4e-103 Click
16complement(4433944..4434372) PHAGE_Escher_P13374: endopeptidase; PP_04529; phage(gi410491649) 8e-75 Click
17complement(4434384..4434518) PHAGE_Escher_P13374: hypothetical protein; PP_04530; phage(gi410491648) 1e-17 Click
18complement(4434533..4435102) PHAGE_Escher_P13374: antirepressor; PP_04531; phage(gi410491647) 9e-107 Click
194435609..4435725 hypothetical; PP_04532 0.0 Click
204435918..4435929 attL    GGCTTTGAGTTT 0.0 Click
214436223..4437020 AraC family transcription regulator [Escherichia coli E24377A] gi|157149368|ref|YP_001451428.1|; PP_04533 1e-94 Click
224437121..4437525 PROPHAGE_Escher_CFT073: transposase insC; PP_04534; phage(gi26251004) 2e-23 Click
234437608..4437742 hypothetical; PP_04535 0.0 Click
24complement(4437768..4438592) PROPHAGE_Shewan_MR-1: IS110 family transposase; PP_04536; phage(gi24375433) 7e-40 Click
254438596..4438718 hypothetical; PP_04537 0.0 Click
26complement(4438704..4439114) anaerobic dimethyl sulfoxide reductase chain ynfG [Escherichia coli O104:H4 str. 2011C-3493] gi|407482001|ref|YP_006779150.1|; PP_04538 7e-50 Click
27complement(4439152..4440315) PHAGE_Salmon_epsilon34: Tyrosine integrase; PP_04539; phage(gi221328640) 5e-180 Click
284440557..4440594 attL    AAACCGCCCGAAGGCGGTTGTCAGTTGATTGATGTACG 0.0 Click
29complement(4440577..4440828) PHAGE_Escher_TL_2011c: putative bacteriophage protein; PP_04540; phage(gi418487053) 2e-39 Click
30complement(4440876..4441556) PHAGE_Stx2_c_1717: exonuclease; PP_04541; phage(gi209447136) 2e-130 Click
31complement(4441553..4442326) PHAGE_Stx2_c_I: Bet protein; PP_04542; phage(gi20065900) 1e-139 Click
32complement(4442298..4442522) hypothetical protein O3K_14190 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482375|ref|YP_006779524.1|; PP_04543 4e-36 Click
33complement(4442569..4442973) hypothetical protein O3K_14195 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482376|ref|YP_006779525.1|; PP_04544 5e-71 Click
34complement(4443109..4443294) hypothetical protein O3K_14200 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482377|ref|YP_006779526.1|; PP_04545 2e-28 Click
35complement(4443427..4443714) hypothetical protein O3K_14205 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482378|ref|YP_006779527.1|; PP_04546 2e-52 Click
36complement(4443793..4443936) PHAGE_Entero_mEp460: hypothetical protein; PP_04547; phage(gi428782374) 4e-21 Click
37complement(4443933..4444484) PHAGE_Entero_HK620: endopeptidase; PP_04548; phage(gi13559860) 6e-67 Click
38complement(4444500..4444616) hypothetical protein G2583_2456 [Escherichia coli O55:H7 str. CB9615] gi|291283181|ref|YP_003499999.1|; PP_04550 2e-12 Click
39complement(4444619..4444750) PHAGE_Escher_P13374: hypothetical protein; PP_04549; phage(gi410491648) 5e-11 Click
40complement(4444753..4444965) hypothetical protein O3K_14225 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482382|ref|YP_006779531.1|; PP_04551 1e-34 Click
41complement(4445043..4445576) PHAGE_Entero_4795: putative R protein; PP_04552; phage(gi157166033) 3e-102 Click
42complement(4445619..4445867) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; PP_04553; phage(gi116221997) 2e-32 Click
434446051..4448567 membrane protein, yeeR [Escherichia coli O104:H4 str. 2011C-3493] gi|407480424|ref|YP_006777573.1|; PP_04554 0.0 Click
444448643..4449098 hypothetical protein i02_3352 [Escherichia coli str. 'clone D i2'] gi|386630792|ref|YP_006150512.1|; PP_04555 2e-83 Click
45complement(4449219..4449407) hypothetical protein ETEC_4457 [Escherichia coli ETEC H10407] gi|387614880|ref|YP_006117996.1|; PP_04556 3e-28 Click
464449504..4449674 hypothetical protein ECSF_4197 [Escherichia coli SE15] gi|387832250|ref|YP_003352187.1|; PP_04557 4e-25 Click
474449715..4449831 hypothetical; PP_04558 0.0 Click
484449828..4449956 hypothetical; PP_04559 0.0 Click
494449923..4450075 hypothetical; PP_04560 0.0 Click
504450407..4450619 PROPHAGE_Escher_CFT073: transposase/IS protein; PP_04561; phage(gi26248359) 2e-08 Click
514451138..4451269 hypothetical; PP_04562 0.0 Click
52complement(4451289..4451438) hypothetical; PP_04563 0.0 Click
534451419..4451559 hypothetical; PP_04564 0.0 Click
54complement(4451760..4451900) hypothetical; PP_04565 0.0 Click
554452262..4453134 hypothetical protein ECSF_4199 [Escherichia coli SE15] gi|387832252|ref|YP_003352189.1|; PP_04566 1e-168 Click
56complement(4453141..4453839) hypothetical protein O3K_13230 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482185|ref|YP_006779334.1|; PP_04567 2e-114 Click
574454081..4456183 iron outer membrane receptor [Escherichia coli O104:H4 str. 2011C-3493] gi|407482186|ref|YP_006779335.1|; PP_04568 0.0 Click
58complement(4456219..4456884) colanic acid/biofilm transcriptional regulator [Escherichia coli O104:H4 str. 2011C-3493] gi|407482187|ref|YP_006779336.1|; PP_04569 2e-120 Click
59complement(4457128..4458438) PHAGE_Escher_P13374: phage integrase; PP_04570; phage(gi410491596) 0.0 Click
60complement(4458491..4458775) PHAGE_Escher_P13374: excisionase; PP_04571; phage(gi410491597) 1e-51 Click
614458801..4458838 attR    AAACCGCCCGAAGGCGGTTGTCAGTTGATTGATGTACG 0.0 Click
62complement(4458821..4459072) PHAGE_Escher_TL_2011c: putative bacteriophage protein; PP_04572; phage(gi418487053) 4e-41 Click
634459183..4459194 attR    GGCTTTGAGTTT 0.0 Click
644459334..4459456 PHAGE_Escher_P13374: hypothetical protein; PP_04573; phage(gi410491599) 4e-17 Click
65complement(4459437..4459790) PHAGE_Escher_P13374: hypothetical protein; PP_04574; phage(gi410491600) 3e-62 Click
66complement(4459826..4460038) PHAGE_Escher_P13374: hypothetical protein; PP_04575; phage(gi410491601) 1e-32 Click
67complement(4459998..4460624) PHAGE_Escher_P13374: methylase; PP_04576; phage(gi410491602) 2e-122 Click
68complement(4460621..4461052) PHAGE_Escher_P13374: regulatory protein; PP_04577; phage(gi410491603) 9e-63 Click
694461241..4461408 PROPHAGE_Escher_CFT073: prophage P4 integrase; PP_04578; phage(gi26251024) 1e-27 Click
704474747..4474798 attR    CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGT 0.0 Click

Region 12, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14519114..4519368 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF79; PP_04654; phage(gi157166064) 1e-22 Click
2complement(4519777..4519965) hypothetical protein SSON53_18270 [Shigella sonnei 53G] gi|383180153|ref|YP_005458158.1|; PP_04655 1e-24 Click
34520053..4520853 putative plasmid transfer protein [Escherichia coli ED1a] gi|218691170|ref|YP_002399382.1|; PP_04656 2e-146 Click
44521214..4525071 PROPHAGE_Shigel_301: serine protease; PP_04657; phage(gi24114232) 0.0 Click
54525118..4525699 hypothetical protein SF2969 [Shigella flexneri 2a str. 301] gi|24114233|ref|NP_708743.1|; PP_04658 6e-107 Click
64526096..4526308 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04659; phage(gi418487058) 1e-34 Click
74526320..4526601 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04660; phage(gi418487089) 5e-37 Click
84526622..4526903 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04661; phage(gi418487088) 2e-50 Click
94526920..4527870 PHAGE_Escher_TL_2011c: RecT; PP_04662; phage(gi418487123) 0.0 Click
104527867..4528556 PHAGE_Escher_TL_2011c: putative exonuclease; PP_04663; phage(gi418487057) 8e-135 Click
114528556..4529143 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04664; phage(gi418487087) 2e-110 Click
124529218..4529565 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04665; phage(gi418487086) 8e-62 Click
134529629..4530450 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04666; phage(gi418487056) 7e-152 Click
144530527..4530922 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04667; phage(gi418487085) 7e-72 Click
154531073..4531798 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04668; phage(gi418487084) 1e-86 Click
164531795..4532202 PHAGE_Escher_P13374: hypothetical protein; PP_04669; phage(gi410491609) 5e-73 Click
174532204..4532395 PHAGE_Escher_P13374: hypothetical protein; PP_04670; phage(gi410491608) 3e-29 Click
184532398..4532580 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04671; phage(gi418487081) 4e-18 Click
19complement(4533467..4534678) hypothetical protein EcE24377A_F0081 [Escherichia coli E24377A] gi|157149372|ref|YP_001451437.1|; PP_04672 4e-68 Click
20complement(4534695..4535324) PHAGE_Plankt_PaV_LD: ABC transporter; PP_04673; phage(gi371496158) 5e-24 Click
21complement(4535317..4535931) hypothetical protein [Yersinia enterocolitica subsp. palearctica Y11] gi|386309886|ref|YP_006005942.1|; PP_04674 7e-40 Click
22complement(4536035..4537273) PHAGE_Acanth_moumouvirus: hypothetical protein; PP_04675; phage(gi441432415) 3e-05 Click

Region 13, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14588907..4589488 PHAGE_Caulob_CcrColossus: putative TerD-like bacterial stress protein; PP_04742; phage(gi414088275) 6e-15 Click
24589488..4590645 putative tellurium resistance protein TerA [Escherichia coli O104:H4 str. 2011C-3493] gi|407482631|ref|YP_006779780.1|; PP_04743 0.0 Click
34590668..4591123 putative tellurium resistance protein TerB [Escherichia coli O104:H4 str. 2011C-3493] gi|407482630|ref|YP_006779779.1|; PP_04744 3e-78 Click
44591146..4592186 PHAGE_Escher_phAPEC8: integral membrane protein TerC; PP_04745; phage(gi448260482) 7e-84 Click
54592235..4592813 PHAGE_Caulob_CcrColossus: putative TerD-like bacterial stress protein; PP_04746; phage(gi414088275) 4e-35 Click
64592882..4593457 PHAGE_Caulob_CcrColossus: putative TerD-like bacterial stress protein; PP_04747; phage(gi414088275) 1e-33 Click
74593889..4595130 PHAGE_Escher_phAPEC8: hypothetical protein; PP_04748; phage(gi448260471) 1e-15 Click
8complement(4595140..4595904) PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; PP_04749; phage(gi418487059) 1e-83 Click
9complement(4596533..4597486) PHAGE_Escher_TL_2011c: type II restriction enzyme BsuBI; PP_04750; phage(gi418487060) 0.0 Click
10complement(4597483..4598952) PHAGE_Escher_TL_2011c: modification methylase BsuBI; PP_04751; phage(gi418487061) 0.0 Click
11complement(4599047..4599760) PHAGE_Escher_TL_2011c: repressor protein CI; PP_04752; phage(gi418487062) 2e-134 Click
124599856..4600059 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04753; phage(gi418487091) 2e-32 Click
134600591..4600968 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04754; phage(gi418487092) 4e-64 Click
144600962..4602482 PHAGE_Escher_TL_2011c: helicase domain protein; PP_04755; phage(gi418487063) 0.0 Click
154602472..4603443 PHAGE_Escher_TL_2011c: putative phage DNA primase; PP_04756; phage(gi418487064) 0.0 Click
164603443..4603892 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04757; phage(gi418487093) 1e-84 Click
174603900..4604463 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04758; phage(gi418487094) 2e-108 Click
184604460..4604654 PHAGE_Escher_TL_2011c: phage NinH family protein; PP_04759; phage(gi418487065) 7e-32 Click
194604647..4604925 PHAGE_Escher_TL_2011c: putative late gene regulator Q; PP_04760; phage(gi418487066) 3e-51 Click
204605154..4606323 hypothetical protein O3K_11440 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481830|ref|YP_006778979.1|; PP_04761 0.0 Click
21complement(4606415..4607524) PHAGE_Entero_2: P2 gpD-like tail protein; PP_04762; phage(gi169936019) 1e-99 Click
22complement(4607571..4607702) hypothetical; PP_04763 0.0 Click
234607682..4608866 PHAGE_Erwini_ENT90: tail sheath protein; PP_04764; phage(gi431810939) 3e-101 Click
244608866..4609378 PROPHAGE_Salmon_Ty2: major tail tube protein; PP_04765; phage(gi29143759) 4e-35 Click
254609433..4609798 PHAGE_Burkho_phiE202: gp28, phage tail protein E; PP_04766; phage(gi134288780) 5e-06 Click
264609834..4609962 PHAGE_Yersin_413C: gpE+E'; PP_04767; phage(gi30065728) 2e-06 Click
274609949..4612756 PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; PP_04768; phage(gi428782750) 4e-114 Click
284612769..4613257 PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_04769; phage(gi29143763) 1e-38 Click
294613414..4613986 acetyltransferase [Escherichia coli O104:H4 str. 2011C-3493] gi|407481838|ref|YP_006778987.1|; PP_04770 9e-108 Click
30complement(4614030..4614608) PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_04771; phage(gi16129505) 2e-99 Click
31complement(4614608..4614973) PHAGE_Entero_vB_EcoM_VR7: gp37 long tail fiber distal subunit; PP_04772; phage(gi314121827) 2e-40 Click
324615481..4616200 PHAGE_Bacill_BCP78: putative RNA polymerase sigma 28 subunit SigF; PP_04773; phage(gi410492877) 3e-11 Click

Region 14, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4658820..4659215) PHAGE_Escher_HK75: Rz; PP_04825; phage(gi356870731) 6e-62 Click
2complement(4659212..4659709) PHAGE_Entero_cdtI: lysin; PP_04826; phage(gi148609440) 1e-91 Click
3complement(4659709..4659924) PHAGE_Stx2_c_II: holin; PP_04827; phage(gi302393164) 5e-28 Click
44660513..4661595 outer membrane porin, DLP12 prophage [Escherichia coli O104:H4 str. 2011C-3493] gi|407483057|ref|YP_006780206.1|; PP_04828 0.0 Click
5complement(4661784..4662167) PHAGE_Entero_2008: antitermination protein Q; PP_04829; phage(gi209427762) 5e-56 Click
6complement(4662253..4662393) PHAGE_Entero_mEp237: hypothetical protein; PP_04830; phage(gi435439319) 5e-11 Click
7complement(4662390..4662617) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_04831; phage(gi435439318) 7e-34 Click
8complement(4662748..4663038) PHAGE_Entero_mEp237: hypothetical protein; PP_04832; phage(gi435439317) 3e-48 Click
9complement(4663031..4663201) PHAGE_Escher_HK639: NinE; PP_04833; phage(gi356870663) 6e-15 Click
10complement(4663201..4663656) PHAGE_Cronob_phiES15: hypothetical protein; PP_04834; phage(gi401817579) 3e-61 Click
11complement(4663851..4664360) hypothetical protein O3O_07585 [Escherichia coli O104:H4 str. 2009EL-2071] gi|407468202|ref|YP_006785356.1|; PP_04835 5e-92 Click
12complement(4664679..4664810) antirepressor protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407483065|ref|YP_006780214.1|; PP_04836 1e-16 Click
13complement(4665030..4665824) putative phage recombinase [Escherichia coli O104:H4 str. 2011C-3493] gi|407483066|ref|YP_006780215.1|; PP_04837 2e-147 Click
14complement(4665781..4666002) multidrug efflux protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407483067|ref|YP_006780216.1|; PP_04838 3e-37 Click
15complement(4666070..4666372) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; PP_04839; phage(gi20065923) 1e-42 Click
16complement(4666369..4667070) PHAGE_Entero_4795: putative replication protein P; PP_04840; phage(gi157166012) 2e-129 Click
17complement(4667067..4668086) PHAGE_Stx2_c_I: O protein; PP_04841; phage(gi20065919) 3e-112 Click
18complement(4668083..4668622) PHAGE_Entero_mEp237: CII protein; PP_04842; phage(gi435439306) 3e-64 Click
19complement(4668692..4668922) PHAGE_Escher_HK639: cro; PP_04843; phage(gi356870651) 2e-19 Click
204669103..4669717 PHAGE_Entero_ST104: CI; PP_04844; phage(gi46358671) 3e-89 Click
214670315..4670521 PHAGE_Entero_mEp237: Kil protein; PP_04845; phage(gi435439298) 8e-30 Click
224670597..4670893 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_04846; phage(gi116222045) 3e-52 Click

Region 15, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4679602..4682451) PHAGE_Bacill_36: RecQ helicase; PP_04851; phage(gi156564053) 3e-19 Click
24682507..4682623 hypothetical; PP_04852 0.0 Click
34682752..4682934 hypothetical protein O3K_04585 [Escherichia coli O104:H4 str. 2011C-3493] gi|407480488|ref|YP_006777637.1|; PP_04853 1e-30 Click
44682937..4683455 hypothetical protein O3K_04590 [Escherichia coli O104:H4 str. 2011C-3493] gi|407480489|ref|YP_006777638.1|; PP_04854 2e-101 Click
5complement(4683921..4684184) hypothetical protein O3K_04595 [Escherichia coli O104:H4 str. 2011C-3493] gi|407480490|ref|YP_006777639.1|; PP_04855 2e-44 Click
64684671..4685192 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_04856; phage(gi399498859) 1e-100 Click
7complement(4685332..4685496) arginyl-tRNA synthetase [Escherichia coli O7:K1 str. CE10] gi|386622925|ref|YP_006142653.1|; PP_04857 2e-10 Click
8complement(4685535..4685669) hypothetical; PP_04858 0.0 Click
9complement(4685823..4685954) PHAGE_Entero_HK629: putative envelope protein; PP_04859; phage(gi428782079) 3e-13 Click
10complement(4686011..4686244) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_04860; phage(gi209427772) 2e-20 Click
114686350..4686493 hypothetical protein ECIAI1_1590 [Escherichia coli IAI1] gi|218554109|ref|YP_002387022.1|; PP_04861 5e-19 Click
124686633..4687178 PHAGE_Entero_HK629: terminase small subunit nu1; PP_04862; phage(gi428782012) 4e-98 Click
134687153..4688814 PHAGE_Entero_HK629: terminase large subunit A; PP_04863; phage(gi428782013) 0.0 Click
144688859..4689077 PHAGE_Entero_HK629: terminase large subunit A; PP_04864; phage(gi428782013) 7e-35 Click
154689074..4689280 PHAGE_Entero_HK629: head-tail connector; PP_04865; phage(gi428782014) 4e-32 Click
164689277..4690878 PHAGE_Entero_HK629: portal protein; PP_04866; phage(gi428782015) 0.0 Click
174690859..4692178 PHAGE_Entero_HK629: head maturation protease; PP_04867; phage(gi428782016) 0.0 Click
184692188..4692520 PHAGE_Entero_HK629: head decoration protein; PP_04868; phage(gi428782018) 2e-57 Click
194692549..4693601 PHAGE_Entero_HK629: major head subunit; PP_04869; phage(gi428782019) 0.0 Click
204693643..4694038 PHAGE_Entero_HK629: DNA packaging protein Fi; PP_04870; phage(gi428782020) 2e-57 Click
214694050..4694403 PHAGE_Entero_HK629: head-tail connector Fii; PP_04871; phage(gi428782021) 4e-61 Click
224694415..4694993 PHAGE_Entero_HK629: minor tail protein; PP_04872; phage(gi428782022) 2e-101 Click
234694990..4695385 PHAGE_Entero_HK629: minor tail protein; PP_04873; phage(gi428782023) 3e-71 Click
244695393..4696133 PHAGE_Entero_HK629: major tail protein; PP_04874; phage(gi428782024) 4e-135 Click
254696149..4696571 PHAGE_Entero_HK629: minor tail protein; PP_04875; phage(gi428782025) 2e-63 Click
264696553..4696987 PHAGE_Entero_HK629: tail assembly protein; PP_04876; phage(gi428782026) 4e-81 Click
274696980..4699193 PHAGE_Entero_HK629: tail length tape measure protein; PP_04877; phage(gi428782027) 0.0 Click

Region 16, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4778962..4779258) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_04961; phage(gi116222045) 5e-45 Click
2complement(4779255..4781327) PHAGE_Salmon_SPN3UB: RecE; PP_04962; phage(gi423262421) 8e-56 Click
3complement(4781435..4781821) hypothetical protein O3K_12335 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482008|ref|YP_006779157.1|; PP_04963 3e-69 Click
4complement(4781905..4782126) PHAGE_Escher_P13374: host killing protein; PP_04964; phage(gi410491620) 6e-05 Click
54782583..4782792 hypothetical protein O3K_12345 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482010|ref|YP_006779159.1|; PP_04965 7e-32 Click
6complement(4782761..4783120) PHAGE_Cronob_phiES15: hypothetical protein; PP_04966; phage(gi401817573) 2e-06 Click
7complement(4783152..4783865) PHAGE_Entero_phiP27: hypothetical protein P27p20; PP_04967; phage(gi18249884) 3e-08 Click
8complement(4783869..4784252) PHAGE_Entero_mEp234: anti-termination protein N; PP_04968; phage(gi428782289) 9e-67 Click
94784480..4784605 hypothetical; PP_04969 0.0 Click
10complement(4784747..4785523) PHAGE_Burkho_2: gp47, conserved hypothetical protein; PP_04970; phage(gi134288670) 2e-08 Click
11complement(4785511..4785924) hypothetical protein O3K_12370 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482015|ref|YP_006779164.1|; PP_04971 4e-79 Click
12complement(4786100..4786813) PHAGE_Entero_mEp234: prophage repressor; PP_04972; phage(gi428782293) 4e-134 Click
134786914..4787114 PHAGE_Entero_mEp234: prophage anti-repressor; PP_04973; phage(gi428782294) 1e-30 Click
144787253..4787549 PHAGE_Stx2_c_86: regulatory protein CII; PP_04974; phage(gi116222057) 4e-38 Click
154787564..4787782 hypothetical protein O3K_12390 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482019|ref|YP_006779168.1|; PP_04975 7e-39 Click
164787884..4788885 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_04976; phage(gi18249881) 4e-31 Click
174788892..4789632 PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_04977; phage(gi169257280) 1e-76 Click
184789658..4790428 hypothetical protein O3K_12405 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482022|ref|YP_006779171.1|; PP_04978 1e-138 Click
194790444..4790839 PHAGE_Entero_HK225: putative Ren exclusion protein; PP_04979; phage(gi428782427) 9e-05 Click
204790896..4791480 PHAGE_Entero_cdtI: Valyl-tRNA synthetase; PP_04980; phage(gi148609417) 2e-15 Click