Shigella flexneri K-272 .0, whole genome shotgun [asmbl_id: NC_000000].4510648, GC%: 50.95%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1141515..141531 attL    TCGGTGGCGTTTCTGGT 0.0 Click
2complement(147054..147767) PROPHAGE_Escher_CFT073: transposase insF; SFK272_0164; phage(gi26249410) 3e-136 Click
3148038..148268 PHAGE_Entero_Sf6: gene 56 protein; SFK272_0165; phage(gi41057344) 8e-36 Click
4148295..149134 PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_0166; phage(gi41057343) 8e-170 Click
5complement(149159..149461) PHAGE_Entero_Sf6: gene 56 protein; SFK272_0167; phage(gi41057344) 3e-09 Click
6149552..150271 sugar transporter subunit: periplasmic-binding component of ABC superfamily domain protein; SFK272_0168 0.0 Click
7150411..151913 PHAGE_Plankt_PaV_LD: ABC transporter; SFK272_0169; phage(gi371496158) 1e-14 Click
8151927..152949 PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; SFK272_0170; phage(gi163932195) 3e-05 Click
9152936..153931 inner membrane ABC transporter permease protein yjfF; SFK272_0171 0.0 Click
10154018..155364 PROPHAGE_Escher_MG1655: IS4 transposase; SFK272_0172; phage(gi16132099) 0.0 Click
11165036..165052 attR    TCGGTGGCGTTTCTGGT 0.0 Click

Region 2, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1789258..789273 attL    TTCTCCCTGTTAATCA 0.0 Click
2799618..801276 PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; SFK272_0882; phage(gi197322490) 5e-07 Click
3801299..801628 transcriptional regulatory protein dpiA domain protein; SFK272_0883 0.0 Click
4complement(801704..802399) PHAGE_Entero_Mu: Mom; SFK272_0884; phage(gi9633544) 4e-133 Click
5complement(802350..802538) PHAGE_Entero_Mu: Com; SFK272_0885; phage(gi9633543) 4e-33 Click
6802923..803909 PHAGE_Entero_Mu: tail fiber; SFK272_0886; phage(gi9633540) 1e-110 Click
7complement(803906..804619) PROPHAGE_Escher_CFT073: transposase insF; SFK272_0887; phage(gi26249410) 2e-135 Click
8complement(804774..805061) PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_0888; phage(gi21231087) 5e-07 Click
9complement(805123..806577) PHAGE_Entero_Mu: transposase; SFK272_0889; phage(gi9633496) 0.0 Click
10807148..807657 PHAGE_Entero_Mu: c-repressor; SFK272_0890; phage(gi9633545) 5e-20 Click
11807373..807388 attR    TTCTCCCTGTTAATCA 0.0 Click

Region 3, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1861214..861225 attL    CTTATCAGGCCT 0.0 Click
2complement(872808..873485) PHAGE_Feldma_virus: putative sensor histidine kinase; SFK272_0962; phage(gi197322366) 5e-06 Click
3complement(873482..875350) PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; SFK272_0963; phage(gi197322490) 7e-11 Click
4875586..876089 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_0964; phage(gi16131317) 2e-85 Click
5876257..876463 hypothetical protein; SFK272_0965 0.0 Click
6complement(876859..877764) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_0966; phage(gi16130763) 3e-178 Click
7877752..877952 hypothetical protein; SFK272_0967 0.0 Click
8complement(878163..878846) PHAGE_Psychr_pOW20_A: phage terminase large subunit; SFK272_0968; phage(gi472339822) 3e-86 Click
9complement(878797..879561) PHAGE_Escher_TL_2011c: putative terminase small subunit; SFK272_0969; phage(gi418487072) 2e-16 Click
10880092..880268 putative membrane protein; SFK272_0970 0.0 Click
11880729..880959 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SFK272_0971; phage(gi24373865) 7e-05 Click
12880986..881564 PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_0972; phage(gi41057343) 2e-113 Click
13881619..881825 PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_0973; phage(gi41057343) 2e-36 Click
14complement(881831..882061) PHAGE_Entero_HK620: endopeptidase; SFK272_0974; phage(gi13559860) 1e-34 Click
15complement(882058..882555) PHAGE_Entero_cdtI: lysin; SFK272_0975; phage(gi148609440) 2e-90 Click
16complement(882555..882761) PHAGE_Entero_cdtI: lysis protein; SFK272_0976; phage(gi148609439) 9e-29 Click
17complement(883451..883525) tRNA 0.0 Click
18complement(883529..883604) tRNA 0.0 Click
19complement(883607..883683) tRNA 0.0 Click
20complement(883685..883761) tRNA 0.0 Click
21complement(883951..884505) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; SFK272_0981; phage(gi399528832) 2e-06 Click
22complement(884502..884792) PHAGE_Erwini_phiEt88: hypothetical protein; SFK272_0982; phage(gi327198620) 3e-32 Click
23complement(884792..885391) PHAGE_Entero_mEp237: hypothetical protein; SFK272_0983; phage(gi435439315) 2e-53 Click
24complement(885430..885588) hypothetical protein; SFK272_0984 0.0 Click
25complement(885558..885671) hypothetical protein; SFK272_0985 0.0 Click
26complement(886350..886916) hypothetical protein; SFK272_0986 0.0 Click
27887120..887131 attL    GATGATTTGAGG 0.0 Click
28complement(887256..888095) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_0987; phage(gi41057343) 8e-170 Click
29complement(888122..888424) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SFK272_0988; phage(gi24373865) 2e-09 Click
30888471..888593 hypothetical protein; SFK272_0989 0.0 Click
31complement(888587..889090) PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_0990; phage(gi16131317) 4e-85 Click
32889165..889662 PHAGE_Entero_mEp235: integrase; SFK272_0991; phage(gi428781836) 1e-22 Click
33890152..890970 cof-like hydrolase family protein; SFK272_0992 0.0 Click
34complement(890971..892029) PHAGE_Plankt_PaV_LD: ABC transporter; SFK272_0993; phage(gi371496158) 8e-22 Click
35complement(892032..892721) molybdate ABC transporter, permease protein; SFK272_0994 0.0 Click
36complement(892721..893494) molybdate ABC transporter, periplasmic molybdate-binding protein; SFK272_0995 0.0 Click
37complement(893661..893810) hypothetical protein; SFK272_0996 0.0 Click
38893939..894727 transcriptional regulator modE; SFK272_0997 0.0 Click
39894783..896267 PHAGE_Amsact_: putative ATP-binding cassette transporter; SFK272_0998; phage(gi9964444) 6e-13 Click
40900968..900979 attR    GATGATTTGAGG 0.0 Click
41901845..901856 attR    CTTATCAGGCCT 0.0 Click

Region 4, total : 62 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1948679..948702 attL    AGGCGTTCACGCCGCATCCGGCAT 0.0 Click
2complement(948729..950147) PHAGE_Cafete_BV_PW1: putative CPD class I photolyase; SFK272_1058; phage(gi310831104) 8e-55 Click
3complement(950144..950653) hypothetical protein; SFK272_1059 0.0 Click
4950782..951111 hypothetical protein; SFK272_1060 0.0 Click
5complement(951447..951950) PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_1061; phage(gi16131317) 3e-86 Click
6952025..952240 transposase domain protein; SFK272_1062 0.0 Click
7complement(952456..952656) hypothetical protein; SFK272_1063 0.0 Click
8952644..953549 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_1064; phage(gi16130763) 3e-178 Click
9953594..954301 PHAGE_Psychr_pOW20_A: phage terminase large subunit; SFK272_1065; phage(gi472339822) 2e-60 Click
10954301..955767 PHAGE_Vibrio_CP_T1: putative portal protein; SFK272_1066; phage(gi418489212) 3e-40 Click
11955943..956401 PROPHAGE_Deinoc_R1: head morphogenesis protein, putative; SFK272_1067; phage(gi15807765) 3e-13 Click
12956465..957625 PHAGE_Pectob_ZF40: putative head protein; SFK272_1068; phage(gi422936684) 4e-19 Click
13957628..958134 hypothetical protein; SFK272_1069 0.0 Click
14958146..959087 PHAGE_Vibrio_CP_T1: putative major capsid protein; SFK272_1070; phage(gi418489228) 4e-16 Click
15959129..959374 hypothetical protein; SFK272_1071 0.0 Click
16complement(959371..960084) PROPHAGE_Escher_CFT073: transposase insF; SFK272_1072; phage(gi26249410) 3e-136 Click
17complement(960225..960527) PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_1073; phage(gi21231087) 3e-09 Click
18960576..960591 attL    AACTCAGGCTACCTCA 0.0 Click
19960831..961208 PHAGE_Entero_phiP27: hypothetical protein P27p57; SFK272_1074; phage(gi18249921) 1e-53 Click
20complement(961270..961786) PROPHAGE_Escher_CFT073: transposase insF; SFK272_1075; phage(gi26249410) 5e-97 Click
21961894..961927 attL    CTTCAATGGGAAATTGTTGTCGCCATTGTTCGAT 0.0 Click
22complement(961927..962229) PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_1076; phage(gi21231087) 1e-09 Click
23complement(962291..962464) hypothetical protein; SFK272_1077 0.0 Click
24complement(962617..963171) hypothetical protein; SFK272_1078 0.0 Click
25complement(963168..963458) PHAGE_Erwini_phiEt88: hypothetical protein; SFK272_1079; phage(gi327198620) 2e-33 Click
26complement(963458..964057) PHAGE_Entero_mEp237: hypothetical protein; SFK272_1080; phage(gi435439315) 8e-55 Click
27964385..964888 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_1081; phage(gi16131317) 2e-85 Click
28complement(965775..965951) hypothetical protein; SFK272_1082 0.0 Click
29complement(965982..966152) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp44; SFK272_1083; phage(gi116222036) 5e-05 Click
30complement(966343..967008) hypothetical protein; SFK272_1084 0.0 Click
31complement(967005..967370) PHAGE_Entero_HK225: HNH endonuclease; SFK272_1085; phage(gi428782431) 3e-34 Click
32complement(967372..967746) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; SFK272_1086; phage(gi20065885) 1e-29 Click
33967821..968150 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_1087; phage(gi16131317) 5e-51 Click
34complement(968459..968635) hypothetical protein; SFK272_1088 0.0 Click
35complement(968693..969532) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_1089; phage(gi41057343) 8e-170 Click
36complement(969559..969789) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SFK272_1090; phage(gi24373865) 7e-05 Click
37complement(969868..969944) tRNA 0.0 Click
38969965..970108 hypothetical protein; SFK272_1092 0.0 Click
39complement(970121..970810) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; SFK272_1093; phage(gi169257244) 1e-77 Click
40complement(970807..971166) PHAGE_Escher_HK75: RusA-like protein; SFK272_1094; phage(gi356870726) 4e-40 Click
41complement(971166..971303) PHAGE_Entero_phiP27: hypothetical protein P27p20; SFK272_1095; phage(gi18249884) 1e-18 Click
42971370..971672 PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_1096; phage(gi21231087) 1e-09 Click
43971813..972526 PROPHAGE_Escher_CFT073: transposase insF; SFK272_1097; phage(gi26249410) 3e-136 Click
44972553..972879 PHAGE_Entero_mEp460: minor tail protein; SFK272_1098; phage(gi428782327) 4e-49 Click
45972900..973217 PHAGE_Entero_mEp460: tail assembly protein; SFK272_1099; phage(gi428782328) 1e-55 Click
46973189..974160 PHAGE_Entero_mEp460: tail length tape measure protein; SFK272_1100; phage(gi428782329) 1e-151 Click
47974304..976166 PHAGE_Entero_mEp460: tail length tape measure protein; SFK272_1101; phage(gi428782329) 0.0 Click
48976166..976429 PHAGE_Entero_mEp460: minor tail protein; SFK272_1102; phage(gi428782330) 5e-44 Click
49976496..977194 PHAGE_Entero_mEp460: minor tail protein; SFK272_1103; phage(gi428782331) 1e-120 Click
50977343..977942 PHAGE_Entero_mEp460: tail fiber component; SFK272_1104; phage(gi428782332) 5e-113 Click
51977939..978481 PHAGE_Entero_mEp460: tail assembly protein; SFK272_1105; phage(gi428782333) 1e-80 Click
52978542..981334 PHAGE_Entero_mEp460: host specificity protein; SFK272_1106; phage(gi428782334) 0.0 Click
53981331..982017 PHAGE_Stx2_c_1717: putative tail fiber component J; SFK272_1107; phage(gi209447196) 4e-84 Click
54982085..982684 PHAGE_Entero_mEp460: Lom protein; SFK272_1108; phage(gi428782335) 6e-104 Click
55982748..984034 PHAGE_Entero_phiP27: putative tail fiber protein; SFK272_1109; phage(gi18249920) 2e-68 Click
56985040..985426 PHAGE_Halocy_JM_2012: leucine rich repeat protein; SFK272_1110; phage(gi389060297) 7e-05 Click
57985672..986223 60 kDa antigen domain protein; SFK272_1111 0.0 Click
58986364..986564 PHAGE_Entero_Sf6: gene 56 protein; SFK272_1112; phage(gi41057344) 1e-29 Click
59986620..987486 PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_1113; phage(gi41057343) 2e-169 Click
60complement(987464..987661) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SFK272_1114; phage(gi24111655) 2e-32 Click
61987649..987849 hypothetical protein; SFK272_1115 0.0 Click
62complement(988060..988296) PROPHAGE_Escher_CFT073: transposase insF; SFK272_1116; phage(gi26249410) 9e-37 Click
63988300..988333 attR    CTTCAATGGGAAATTGTTGTCGCCATTGTTCGAT 0.0 Click
64complement(988333..988635) PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_1117; phage(gi21231087) 1e-09 Click
65988684..988699 attR    AACTCAGGCTACCTCA 0.0 Click
66989574..989723 hypothetical protein; SFK272_1118 0.0 Click
67complement(989771..989905) glucosyl transferase domain protein; SFK272_1119 0.0 Click
68complement(990803..991720) PHAGE_Entero_SfV: bactoprenol glucosyltransferase; SFK272_1120; phage(gi19549012) 2e-170 Click
691000859..1000882 attR    AGGCGTTCACGCCGCATCCGGCAT 0.0 Click

Region 5, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11119202..1119214 attL    GCTGTCGGCCTTT 0.0 Click
21120681..1121448 PHAGE_Plankt_PaV_LD: ABC transporter; SFK272_1273; phage(gi371496158) 2e-16 Click
3complement(1122006..1122149) hypothetical protein; SFK272_1274 0.0 Click
4complement(1122346..1122516) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_1275; phage(gi41057343) 2e-25 Click
51122646..1122792 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SFK272_1276; phage(gi17546153) 2e-15 Click
61122856..1122987 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SFK272_1277; phage(gi24111655) 3e-19 Click
7complement(1122993..1123832) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_1278; phage(gi41057343) 2e-169 Click
8complement(1123859..1124089) PHAGE_Entero_Sf6: gene 56 protein; SFK272_1279; phage(gi41057344) 8e-36 Click
9complement(1124229..1124780) 60 kDa antigen domain protein; SFK272_1280 0.0 Click
10complement(1125026..1125412) 60 kDa antigen domain protein; SFK272_1281 0.0 Click
111126139..1126270 PHAGE_Escher_D108: G region invertase; SFK272_1282; phage(gi281199698) 4e-09 Click
121126530..1127525 6-phosphogluconolactonase; SFK272_1283 0.0 Click
13complement(1127566..1127955) hypothetical protein; SFK272_1284 0.0 Click
14complement(1127977..1128225) hypothetical protein; SFK272_1285 0.0 Click
15complement(1128508..1128762) putative transposase; SFK272_1286 0.0 Click
161128837..1129281 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_1287; phage(gi16131317) 4e-74 Click
171129406..1129699 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_1288; phage(gi16131317) 1e-48 Click
181129838..1130890 hypothetical protein; SFK272_1289 0.0 Click
191130966..1132399 inner membrane protein ybhI; SFK272_1290 0.0 Click
201132582..1132722 aconitase family domain protein; SFK272_1291 0.0 Click
21complement(1132688..1132870) transposase domain protein; SFK272_1292 0.0 Click
221132945..1133394 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_1293; phage(gi16131317) 3e-66 Click
231133211..1133223 attR    GCTGTCGGCCTTT 0.0 Click
24complement(1133391..1134104) PROPHAGE_Escher_CFT073: transposase insF; SFK272_1294; phage(gi26249410) 3e-136 Click

Region 6, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11186293..1186304 attL    GAAATGATTATG 0.0 Click
21199994..1200251 PHAGE_Cronob_vB_CsaM_GAP32: glutaredoxin; SFK272_1364; phage(gi414087106) 3e-13 Click
3complement(1200281..1200658) inner membrane protein ybjM; SFK272_1365 0.0 Click
41200928..1202613 yidE/YbjL duplication domain protein; SFK272_1366 0.0 Click
5complement(1202849..1203004) PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); SFK272_1367; phage(gi169936018) 3e-12 Click
6complement(1203158..1204174) PHAGE_Entero_2: P2 gpD-like tail protein; SFK272_1368; phage(gi169936019) 6e-173 Click
7complement(1204255..1204740) PHAGE_Entero_2: P2 gpU-like tail protein; SFK272_1369; phage(gi169936020) 2e-75 Click
8complement(1204737..1205780) PHAGE_Entero_2: P2 gpT-like tail protein; SFK272_1370; phage(gi169936021) 2e-146 Click
9complement(1205864..1207810) PHAGE_Entero_2: P2 gpT-like tail protein; SFK272_1371; phage(gi169936021) 0.0 Click
10complement(1207803..1207922) PHAGE_Entero_2: P2 gpE-like protein; SFK272_1372; phage(gi169936022) 1e-14 Click
11complement(1207937..1208239) PHAGE_Entero_2: P2 gpE-like tail protein; SFK272_1373; phage(gi169936023) 1e-42 Click
12complement(1208294..1208809) PHAGE_Entero_2: P2 gpFII-like protein; SFK272_1374; phage(gi169936024) 4e-91 Click
13complement(1208819..1209991) PHAGE_Entero_2: P2 gpFI-like protein; SFK272_1375; phage(gi169936025) 0.0 Click
14complement(1210134..1210700) PHAGE_Entero_2: DNA-invertase; SFK272_1376; phage(gi169936026) 1e-87 Click
15complement(1210888..1211193) transposase; SFK272_1377 0.0 Click
161211268..1211771 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_1378; phage(gi16131317) 6e-87 Click
171211840..1212097 PHAGE_Strept_1: hypothetical protein EJ-1p03; SFK272_1379; phage(gi39653677) 4e-14 Click
181212181..1213233 PHAGE_Entero_2: P2 Int-like protein; SFK272_1380; phage(gi169936064) 2e-100 Click
19complement(1213338..1213874) transcriptional regulator, TetR family; SFK272_1381 0.0 Click
201213948..1215156 inner membrane protein ybjJ; SFK272_1382 0.0 Click
211215156..1215971 cof-like hydrolase family protein; SFK272_1383 0.0 Click
221216054..1216065 attR    GAAATGATTATG 0.0 Click
23complement(1216101..1216739) PROPHAGE_Escher_MG1655: IS4 transposase; SFK272_1384; phage(gi16132099) 9e-119 Click
24complement(1216767..1217447) PROPHAGE_Escher_MG1655: IS4 transposase; SFK272_1385; phage(gi16132099) 3e-124 Click
251217520..1217780 hypothetical protein; SFK272_1386 0.0 Click
26complement(1217821..1219047) multidrug translocase mdfA; SFK272_1387 0.0 Click
271219332..1219928 PAP2 superfamily protein; SFK272_1388 0.0 Click
281219986..1220744 deoR-like helix-turn-helix domain protein; SFK272_1389 0.0 Click
29complement(1220791..1221054) PHAGE_Stx2_c_1717: penicillin-binding protein 6b; SFK272_1390; phage(gi209447203) 4e-08 Click
30complement(1221081..1221794) PROPHAGE_Escher_CFT073: transposase insF; SFK272_1391; phage(gi26249410) 3e-136 Click

Region 7, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11314075..1314086 attL    TCGCATCAGGCA 0.0 Click
2complement(1315463..1316268) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_1484; phage(gi16130763) 3e-159 Click
31316316..1316516 hypothetical protein; SFK272_1485 0.0 Click
4complement(1316775..1317551) putative tyrosine-protein kinase epsB; SFK272_1486 0.0 Click
51317615..1317845 PROPHAGE_Escher_CFT073: transposase insC; SFK272_1487; phage(gi26250372) 1e-33 Click
61317858..1318156 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SFK272_1488; phage(gi24111655) 2e-52 Click
71318906..1319253 PHAGE_Stx2_c_1717: transposase; SFK272_1489; phage(gi209447152) 2e-43 Click
81319273..1320721 PHAGE_Stx2_c_1717: transposase; SFK272_1490; phage(gi209447153) 6e-145 Click
9complement(1320878..1322707) hypothetical protein; SFK272_1491 0.0 Click
10complement(1322707..1323192) hypothetical protein; SFK272_1492 0.0 Click
111323254..1323556 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SFK272_1493; phage(gi24373865) 2e-09 Click
121323583..1324050 PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_1494; phage(gi41057343) 2e-80 Click
131324005..1324421 PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_1495; phage(gi41057343) 3e-81 Click
14complement(1324396..1324563) hypothetical protein; SFK272_1496 0.0 Click
15complement(1324701..1325345) hypothetical protein; SFK272_1497 0.0 Click
16complement(1325452..1325757) PHAGE_Equid__9: envelope glycoprotein J; SFK272_1498; phage(gi216905924) 1e-08 Click
17complement(1326199..1326411) cold shock-like protein cspG; SFK272_1499 0.0 Click
18complement(1326652..1326885) putative transposase; SFK272_1500 0.0 Click
191326960..1327463 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_1501; phage(gi16131317) 2e-85 Click
201327485..1327685 PHAGE_Lactoc_bIL312: Csp; SFK272_1502; phage(gi13095918) 3e-18 Click
211333973..1333984 attR    TCGCATCAGGCA 0.0 Click

Region 8, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11466794..1466806 attL    GATGCTTAACGTA 0.0 Click
21467000..1467716 PHAGE_Salmon_vB_SosS_Oslo: integrase; SFK272_1666; phage(gi399528791) 6e-32 Click
31467731..1468228 PHAGE_Entero_HK140: integrase; SFK272_1667; phage(gi428781968) 8e-23 Click
41468849..1469595 hypothetical protein; SFK272_1668 0.0 Click
51469655..1469804 icd-like protein; SFK272_1669 0.0 Click
61469960..1470388 hypothetical protein; SFK272_1670 0.0 Click
71470662..1470674 attR    GATGCTTAACGTA 0.0 Click
81470688..1472439 PHAGE_Entero_EFRM31: DNA primase; SFK272_1671; phage(gi327198106) 9e-13 Click
9complement(1472712..1472825) hypothetical protein; SFK272_1672 0.0 Click
101472845..1473024 hypothetical protein; SFK272_1673 0.0 Click
111473138..1473326 hypothetical protein; SFK272_1674 0.0 Click
121473336..1473497 hypothetical protein; SFK272_1675 0.0 Click
131473639..1473863 hypothetical protein; SFK272_1676 0.0 Click
141474164..1475321 PHAGE_Salmon_ST64B: Major capsid protein precursor; SFK272_1677; phage(gi23505451) 4e-51 Click
151475361..1475933 PHAGE_Entero_EFRM31: prohead protease; SFK272_1678; phage(gi327198114) 3e-28 Click
161475935..1476858 PHAGE_Klebsi_phiKO2: putative portal protein; SFK272_1679; phage(gi46402090) 2e-29 Click
171476855..1477145 PHAGE_Xantho_Xp10: head portal protein; SFK272_1680; phage(gi32128419) 5e-09 Click
181477142..1477480 PHAGE_Entero_HK97: putative head-tail adaptor; SFK272_1681; phage(gi9634168) 2e-26 Click
191477477..1477773 PHAGE_Entero_SfV: hypothetical protein SfVp06; SFK272_1682; phage(gi19548996) 7e-08 Click
201478001..1478213 PHAGE_Xantho_Xop411: HNH endonuclease; SFK272_1683; phage(gi157325492) 7e-05 Click
211478206..1478379 hypothetical protein; SFK272_1684 0.0 Click
221478502..1478858 PHAGE_Salmon_ST64B: terminase small subunit; SFK272_1685; phage(gi23505446) 5e-12 Click
231478842..1480503 PHAGE_Burkho_KS9: terminase gp2; SFK272_1686; phage(gi255033734) 2e-84 Click

Region 9, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11738485..1738497 attL    ATGGCATCAGAAG 0.0 Click
21747034..1747747 PROPHAGE_Escher_CFT073: transposase insF; SFK272_1994; phage(gi26249410) 3e-136 Click
31747781..1747792 attL    GTACACCTCAGG 0.0 Click
41748279..1748404 hypothetical protein; SFK272_1995 0.0 Click
5complement(1748401..1748823) heat shock protein hslJ; SFK272_1996 0.0 Click
6complement(1748934..1749923) PHAGE_Parame_1: hypothetical protein; SFK272_1997; phage(gi9631622) 6e-72 Click
71750131..1752770 hypothetical protein; SFK272_1998 0.0 Click
81752767..1752937 hypothetical protein; SFK272_1999 0.0 Click
9complement(1753118..1753288) putative transposase; SFK272_2000 0.0 Click
101753304..1753606 PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_2001; phage(gi21231087) 1e-09 Click
111753747..1754478 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2002; phage(gi26249410) 9e-135 Click
12complement(1754501..1754743) PHAGE_Staphy_CNPH82: putative nuclease protein; SFK272_2003; phage(gi119953735) 7e-05 Click
131754945..1755549 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2004; phage(gi26249410) 2e-115 Click
141755583..1755594 attR    GTACACCTCAGG 0.0 Click
151755623..1756228 dual specificity phosphatase, catalytic domain protein; SFK272_2005 0.0 Click
16complement(1756282..1756887) FMN-dependent NADH-azoreductase; SFK272_2006 0.0 Click
171757145..1760990 PHAGE_Acanth_moumouvirus: HrpA-like helicase; SFK272_2007; phage(gi441432500) 2e-47 Click
181761094..1761107 attL    TGAGGTAGCCTGAG 0.0 Click
19complement(1761147..1761860) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2008; phage(gi26249410) 3e-136 Click
20complement(1762001..1762257) PHAGE_Entero_Sf6: gene 56 protein; SFK272_2009; phage(gi41057344) 1e-05 Click
211762332..1762556 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2010; phage(gi26249410) 1e-38 Click
221762687..1763940 aldehyde dehydrogenase A; SFK272_2011 0.0 Click
23complement(1763982..1764983) glyceraldehyde-3-phosphate dehydrogenase, type I; SFK272_2012 0.0 Click
241765172..1765702 cytochrome b561 family protein; SFK272_2013 0.0 Click
251765967..1766119 hypothetical protein; SFK272_2014 0.0 Click
26complement(1766806..1767006) hypothetical protein; SFK272_2015 0.0 Click
271766994..1767899 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_2016; phage(gi16130763) 4e-177 Click
281768713..1768726 attR    TGAGGTAGCCTGAG 0.0 Click
291768755..1768767 attR    ATGGCATCAGAAG 0.0 Click

Region 10, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11902290..1902302 attL    AAAATGCCTGTTA 0.0 Click
21909310..1909609 PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; SFK272_2189; phage(gi9630187) 4e-15 Click
31909710..1910690 hemin transport system permease protein hmuU; SFK272_2190 0.0 Click
41910753..1911304 PHAGE_Mollus_1: MC066L; SFK272_2191; phage(gi19744909) 1e-20 Click
51911304..1912053 PHAGE_Plankt_PaV_LD: ABC transporter; SFK272_2192; phage(gi371496158) 8e-09 Click
61912131..1912595 PHAGE_Bacill_36: baseplate hub protein; SFK272_2193; phage(gi156564128) 3e-08 Click
71912854..1913366 hypothetical protein; SFK272_2194 0.0 Click
8complement(1913377..1913754) PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_2195; phage(gi16131317) 4e-65 Click
9complement(1913798..1913936) PHAGE_Entero_P1: InsA; SFK272_2196; phage(gi46401643) 7e-19 Click
10complement(1913937..1914297) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_2197; phage(gi41057343) 1e-68 Click
11complement(1914324..1914626) PHAGE_Entero_Sf6: gene 56 protein; SFK272_2198; phage(gi41057344) 6e-50 Click
121915105..1916154 PHAGE_Entero_mEp460: hypothetical protein; SFK272_2199; phage(gi428782365) 3e-110 Click
131916275..1916523 PHAGE_Escher_HK75: RusA-like protein; SFK272_2200; phage(gi356870726) 5e-20 Click
141916538..1917359 PHAGE_Entero_HK225: late gene regulator Q; SFK272_2201; phage(gi428782441) 1e-88 Click
151917503..1917578 tRNA 0.0 Click
161917680..1917756 tRNA 0.0 Click
171918256..1918387 hypothetical protein; SFK272_2204 0.0 Click
181919218..1919229 attL    TGTCAGGTATTT 0.0 Click
191919263..1919451 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; SFK272_2205; phage(gi209427766) 2e-28 Click
201919448..1919609 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; SFK272_2206; phage(gi116221995) 6e-17 Click
21complement(1919865..1920578) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2207; phage(gi26249410) 3e-136 Click
22complement(1920719..1921021) PHAGE_Entero_Sf6: gene 56 protein; SFK272_2208; phage(gi41057344) 4e-09 Click
231921973..1922275 PHAGE_Entero_Sf6: gene 56 protein; SFK272_2209; phage(gi41057344) 4e-09 Click
241922314..1922325 attR    TGTCAGGTATTT 0.0 Click
251922416..1923129 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2210; phage(gi26249410) 2e-132 Click
261923173..1923185 attR    AAAATGCCTGTTA 0.0 Click

Region 11, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12143253..2143265 attL    AGGCTTTTTTATT 0.0 Click
22157241..2157489 PHAGE_Entero_4795: putative damage-inducible protein DinI; SFK272_2482; phage(gi157166070) 2e-25 Click
32157572..2157584 attL    TGCATACGACGTG 0.0 Click
42158847..2159839 60 kDa antigen; SFK272_2483 0.0 Click
5complement(2160018..2160395) PHAGE_Entero_phiP27: hypothetical protein P27p57; SFK272_2484; phage(gi18249921) 2e-50 Click
6complement(2160591..2161679) PHAGE_Entero_phiP27: putative tail fiber protein; SFK272_2485; phage(gi18249920) 1e-47 Click
7complement(2161723..2161947) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2486; phage(gi26249410) 1e-38 Click
82162037..2162411 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2487; phage(gi26249410) 4e-69 Click
9complement(2162725..2162925) hypothetical protein; SFK272_2488 0.0 Click
102162913..2163818 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_2489; phage(gi16130763) 1e-176 Click
112163851..2164126 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; SFK272_2490; phage(gi157166066) 2e-45 Click
122164635..2165006 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SFK272_2491; phage(gi157166067) 1e-66 Click
132165054..2165221 hypothetical protein; SFK272_2492 0.0 Click
14complement(2165378..2165527) hypothetical protein; SFK272_2493 0.0 Click
152165853..2166458 PHAGE_Entero_4795: putative integrase; SFK272_2494; phage(gi157165986) 2e-56 Click
162167043..2167834 afeA; SFK272_2495 0.0 Click
172167834..2168661 PHAGE_Plankt_PaV_LD: ABC transporter; SFK272_2496; phage(gi371496158) 5e-13 Click
182168658..2169515 chelated iron transport system membrane protein yfeC; SFK272_2497 0.0 Click
192169512..2170369 chelated iron transport system membrane protein yfeD; SFK272_2498 0.0 Click
202170545..2170557 attR    TGCATACGACGTG 0.0 Click
21complement(2170570..2170947) PHAGE_Entero_phiP27: hypothetical protein P27p57; SFK272_2499; phage(gi18249921) 2e-53 Click
22complement(2171099..2171323) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2500; phage(gi26249410) 1e-38 Click
232171462..2172118 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_2501; phage(gi16130763) 1e-128 Click
242184159..2184171 attR    AGGCTTTTTTATT 0.0 Click

Region 12, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2190430..2190802) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_2523; phage(gi41057343) 2e-72 Click
2complement(2190803..2191082) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_2524; phage(gi41057343) 7e-51 Click
3complement(2191109..2191411) PHAGE_Entero_Sf6: gene 56 protein; SFK272_2525; phage(gi41057344) 6e-50 Click
42191552..2191947 hypothetical protein; SFK272_2526 0.0 Click
52191999..2192301 PHAGE_Entero_Sf6: gene 56 protein; SFK272_2527; phage(gi41057344) 3e-09 Click
62192442..2192921 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2528; phage(gi26249410) 2e-87 Click
72192930..2193235 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2529; phage(gi26249410) 5e-32 Click
82193408..2193569 hypothetical protein; SFK272_2530 0.0 Click
9complement(2193657..2194301) chemotaxis protein cheZ; SFK272_2531 0.0 Click
10complement(2194312..2194701) PHAGE_Ectoca_1: EsV-1-65; SFK272_2532; phage(gi13242537) 3e-10 Click
11complement(2194716..2195765) response regulator; SFK272_2533 0.0 Click
12complement(2195768..2195905) chemotaxis protein methyltransferase domain protein; SFK272_2534 0.0 Click
13complement(2195871..2196518) chemotaxis protein methyltransferase; SFK272_2535 0.0 Click
14complement(2196537..2198138) PHAGE_Entero_HK629: tail fiber protein; SFK272_2536; phage(gi428782034) 1e-07 Click

Region 13, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12242526..2242538 attL    TTTTATTGGCATT 0.0 Click
22255641..2256354 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2613; phage(gi26249410) 3e-136 Click
32256413..2257036 colanic acid capsular biosynthesis activation protein A; SFK272_2614 0.0 Click
4complement(2257080..2257268) protein dsrB; SFK272_2615 0.0 Click
52257431..2257658 hypothetical protein; SFK272_2616 0.0 Click
62257955..2258362 hypothetical protein; SFK272_2617 0.0 Click
72258426..2258770 hypothetical protein; SFK272_2618 0.0 Click
8complement(2258767..2260443) cellulose synthesis regulatory protein; SFK272_2619 0.0 Click
9complement(2260632..2260814) hypothetical protein; SFK272_2620 0.0 Click
10complement(2260893..2261804) hypothetical protein; SFK272_2621 0.0 Click
112261983..2262903 carboxylate/Amino Acid/Amine Transporter family protein; SFK272_2622 0.0 Click
12complement(2262892..2263362) PHAGE_Burkho_KL3: gp46; SFK272_2623; phage(gi327198091) 9e-34 Click
13complement(2263343..2264761) PHAGE_Burkho_KL3: gp47; SFK272_2624; phage(gi327198092) 6e-102 Click
14complement(2264828..2265523) PHAGE_Lausan: metal-dependent phosphohydrolase; SFK272_2625; phage(gi327409624) 3e-06 Click
15complement(2265821..2266435) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2626; phage(gi26250329) 3e-116 Click
16complement(2266690..2266968) PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_2627; phage(gi21231087) 1e-27 Click
172266995..2267537 outer membrane protein N domain protein; SFK272_2628 0.0 Click
18complement(2267569..2269170) PHAGE_Stx2_c_1717: transposase; SFK272_2629; phage(gi209447153) 5e-162 Click
19complement(2269190..2269537) PHAGE_Stx2_c_1717: transposase; SFK272_2630; phage(gi209447152) 3e-43 Click
202270292..2270408 hypothetical protein; SFK272_2631 0.0 Click
21complement(2270569..2271474) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_2632; phage(gi16130763) 8e-173 Click
22complement(2271566..2271679) hypothetical protein; SFK272_2633 0.0 Click
232271858..2271888 attL    TGGTTGTCTGGAGATTCAGGGGGCCAGTCTA 0.0 Click
24complement(2271985..2272890) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_2634; phage(gi16130763) 3e-177 Click
252272878..2273078 hypothetical protein; SFK272_2635 0.0 Click
26complement(2273052..2273213) PROPHAGE_Escher_CFT073: transposase insC; SFK272_2636; phage(gi26250372) 4e-24 Click
272273274..2273304 attR    TGGTTGTCTGGAGATTCAGGGGGCCAGTCTA 0.0 Click
282273482..2273494 attR    TTTTATTGGCATT 0.0 Click
29complement(2273693..2273878) putative transposase; SFK272_2637 0.0 Click
302273953..2274456 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_2638; phage(gi16131317) 6e-87 Click
31complement(2274467..2275546) putative sensor-like histidine kinase yedV; SFK272_2639 0.0 Click
322275649..2275661 attL    TTTCATTATTTTT 0.0 Click
33complement(2275654..2276325) PHAGE_Ectoca_1: EsV-1-65; SFK272_2640; phage(gi13242537) 2e-06 Click
342276458..2276871 hydroxyisourate hydrolase; SFK272_2641 0.0 Click
352276973..2277179 hypothetical protein; SFK272_2642 0.0 Click
362277333..2277968 hypothetical protein; SFK272_2643 0.0 Click
372277969..2278604 ferric reductase like transmembrane component family protein; SFK272_2644 0.0 Click
382278862..2279512 zinc-binding lipoprotein adcA domain protein; SFK272_2645 0.0 Click
39complement(2280181..2280270) tRNA 0.0 Click
402280478..2281161 hypothetical protein; SFK272_2647 0.0 Click
412281262..2281337 tRNA 0.0 Click
422281718..2282761 PROPHAGE_Escher_CFT073: prophage P4 integrase; SFK272_2649; phage(gi26248270) 0.0 Click
432294583..2294595 attR    TTTCATTATTTTT 0.0 Click

Region 14, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12291012..2291054 attL    ATGAGGTGTACTGACAATAGCGGACACTACCATTTGTTCTTTT 0.0 Click
2complement(2291056..2291229) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2661; phage(gi26249410) 5e-27 Click
3complement(2291230..2291379) PHAGE_Entero_Sf6: gene 56 protein; SFK272_2662; phage(gi41057344) 3e-19 Click
42291592..2291816 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2663; phage(gi26249410) 1e-38 Click
5complement(2291841..2292065) PHAGE_Entero_mEp460: minor tail protein; SFK272_2664; phage(gi428782324) 9e-32 Click
6complement(2292052..2292423) PHAGE_Entero_mEp237: head-tail connector Fii; SFK272_2665; phage(gi435439274) 4e-23 Click
7complement(2292435..2292836) PHAGE_Entero_mEp237: DNA packaging protein Fi; SFK272_2666; phage(gi435439273) 2e-17 Click
82293100..2294257 PROPHAGE_Escher_CFT073: transposase; SFK272_2667; phage(gi26248352) 0.0 Click
9complement(2294994..2295068) tRNA 0.0 Click
10complement(2295072..2295147) tRNA 0.0 Click
11complement(2295150..2295225) tRNA 0.0 Click
12complement(2295227..2295303) tRNA 0.0 Click
132295338..2295562 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_2672; phage(gi16131317) 9e-37 Click
142295626..2295668 attR    ATGAGGTGTACTGACAATAGCGGACACTACCATTTGTTCTTTT 0.0 Click
15complement(2295670..2296383) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2673; phage(gi26249410) 3e-136 Click
16complement(2296524..2296826) PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_2674; phage(gi21231087) 1e-09 Click
17complement(2296888..2297628) PHAGE_Burkho_phi1026b: gp58; SFK272_2675; phage(gi38707948) 5e-08 Click

Region 15, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12304506..2304518 attL    TTTCAGAAAGATA 0.0 Click
22307950..2308984 PROPHAGE_Shewan_MR-1: IS110 family transposase; SFK272_2690; phage(gi24375433) 8e-10 Click
32309111..2309123 attL    CCTCTGTAATGCG 0.0 Click
42309540..2309659 hypothetical protein; SFK272_2691 0.0 Click
5complement(2309760..2310089) hypothetical protein; SFK272_2692 0.0 Click
62310180..2310296 hypothetical protein; SFK272_2693 0.0 Click
7complement(2310261..2310608) inner membrane protein yeeA domain protein; SFK272_2694 0.0 Click
8complement(2310886..2311158) hypothetical protein; SFK272_2695 0.0 Click
92311300..2311647 PHAGE_Stx2_c_1717: transposase; SFK272_2696; phage(gi209447152) 2e-43 Click
102311667..2312707 PHAGE_Stx2_c_1717: transposase; SFK272_2697; phage(gi209447153) 2e-64 Click
112312704..2313267 PHAGE_Stx2_c_1717: transposase; SFK272_2698; phage(gi209447153) 3e-61 Click
12complement(2313314..2313664) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2699; phage(gi26249410) 4e-63 Click
13complement(2313715..2314554) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_2700; phage(gi41057343) 4e-169 Click
14complement(2314581..2314883) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SFK272_2701; phage(gi24373865) 2e-09 Click
15complement(2314953..2315357) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2702; phage(gi26249410) 5e-08 Click
16complement(2315419..2315670) PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_2703; phage(gi21231087) 4e-05 Click
172316188..2317612 exodeoxyribonuclease I; SFK272_2704 0.0 Click
18complement(2317655..2317882) sirA-like family protein; SFK272_2705 0.0 Click
19complement(2317896..2318639) hypothetical protein; SFK272_2706 0.0 Click
20complement(2318817..2319320) PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_2707; phage(gi16131317) 2e-84 Click
212319395..2319538 putative transposase; SFK272_2708 0.0 Click
22complement(2319749..2319949) hypothetical protein; SFK272_2709 0.0 Click
232319937..2320842 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_2710; phage(gi16130763) 3e-178 Click
24complement(2320879..2321067) hypothetical protein; SFK272_2711 0.0 Click
25complement(2321246..2322514) putrescine importer; SFK272_2712 0.0 Click
26complement(2322871..2323353) transcriptional regulator, LysR family; SFK272_2713 0.0 Click
27complement(2323396..2323800) bacterial regulatory helix-turn-helix protein, lysR family protein; SFK272_2714 0.0 Click
28complement(2323846..2324670) NAD dependent epimerase/dehydratase family protein; SFK272_2715 0.0 Click
292324821..2324833 attR    CCTCTGTAATGCG 0.0 Click
302324980..2325309 PHAGE_Stx2_c_1717: truncated transposase; SFK272_2716; phage(gi209447151) 7e-05 Click
312325302..2326207 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_2717; phage(gi16130763) 6e-179 Click
322340902..2340914 attR    TTTCAGAAAGATA 0.0 Click

Region 16, total : 56 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2431379..2432488) PHAGE_Burkho_2: gp12, partition protein; SFK272_2823; phage(gi134288738) 2e-05 Click
22432620..2434653 PHAGE_Megavi_chiliensis: methionyl-tRNA synthetase; SFK272_2824; phage(gi363540510) 2e-56 Click
32434794..2434997 putative molybdate metabolism regulator domain protein; SFK272_2825 0.0 Click
42435049..2435351 PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_2826; phage(gi21231087) 3e-09 Click
52435492..2435874 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2827; phage(gi26249410) 3e-67 Click
62436422..2436769 PHAGE_Stx2_c_1717: transposase; SFK272_2828; phage(gi209447152) 2e-42 Click
72436789..2438390 PHAGE_Stx2_c_1717: transposase; SFK272_2829; phage(gi209447153) 5e-162 Click
8complement(2438456..2438674) PHAGE_Escher_P13374: lysis protein, holin; SFK272_2830; phage(gi410491645) 2e-26 Click
9complement(2438967..2439040) tRNA 0.0 Click
10complement(2439044..2439119) tRNA 0.0 Click
11complement(2439122..2439198) tRNA 0.0 Click
12complement(2439200..2439276) tRNA 0.0 Click
132439200..2439263 attL    TGGTGGCCCTTGCTGGACTTGAACCAGCGACCTGGCGATTATGAGTCGCTCGCTCTGACCAACT 0.0 Click
142439297..2439446 hypothetical protein; SFK272_2835 0.0 Click
15complement(2439571..2439732) PHAGE_Entero_2008: antitermination protein Q; SFK272_2836; phage(gi209427762) 1e-24 Click
16complement(2439725..2439925) PHAGE_Escher_P13374: hypothetical protein; SFK272_2837; phage(gi410491635) 2e-20 Click
17complement(2440020..2440277) PHAGE_Entero_phiP27: hypothetical protein P27p20; SFK272_2838; phage(gi18249884) 1e-36 Click
18complement(2440274..2441257) PHAGE_Entero_phiP27: putative helicase; SFK272_2839; phage(gi18249883) 8e-177 Click
19complement(2441261..2441473) PHAGE_Entero_phiP27: putative helicase; SFK272_2840; phage(gi18249883) 6e-33 Click
20complement(2441662..2442540) PHAGE_Entero_phiP27: putative replication protein DnaC; SFK272_2841; phage(gi18249882) 6e-141 Click
21complement(2442551..2443459) PHAGE_Entero_phiP27: hypothetical protein P27p17; SFK272_2842; phage(gi18249881) 9e-74 Click
22complement(2443446..2443679) PHAGE_Entero_mEp460: hypothetical protein; SFK272_2843; phage(gi428782358) 9e-16 Click
23complement(2443676..2444536) PHAGE_Entero_phiP27: hypothetical protein P27p16; SFK272_2844; phage(gi18249880) 7e-31 Click
24complement(2444533..2445477) PHAGE_Entero_phiP27: hypothetical protein P27p16; SFK272_2845; phage(gi18249880) 1e-100 Click
252445533..2445841 PHAGE_Entero_N15: gp48; SFK272_2846; phage(gi9630515) 2e-07 Click
26complement(2446056..2446451) PHAGE_Entero_phiP27: hypothetical protein P27p14; SFK272_2847; phage(gi18249878) 8e-62 Click
272446529..2446831 PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_2848; phage(gi21231087) 1e-09 Click
282446972..2447685 PROPHAGE_Escher_CFT073: transposase insF; SFK272_2849; phage(gi26249410) 3e-136 Click
292447963..2448511 putative molybdate metabolism regulator domain protein; SFK272_2850 0.0 Click
302449519..2450607 PHAGE_Lister_P70: transcription regulator; SFK272_2851; phage(gi410490694) 3e-05 Click
312450618..2452897 hypothetical protein; SFK272_2852 0.0 Click
322452890..2454026 von Willebrand factor type A domain protein; SFK272_2853 0.0 Click
332454023..2454598 SWIM zinc finger family protein; SFK272_2854 0.0 Click
342454616..2455497 hypothetical protein; SFK272_2855 0.0 Click
352455608..2456018 hypothetical protein; SFK272_2856 0.0 Click
362456143..2456604 hypothetical protein; SFK272_2857 0.0 Click
37complement(2456645..2457115) hypothetical protein; SFK272_2858 0.0 Click
38complement(2457162..2457881) response regulator; SFK272_2859 0.0 Click
39complement(2457878..2459563) PHAGE_Entero_2008: putative 2-component sensor protein YehU; SFK272_2860; phage(gi209427798) 0.0 Click
402459771..2460604 PROPHAGE_Escher_MG1655: IS4 transposase; SFK272_2861; phage(gi16132099) 5e-151 Click
412460694..2461116 PROPHAGE_Escher_MG1655: IS4 transposase; SFK272_2862; phage(gi16132099) 1e-75 Click
422461514..2461762 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; SFK272_2863; phage(gi148609412) 4e-41 Click
43complement(2461878..2462147) PHAGE_Entero_HK630: tail fiber assembly protein; SFK272_2864; phage(gi428782810) 1e-21 Click
442462699..2462872 hypothetical protein; SFK272_2865 0.0 Click
452463854..2464831 60 kDa antigen domain protein; SFK272_2866 0.0 Click
46complement(2465011..2465388) PHAGE_Entero_phiP27: hypothetical protein P27p57; SFK272_2867; phage(gi18249921) 2e-50 Click
47complement(2465551..2466659) PHAGE_Entero_phiP27: putative tail fiber protein; SFK272_2868; phage(gi18249920) 9e-40 Click
482466678..2467544 60 kDa antigen domain protein; SFK272_2869 0.0 Click
49complement(2467724..2468044) PHAGE_Entero_phiP27: hypothetical protein P27p57; SFK272_2870; phage(gi18249921) 3e-41 Click
50complement(2468296..2469564) PHAGE_Entero_phiP27: putative tail fiber protein; SFK272_2871; phage(gi18249920) 2e-75 Click
51complement(2469588..2470133) PHAGE_Entero_phiP27: putative tail fiber assembly protein; SFK272_2872; phage(gi18249919) 2e-74 Click
52complement(2470136..2470786) PHAGE_Entero_phiP27: putative tail fiber protein; SFK272_2873; phage(gi18249918) 4e-39 Click
53complement(2470779..2470994) PHAGE_Escher_P13374: lysis protein, holin; SFK272_2874; phage(gi410491645) 2e-27 Click
54complement(2471287..2471361) tRNA 0.0 Click
55complement(2471365..2471440) tRNA 0.0 Click
56complement(2471443..2471519) tRNA 0.0 Click
57complement(2471521..2471597) tRNA 0.0 Click
582471521..2471584 attR    TGGTGGCCCTTGCTGGACTTGAACCAGCGACCTGGCGATTATGAGTCGCTCGCTCTGACCAACT 0.0 Click
59complement(2471806..2472288) PHAGE_Stx2_c_II: putative antirepressor-like protein; SFK272_2879; phage(gi302393152) 2e-45 Click
60complement(2472359..2472574) PROPHAGE_Escher_CFT073: transposase insF; SFK272_2880; phage(gi26249410) 6e-36 Click
61complement(2472575..2472791) transposase family protein; SFK272_2881 0.0 Click
622472973..2473584 PROPHAGE_Escher_CFT073: transposase IS629; SFK272_2882; phage(gi26250986) 6e-114 Click
63complement(2473724..2473885) PHAGE_Entero_Sf6: gene 56 protein; SFK272_2883; phage(gi41057344) 6e-23 Click
642474290..2474823 HTH-type transcriptional regulator mlrA; SFK272_2884 0.0 Click
652474783..2474941 HTH-type transcriptional regulator mlrA domain protein; SFK272_2885 0.0 Click
66complement(2475089..2475820) inner membrane ABC transporter permease protein yehW; SFK272_2886 0.0 Click
67complement(2475825..2476751) PHAGE_Plankt_PaV_LD: ABC transporter; SFK272_2887; phage(gi371496158) 1e-24 Click

Region 17, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12575288..2575317 attL    ATGCCGGATGCGGCGTAAACGCCTTATCCG 0.0 Click
2complement(2586260..2586439) PROPHAGE_Escher_CFT073: transposase; SFK272_2999; phage(gi26246249) 6e-06 Click
32587275..2588312 60 kDa antigen; SFK272_3000 0.0 Click
42588597..2588652 attL    TAGACTGGCCCCCTGAATCTCCAGACAACCAGTATCACTTATTTAAGTGATAGTCT 0.0 Click
5complement(2588823..2589023) hypothetical protein; SFK272_3001 0.0 Click
62589011..2589916 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_3002; phage(gi16130763) 3e-178 Click
72590299..2590745 PHAGE_Stx2_c_1717: NinB protein; SFK272_3003; phage(gi209447158) 2e-80 Click
8complement(2590960..2591268) PHAGE_Entero_N15: gp48; SFK272_3004; phage(gi9630515) 2e-07 Click
9complement(2591258..2591488) PHAGE_Entero_N15: gp49; SFK272_3005; phage(gi9630516) 2e-11 Click
102592200..2592592 PHAGE_Stx2_c_II: putative antirepressor-like protein; SFK272_3006; phage(gi302393152) 1e-59 Click
112592667..2593119 PHAGE_Entero_HK140: DNA-binding protein; SFK272_3007; phage(gi428781998) 2e-64 Click
12complement(2593094..2593933) PHAGE_Entero_Sf6: putative transposase OrfB; SFK272_3008; phage(gi41057343) 8e-170 Click
13complement(2593960..2594262) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SFK272_3009; phage(gi24373865) 2e-09 Click
142594418..2594549 PHAGE_Entero_mEp235: integrase; SFK272_3010; phage(gi428781836) 6e-13 Click
152594599..2595132 PROPHAGE_Escher_MG1655: IS4 transposase; SFK272_3011; phage(gi16132099) 5e-85 Click
162595306..2595944 PROPHAGE_Escher_MG1655: IS4 transposase; SFK272_3012; phage(gi16132099) 9e-119 Click
17complement(2595933..2596238) hypothetical protein; SFK272_3013 0.0 Click
18complement(2596290..2597978) hypothetical protein; SFK272_3014 0.0 Click
19complement(2598127..2600754) PHAGE_Lactoc_949: putative DNA gyrase subunit A-topoisomerase; SFK272_3015; phage(gi327197938) 1e-73 Click
202600901..2601623 PHAGE_Microm_12T: hypothetical protein; SFK272_3016; phage(gi472342811) 2e-08 Click
21complement(2601765..2604293) PHAGE_Pelagi_HTVC008M: hypothetical protein; SFK272_3017; phage(gi460042500) 1e-08 Click
22complement(2604390..2605301) hypothetical protein; SFK272_3018 0.0 Click
232605334..2605389 attR    TAGACTGGCCCCCTGAATCTCCAGACAACCAGTATCACTTATTTAAGTGATAGTCT 0.0 Click
24complement(2605548..2605748) hypothetical protein; SFK272_3019 0.0 Click
252605736..2606641 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SFK272_3020; phage(gi16130763) 1e-177 Click
262609821..2609850 attR    ATGCCGGATGCGGCGTAAACGCCTTATCCG 0.0 Click

Region 18, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12915319..2916875 PHAGE_Yersin_12: internal virion protein D; SFK272_3347; phage(gi9634042) 1e-07 Click
2complement(2916872..2917375) PHAGE_Microm_MpV1: hypothetical protein; SFK272_3348; phage(gi313768407) 1e-05 Click
3complement(2917433..2918068) hypothetical protein; SFK272_3349 0.0 Click
42918278..2919126 hypothetical protein; SFK272_3350 0.0 Click
5complement(2919231..2919344) hypothetical protein; SFK272_3351 0.0 Click
6complement(2919579..2919812) PHAGE_Entero_2: DNA-invertase; SFK272_3352; phage(gi169936026) 4e-35 Click
72920706..2921134 PHAGE_Gifsy_1: leucine-rich repeat protein; SFK272_3353; phage(gi169257209) 1e-05 Click
82921380..2921931 60 kDa antigen domain protein; SFK272_3354 0.0 Click
92922072..2922188 PHAGE_Entero_Sf6: gene 56 protein; SFK272_3355; phage(gi41057344) 7e-16 Click
102922217..2922441 PROPHAGE_Escher_CFT073: transposase insF; SFK272_3356; phage(gi26249410) 1e-38 Click

Region 19, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13031862..3031875 attL    ACTGGAAGAACAGC 0.0 Click
23036677..3037918 PHAGE_Entero_P4: integrase; SFK272_3475; phage(gi9627511) 1e-63 Click
3complement(3038031..3038237) transposase domain protein; SFK272_3476 0.0 Click
43038312..3038815 PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_3477; phage(gi16131317) 6e-87 Click
53038997..3039341 hypothetical protein; SFK272_3478 0.0 Click
6complement(3039378..3039827) hypothetical protein; SFK272_3479 0.0 Click
73040495..3040899 hypothetical protein; SFK272_3480 0.0 Click
8complement(3040946..3041470) inner membrane protein ygaP; SFK272_3481 0.0 Click
9complement(3041480..3041779) transcriptional activator hlyU; SFK272_3482 0.0 Click
103041962..3042120 hypothetical protein; SFK272_3483 0.0 Click
113042204..3042653 PHAGE_Clostr_CD119: XkdP protein; SFK272_3484; phage(gi90592656) 4e-09 Click
12complement(3042654..3043316) transcriptional regulator, GntR family; SFK272_3485 0.0 Click
13complement(3043337..3044116) GABA permease domain protein; SFK272_3486 0.0 Click
14complement(3044133..3044528) PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_3487; phage(gi16131317) 3e-68 Click
15complement(3044530..3044655) PHAGE_Entero_P1: InsA; SFK272_3488; phage(gi46401643) 4e-08 Click
163044710..3044910 transposase domain protein; SFK272_3489 0.0 Click
173044918..3045139 hypothetical protein; SFK272_3490 0.0 Click
183045456..3045701 PHAGE_Mycoba_Porky: gp37; SFK272_3491; phage(gi194303333) 3e-10 Click
193045698..3046108 PHAGE_Bacill_SP10: ribonucleotide reductase stimulatory protein; SFK272_3492; phage(gi418489617) 7e-14 Click
203046081..3048225 PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; SFK272_3493; phage(gi158079505) 0.0 Click
213048235..3049194 PHAGE_Mycoba_Myrna: gp256; SFK272_3494; phage(gi203454817) 9e-128 Click
223049549..3050751 PHAGE_Plankt_PaV_LD: ABC transporter; SFK272_3495; phage(gi371496158) 1e-24 Click
233050744..3051808 PHAGE_Lactob_KC5a: putative minor tail protein; SFK272_3496; phage(gi90592623) 6e-06 Click
243056738..3056751 attR    ACTGGAAGAACAGC 0.0 Click

Region 20, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13102859..3105384 PHAGE_Cafete_BV_PW1: putative DNA mismatch repair protein MutS; SFK272_3562; phage(gi310831476) 1e-42 Click
23105490..3105828 PHAGE_Entero_P1: Ppp; SFK272_3563; phage(gi46401710) 4e-27 Click
3complement(3105954..3106457) PROPHAGE_Escher_MG1655: IS1 transposase B; SFK272_3564; phage(gi16131317) 2e-85 Click
4complement(3106718..3107215) PHAGE_Entero_Mu: Gam; SFK272_3565; phage(gi9633500) 3e-76 Click
5complement(3107226..3107939) PROPHAGE_Escher_CFT073: transposase insF; SFK272_3566; phage(gi26249410) 3e-136 Click
6complement(3108094..3108381) PROPHAGE_Xantho_33913: ISxac3 transposase; SFK272_3567; phage(gi21231087) 1e-06 Click
7complement(3108526..3108813) PHAGE_Entero_Mu: hypothetical protein Mup09; SFK272_3568; phage(gi9633546) 6e-44 Click
8complement(3108826..3109245) PHAGE_Entero_Mu: hypothetical protein Mup08; SFK272_3569; phage(gi9633547) 2e-73 Click
9complement(3109260..3109523) PHAGE_Entero_Mu: hypothetical protein Mup07; SFK272_3570; phage(gi9633499) 3e-40 Click
10complement(3109556..3109783) PHAGE_Entero_Mu: kil; SFK272_3571; phage(gi9633497) 5e-35 Click
11complement(3109799..3110749) PHAGE_Entero_Mu: DNA transposition protein; SFK272_3572; phage(gi9633513) 5e-59 Click
12complement(3110825..3112921) PROPHAGE_Escher_Sakai: phage transposase; SFK272_3573; phage(gi15834199) 0.0 Click