Shigella dysenteriae 155-74 .0, whole genome shotgun [asmbl_id: NC_000000].5162596, GC%: 50.77%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 92 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13490..4672 PHAGE_Entero_mEp460: terminase large subunit; SD15574_5499; phage(gi428782318) 0.0 Click
24669..4881 PHAGE_Entero_mEp460: hypothetical protein; SD15574_5500; phage(gi428782319) 4e-34 Click
34881..6389 PHAGE_Entero_mEp460: portal protein; SD15574_5501; phage(gi428782320) 0.0 Click
46403..8361 PHAGE_Entero_mEp460: putative protease/scaffold protein; SD15574_5502; phage(gi428782321) 0.0 Click
58448..8771 PHAGE_Entero_mEp460: hypothetical protein; SD15574_5503; phage(gi428782322) 7e-55 Click
68764..9039 PHAGE_Entero_mEp460: hypothetical protein; SD15574_5504; phage(gi428782323) 2e-46 Click
79051..9629 PHAGE_Entero_mEp460: minor tail protein; SD15574_5505; phage(gi428782324) 2e-104 Click
89626..10027 PHAGE_Entero_mEp460: minor tail protein; SD15574_5506; phage(gi428782325) 2e-73 Click
910038..10781 PHAGE_Entero_mEp460: major tail protein; SD15574_5507; phage(gi428782326) 6e-139 Click
1010842..11228 PHAGE_Entero_mEp460: minor tail protein; SD15574_5508; phage(gi428782327) 3e-67 Click
1111291..11566 PHAGE_Entero_mEp460: tail assembly protein; SD15574_5509; phage(gi428782328) 5e-48 Click
1211538..14603 PHAGE_Entero_mEp460: tail length tape measure protein; SD15574_5510; phage(gi428782329) 0.0 Click
1314603..14718 PHAGE_Entero_mEp460: minor tail protein; SD15574_5511; phage(gi428782330) 1e-16 Click
1414719..15238 PHAGE_Entero_SfV: tail protein; SD15574_5512; phage(gi19549009) 2e-15 Click
1515223..15807 PHAGE_Entero_SfV: tail protein; SD15574_5513; phage(gi19548988) 2e-05 Click
1616129..16908 PHAGE_Escher_D108: tail fiber fragment; SD15574_5514; phage(gi281199697) 5e-53 Click
1716923..17225 PROPHAGE_Escher_Sakai: putative tail fiber assembly protein; SD15574_5515; phage(gi15834244) 2e-34 Click
18complement(17226..17870) bacterial transcriptional regulator family protein; SD15574_5516 0.0 Click
19complement(18217..19419) molybdenum cofactor synthesis domain protein; SD15574_5517 0.0 Click
20complement(19519..20061) hypothetical protein; SD15574_5518 0.0 Click
2120403..20765 NUDIX domain protein; SD15574_5519 0.0 Click
22complement(20804..21406) phosphoglycerate mutase family protein; SD15574_5520 0.0 Click
2321713..22852 PHAGE_Ostreo_1: hypothetical protein H665_p041; SD15574_5521; phage(gi260665911) 1e-22 Click
2422856..23824 PHAGE_Salmon_ST160: GtrB; SD15574_5522; phage(gi318065903) 3e-40 Click
2523824..24860 PHAGE_Prochl_P_SSM7: PRGA-formyltransferase; SD15574_5523; phage(gi326784531) 3e-11 Click
26complement(24861..25314) glutathione-regulated potassium-efflux system protein kefC domain protein; SD15574_5524 0.0 Click
27complement(25318..25680) hydrogenase-1 operon protein hyaF domain protein; SD15574_5525 0.0 Click
2825869..25994 trigger factor domain protein; SD15574_5526 0.0 Click
2927078..27443 PHAGE_Haemop_SuMu: baseplate J family protein gp47; SD15574_5528; phage(gi418489071) 9e-05 Click
3027480..28109 PHAGE_Entero_mEp460: major tail protein; SD15574_5529; phage(gi428782326) 2e-106 Click
3128168..28554 PHAGE_Entero_mEp460: minor tail protein; SD15574_5530; phage(gi428782327) 4e-63 Click
3228617..28892 PHAGE_Entero_mEp460: tail assembly protein; SD15574_5531; phage(gi428782328) 1e-47 Click
3328864..31905 PHAGE_Entero_mEp460: tail length tape measure protein; SD15574_5532; phage(gi428782329) 0.0 Click
3431938..32126 PHAGE_Entero_mEp460: minor tail protein; SD15574_5533; phage(gi428782330) 8e-30 Click
3532887..33648 PHAGE_Entero_mEp460: regulatory protein Rha; SD15574_5534; phage(gi428782357) 9e-58 Click
3633649..33941 PROPHAGE_Shewan_MR-1: ISSod3, transposase; SD15574_5535; phage(gi24375070) 5e-08 Click
37complement(33963..34085) PHAGE_Escher_D108: tail fiber protein; SD15574_5536; phage(gi281199694) 2e-05 Click
38complement(34187..35161) PHAGE_Entero_SfV: tail protein; SD15574_5537; phage(gi19549009) 6e-23 Click
39complement(35151..35603) PHAGE_Burkho_KS10: MuV-like tail protein; SD15574_5538; phage(gi198449306) 5e-11 Click
40complement(35600..36136) PHAGE_Entero_Mu: putative baseplate assembly protein; SD15574_5539; phage(gi9633536) 2e-28 Click
41complement(36127..36438) PHAGE_Entero_SfV: tail protein; SD15574_5540; phage(gi19549006) 8e-06 Click
42complement(36441..37196) PHAGE_Entero_Mu: putative tail protein; SD15574_5541; phage(gi9633535) 3e-36 Click
43complement(37196..38113) DNA circulation protein; SD15574_5542 0.0 Click
44complement(38254..38382) hypothetical protein; SD15574_5543 0.0 Click
45complement(38470..40314) PHAGE_Clostr_phiCTP1: putative tape measure protein; SD15574_5544; phage(gi304360684) 4e-06 Click
46complement(40401..40796) PHAGE_Entero_Mu: hypothetical protein Mup41; SD15574_5545; phage(gi9633532) 2e-15 Click
47complement(40798..41154) PHAGE_Escher_D108: tail tube protein; SD15574_5546; phage(gi281199684) 3e-09 Click
48complement(41164..42639) PHAGE_Entero_Mu: major tail subunit; SD15574_5547; phage(gi9633530) 2e-99 Click
49complement(42639..42839) hypothetical protein; SD15574_5548 0.0 Click
50complement(42805..43416) hypothetical protein; SD15574_5549 0.0 Click
51complement(43413..43955) PHAGE_Pseudo_B3: hypothetical protein B3ORF35; SD15574_5550; phage(gi56692603) 5e-05 Click
52complement(43955..44392) PHAGE_Escher_D108: hypothetical protein; SD15574_5551; phage(gi281199680) 2e-09 Click
53complement(44392..44526) hypothetical protein; SD15574_5552 0.0 Click
54complement(44731..46020) PHAGE_Stx2_c_1717: transposase; SD15574_5553; phage(gi209447153) 9e-148 Click
5547045..47158 hypothetical protein; SD15574_5463 0.0 Click
5647192..47308 hypothetical protein; SD15574_5464 0.0 Click
57complement(47546..47902) putative transposase; SD15574_5465 0.0 Click
58complement(47902..48087) putative transposase; SD15574_5466 0.0 Click
5948770..49087 PROPHAGE_Escher_CFT073: transposase; SD15574_5467; phage(gi26248360) 6e-57 Click
6049204..49866 PROPHAGE_Escher_CFT073: transposase/IS protein; SD15574_5468; phage(gi26248359) 4e-120 Click
61complement(50423..50548) hypothetical protein; SD15574_5469 0.0 Click
6250561..51289 PROPHAGE_Escher_CFT073: putative transposase; SD15574_5470; phage(gi26246170) 8e-112 Click
6351244..51591 PROPHAGE_Escher_EDL933: putative transposase; SD15574_5471; phage(gi15803522) 2e-31 Click
6451913..52071 PROPHAGE_Escher_CFT073: transposase; SD15574_5472; phage(gi26248352) 3e-21 Click
6552102..52414 PROPHAGE_Escher_CFT073: transposase; SD15574_5473; phage(gi26248352) 5e-52 Click
66complement(53232..53363) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFB protein; SD15574_5474; phage(gi17546154) 3e-10 Click
67complement(54792..55112) PROPHAGE_Escher_CFT073: transposase/IS protein; SD15574_5475; phage(gi26248359) 9e-45 Click
6855213..55512 PROPHAGE_Escher_MG1655: IS150 transposase A; SD15574_5476; phage(gi16131428) 3e-52 Click
6955618..55734 PROPHAGE_Escher_MG1655: IS150 transposase A; SD15574_5477; phage(gi16131428) 4e-14 Click
7055731..55943 PROPHAGE_Escher_MG1655: IS150 transposase B; SD15574_5478; phage(gi16131429) 1e-35 Click
7156083..56721 PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_5479; phage(gi16132099) 1e-119 Click
7256793..57623 PHAGE_Entero_mEp460: host specificity protein; SD15574_5480; phage(gi428782334) 1e-156 Click
7357693..58152 PHAGE_Entero_mEp460: Lom protein; SD15574_5481; phage(gi428782335) 3e-81 Click
74complement(58153..58590) PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_5482; phage(gi16132099) 1e-78 Click
75complement(58592..59785) PROPHAGE_Escher_CFT073: transposase; SD15574_5483; phage(gi26248352) 0.0 Click
7660021..60605 PHAGE_Entero_mEp460: host specificity protein; SD15574_5484; phage(gi428782334) 4e-100 Click
7760669..61038 PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_5485; phage(gi16132099) 6e-63 Click
7861175..61309 hypothetical protein; SD15574_5486 0.0 Click
7962204..62338 hypothetical protein; SD15574_5487 0.0 Click
80complement(63038..63271) hypothetical protein; SD15574_5488 0.0 Click
81complement(63689..63849) hypothetical protein; SD15574_5489 0.0 Click
8263906..64514 PHAGE_Entero_mEp460: tail assembly protein; SD15574_0001; phage(gi428782333) 3e-96 Click
8364575..67973 PHAGE_Entero_mEp460: host specificity protein; SD15574_0002; phage(gi428782334) 0.0 Click
8468040..68639 PHAGE_Entero_mEp460: Lom protein; SD15574_0003; phage(gi428782335) 4e-111 Click
85complement(68640..68813) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; SD15574_0004; phage(gi157166059) 2e-29 Click
86complement(69201..69938) PHAGE_Entero_lambda: hypothetical protein lambdap90; SD15574_0005; phage(gi9626267) 1e-55 Click
8769896..70108 hypothetical protein; SD15574_0006 0.0 Click
8870069..72051 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; SD15574_0007; phage(gi16129506) 2e-103 Click
8972051..72635 PHAGE_Entero_HK630: tail fiber assembly protein; SD15574_0008; phage(gi428782810) 4e-105 Click
90complement(73081..73734) TIR domain protein; SD15574_0009 0.0 Click
91complement(73956..74708) PHAGE_Burkho_KS5: gp44; SD15574_0010; phage(gi327198042) 6e-09 Click
92complement(75044..75304) PHAGE_Entero_mEp460: DinI-like protein; SD15574_0011; phage(gi428782337) 3e-39 Click

Region 2, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1349259..349271 attL    CCAGTAACACATT 0.0 Click
2complement(361261..361590) PHAGE_Acinet_ZZ1: putative quaternary ammonium compound-resistance protein qacE; SD15574_0293; phage(gi392973036) 2e-09 Click
3complement(361577..361942) PHAGE_Acinet_ZZ1: putative quaternary ammonium compound-resistance protein qacE; SD15574_0294; phage(gi392973036) 1e-06 Click
4complement(362049..362186) hypothetical protein; SD15574_0295 0.0 Click
5362354..362518 AI-2 transport protein tqsA domain protein; SD15574_0296 0.0 Click
6complement(362524..362649) putative membrane protein; SD15574_0297 0.0 Click
7complement(363256..363537) hypothetical protein; SD15574_0298 0.0 Click
8complement(363551..365029) PHAGE_Burkho_KS9: terminase gp2; SD15574_0299; phage(gi255033734) 1e-82 Click
9complement(365196..365507) PHAGE_Salmon_ST64B: terminase small subunit; SD15574_0300; phage(gi23505446) 8e-12 Click
10complement(365676..365849) hypothetical protein; SD15574_0301 0.0 Click
11complement(365842..366054) PHAGE_Xantho_Xop411: HNH endonuclease; SD15574_0302; phage(gi157325492) 7e-05 Click
12complement(366282..366578) PHAGE_Salmon_ST64B: hypothetical protein sb8; SD15574_0303; phage(gi23505453) 1e-05 Click
13complement(366575..366913) PHAGE_Entero_HK97: putative head-tail adaptor; SD15574_0304; phage(gi9634168) 9e-27 Click
14complement(366910..367950) PHAGE_Salmon_ST64B: Portal Protein; SD15574_0305; phage(gi23505449) 2e-36 Click
15complement(368123..368680) PHAGE_Entero_1: prohead protease; SD15574_0306; phage(gi225626394) 9e-29 Click
16complement(368735..369892) PHAGE_Salmon_ST64B: Major capsid protein precursor; SD15574_0307; phage(gi23505451) 2e-52 Click
17complement(370463..370873) PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; SD15574_0308; phage(gi115304283) 1e-09 Click
18complement(370870..371070) hypothetical protein; SD15574_0309 0.0 Click
19complement(371324..372724) PHAGE_Mycoba_PG1: gp59; SD15574_0310; phage(gi38638462) 3e-30 Click
20complement(372721..373020) hypothetical protein; SD15574_0311 0.0 Click
21complement(373026..373259) hypothetical protein; SD15574_0312 0.0 Click
22complement(373261..373530) hypothetical protein; SD15574_0313 0.0 Click
23complement(373686..374117) PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; SD15574_0314; phage(gi169257169) 2e-07 Click
24complement(374267..374938) hypothetical protein; SD15574_0315 0.0 Click
25375414..375426 attR    CCAGTAACACATT 0.0 Click
26complement(375559..376776) PHAGE_Salmon_vB_SosS_Oslo: integrase; SD15574_0316; phage(gi399528791) 3e-57 Click

Region 3, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1428218..428230 attL    TATATCGCCCTGC 0.0 Click
2437143..437970 PHAGE_Plankt_PaV_LD: ABC transporter; SD15574_0377; phage(gi371496158) 5e-13 Click
3437967..438824 chelated iron transport system membrane protein yfeC; SD15574_0378 0.0 Click
4438821..439678 chelated iron transport system membrane protein yfeD; SD15574_0379 0.0 Click
5complement(439879..440442) PHAGE_Entero_phiP27: hypothetical protein P27p57; SD15574_0380; phage(gi18249921) 5e-86 Click
6complement(440453..441544) PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_0381; phage(gi18249920) 2e-65 Click
7complement(441745..442290) PHAGE_Entero_phiP27: putative tail fiber assembly protein; SD15574_0382; phage(gi18249919) 3e-74 Click
8complement(442293..442766) PHAGE_Salmon_ST64B: tail protein; SD15574_0383; phage(gi23505468) 9e-23 Click
9complement(443681..444286) PHAGE_Burkho_Bcep43: gp32; SD15574_0384; phage(gi41057684) 6e-26 Click
10complement(444288..445043) PHAGE_Acinet_AP22: putative baseplate J-like protein; SD15574_0385; phage(gi388570818) 1e-26 Click
11complement(445073..445525) PHAGE_Acinet_AP22: putative baseplate J-like protein; SD15574_0386; phage(gi388570818) 5e-18 Click
12complement(445522..445878) PHAGE_Burkho_Bcep43: gp50; SD15574_0387; phage(gi41057703) 4e-14 Click
13complement(445891..446568) PHAGE_Burkho_Bcep43: gp36; SD15574_0388; phage(gi41057688) 2e-19 Click
14complement(446549..447418) PHAGE_Burkho_Bcep43: gp38; SD15574_0389; phage(gi41057690) 2e-10 Click
15complement(447670..448476) PHAGE_Stx2_c_1717: transposase; SD15574_0390; phage(gi209447153) 1e-99 Click
16448965..450116 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_0391; phage(gi16132105) 0.0 Click
17450559..450571 attR    TATATCGCCCTGC 0.0 Click
18450700..451305 PHAGE_Entero_4795: putative integrase; SD15574_0392; phage(gi157165986) 2e-56 Click
19451357..452292 PHAGE_Parame_FR483: hypothetical protein FR483_N404R; SD15574_0393; phage(gi155370502) 3e-08 Click
20complement(452421..453719) PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; SD15574_0394; phage(gi310831360) 6e-46 Click

Region 4, total : 37 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(872119..873555) PHAGE_Aeromo_8t: hypothetical protein 44RRORF048c; SD15574_0833; phage(gi37651529) 4e-13 Click
2complement(873787..874232) PROPHAGE_Escher_EDL933: putative transposase; SD15574_0834; phage(gi15803522) 3e-50 Click
3complement(874233..874386) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SD15574_0835; phage(gi157166067) 1e-24 Click
4874492..874920 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SD15574_0836; phage(gi24373865) 1e-09 Click
5complement(875035..875208) transposase domain protein; SD15574_0837 0.0 Click
6complement(875288..875364) tRNA 0.0 Click
7complement(875366..875442) tRNA 0.0 Click
8875422..875433 attL    GACCAACTGAGC 0.0 Click
9complement(875632..876186) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; SD15574_0840; phage(gi399528832) 5e-06 Click
10complement(876183..876473) PHAGE_Erwini_phiEt88: hypothetical protein; SD15574_0841; phage(gi327198620) 3e-32 Click
11complement(876473..877072) PHAGE_Entero_mEp237: hypothetical protein; SD15574_0842; phage(gi435439315) 9e-54 Click
12complement(877111..877398) hypothetical protein; SD15574_0843 0.0 Click
13complement(878031..878597) hypothetical protein; SD15574_0844 0.0 Click
14879471..879754 PROPHAGE_Xantho_33913: ISxac3 transposase; SD15574_0845; phage(gi21231087) 5e-07 Click
15complement(879755..880426) PROPHAGE_Escher_CFT073: putative transposase; SD15574_0846; phage(gi26246170) 1e-120 Click
16880439..880627 nitrite extrusion protein 2; SD15574_0847 0.0 Click
17complement(880687..881400) PROPHAGE_Escher_CFT073: transposase insF; SD15574_0848; phage(gi26249410) 3e-136 Click
18complement(881590..882741) PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_0849; phage(gi16132105) 0.0 Click
19complement(882742..883065) PROPHAGE_Xantho_33913: ISxac3 transposase; SD15574_0850; phage(gi21231087) 3e-07 Click
20complement(883127..883468) PHAGE_Salmon_1: hypothetical protein STM0898.3n.Fels1; SD15574_0851; phage(gi169257166) 9e-26 Click
21complement(883664..883870) PHAGE_Entero_phiP27: hypothetical protein P27p08; SD15574_0852; phage(gi18249872) 3e-31 Click
22884106..884270 hypothetical protein; SD15574_0853 0.0 Click
23complement(884299..884487) PHAGE_Entero_phiP27: hypothetical protein P27p10; SD15574_0854; phage(gi18249874) 6e-28 Click
24complement(884758..885414) PHAGE_Entero_phiP27: putative lambda repressor; SD15574_0855; phage(gi18249875) 1e-125 Click
25885984..886097 hypothetical protein; SD15574_0856 0.0 Click
26886324..886713 PROPHAGE_Shewan_MR-1: ISSod6, transposase; SD15574_0857; phage(gi24374783) 1e-14 Click
27complement(886724..887017) PHAGE_Burkho_Bcep176: gp17; SD15574_0858; phage(gi77864642) 6e-07 Click
28887137..887844 PHAGE_Entero_phiP27: hypothetical protein P27p14; SD15574_0859; phage(gi18249878) 2e-99 Click
29887864..888040 hypothetical protein; SD15574_0860 0.0 Click
30complement(888062..888391) hypothetical protein; SD15574_0861 0.0 Click
31complement(888423..888710) hypothetical protein; SD15574_0862 0.0 Click
32888675..889613 PHAGE_Entero_phiP27: hypothetical protein P27p16; SD15574_0863; phage(gi18249880) 4e-29 Click
33889610..889843 PHAGE_Entero_mEp460: hypothetical protein; SD15574_0864; phage(gi428782358) 2e-17 Click
34889830..890738 PHAGE_Entero_phiP27: hypothetical protein P27p17; SD15574_0865; phage(gi18249881) 4e-74 Click
35890749..891627 PHAGE_Entero_phiP27: putative replication protein DnaC; SD15574_0866; phage(gi18249882) 6e-141 Click
36891624..892205 PHAGE_Entero_phiP27: putative helicase; SD15574_0867; phage(gi18249883) 1e-101 Click
37892236..893015 PHAGE_Entero_phiP27: putative helicase; SD15574_0868; phage(gi18249883) 5e-142 Click
38893027..893269 PHAGE_Entero_phiP27: hypothetical protein P27p20; SD15574_0869; phage(gi18249884) 4e-37 Click
39893269..893643 PHAGE_Escher_HK75: RusA-like protein; SD15574_0870; phage(gi356870726) 6e-36 Click
40893640..894461 PHAGE_Entero_HK225: late gene regulator Q; SD15574_0871; phage(gi428782441) 3e-88 Click
41898637..898648 attR    GACCAACTGAGC 0.0 Click

Region 5, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11065644..1066702 PHAGE_Plankt_PaV_LD: ABC transporter; SD15574_1068; phage(gi371496158) 6e-22 Click
2complement(1066703..1067521) cof-like hydrolase family protein; SD15574_1069 0.0 Click
31067622..1067633 attL    AAAAGCGACTAA 0.0 Click
4complement(1067757..1068803) PHAGE_Entero_mEp235: integrase; SD15574_1070; phage(gi428781836) 1e-78 Click
51068851..1068979 hypothetical protein; SD15574_1071 0.0 Click
6complement(1069336..1070379) PHAGE_Cronob_phiES15: hypothetical protein; SD15574_1072; phage(gi401817570) 2e-175 Click
7complement(1070439..1070735) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; SD15574_1073; phage(gi116222045) 1e-43 Click
8complement(1070713..1072266) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; SD15574_1074; phage(gi169257272) 7e-44 Click
9complement(1072330..1072671) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; SD15574_1075; phage(gi169257272) 8e-33 Click
10complement(1072800..1073045) rac prophage; predicted protein; SD15574_1076 0.0 Click
11complement(1073418..1074266) PHAGE_Entero_mEp460: regulatory protein Rha; SD15574_1077; phage(gi428782357) 9e-57 Click
12complement(1074784..1075815) PROPHAGE_Escher_EDL933: putative transposase; SD15574_1078; phage(gi15803522) 2e-146 Click
13complement(1076102..1076314) PHAGE_Cronob_phiES15: hypothetical protein; SD15574_1079; phage(gi401817573) 2e-11 Click
14complement(1076307..1076462) PHAGE_Salico_CGphi29: hypothetical protein; SD15574_1080; phage(gi472340166) 2e-09 Click
151076778..1076990 hypothetical protein; SD15574_1081 0.0 Click
161077149..1077376 PHAGE_Pectob_ZF40: putative cro anti-repressor; SD15574_1082; phage(gi422936651) 1e-09 Click
171077541..1077783 hypothetical protein; SD15574_1083 0.0 Click
181078100..1078645 PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; SD15574_1084; phage(gi169257279) 3e-22 Click
191078652..1079398 PHAGE_Gifsy_2: bacteriophage DNA replication protein; SD15574_1085; phage(gi169257280) 1e-79 Click
20complement(1079730..1080128) PROPHAGE_Shewan_MR-1: ISSod3, transposase; SD15574_1086; phage(gi24375070) 4e-16 Click
21complement(1080173..1080922) PROPHAGE_Xantho_33913: IS1481 transposase; SD15574_1087; phage(gi21229606) 3e-27 Click
221080974..1081891 PROPHAGE_Escher_Sakai: tail fiber; SD15574_1088; phage(gi15834243) 1e-35 Click
231081906..1082436 PROPHAGE_Escher_Sakai: putative tail fiber assembly protein; SD15574_1089; phage(gi15834244) 5e-58 Click
241082423..1083826 PHAGE_Gifsy_2: bacteriophage side tail fiber protein; Lambda gpStf (gpN) homolog; SD15574_1090; phage(gi169257320) 3e-22 Click
251084021..1084401 PHAGE_Entero_phiP27: hypothetical protein P27p57; SD15574_1091; phage(gi18249921) 5e-43 Click
261084662..1085357 PHAGE_Escher_D108: DNA modification protein Mom; SD15574_1092; phage(gi281199700) 3e-130 Click
271085308..1085319 attR    AAAAGCGACTAA 0.0 Click
281085461..1085798 PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_1093; phage(gi16132099) 3e-55 Click

Region 6, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11096726..1097802 PHAGE_Staphy_JD007: glycerophosphoryl diester phosphodiesterase; SD15574_1105; phage(gi428783010) 1e-10 Click
2complement(1097844..1098050) hypothetical protein; SD15574_1106 0.0 Click
3complement(1098182..1099213) PROPHAGE_Escher_EDL933: putative transposase; SD15574_1107; phage(gi15803522) 1e-145 Click
41099420..1100070 protein inaA; SD15574_1108 0.0 Click
5complement(1100124..1100378) PHAGE_Pseudo_OBP: putative 2Fe-2S ferredoxin; SD15574_1109; phage(gi371671579) 3e-24 Click
6complement(1100378..1101508) PHAGE_Salmon_SSU5: putative ribonucleotide-diphosphate reductase, beta subunit; SD15574_1110; phage(gi410491489) 4e-125 Click
7complement(1101742..1104027) PHAGE_Salmon_SSU5: putative ribonucleotide-diphosphate reductase, alpha subunit; SD15574_1111; phage(gi410491488) 0.0 Click
81104164..1104298 PHAGE_Entero_P1: UpfO; SD15574_1112; phage(gi46401720) 3e-06 Click
91104771..1107284 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; SD15574_1113; phage(gi414087138) 5e-07 Click

Region 7, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11155976..1155987 attL    GCTGCGCTACGT 0.0 Click
21160492..1161889 PROPHAGE_Escher_CFT073: Pic serine protease precursor; SD15574_1163; phage(gi26246250) 8e-15 Click
31161853..1161966 hypothetical protein; SD15574_1164 0.0 Click
4complement(1162544..1162825) hypothetical protein; SD15574_1165 0.0 Click
5complement(1163082..1163624) PHAGE_Entero_N15: gp1; SD15574_1166; phage(gi9630465) 4e-36 Click
6complement(1163831..1164223) hypothetical protein; SD15574_1167 0.0 Click
7complement(1164257..1164592) PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; SD15574_1168; phage(gi169257231) 7e-08 Click
8complement(1164605..1165660) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; SD15574_1169; phage(gi169257230) 3e-84 Click
9complement(1165660..1165866) hypothetical protein; SD15574_1170 0.0 Click
10complement(1166282..1166704) PHAGE_Pseudo_F116: single-stranded DNA-binding protein; SD15574_1171; phage(gi56692915) 4e-10 Click
11complement(1166701..1166880) hypothetical protein; SD15574_1172 0.0 Click
121166900..1167013 hypothetical protein; SD15574_1173 0.0 Click
13complement(1167268..1169016) PHAGE_Entero_P4: DNA primase; SD15574_1174; phage(gi9627512) 3e-92 Click
14complement(1169013..1169312) hypothetical protein; SD15574_1175 0.0 Click
15complement(1169318..1169452) hypothetical protein; SD15574_1176 0.0 Click
16complement(1169538..1169708) hypothetical protein; SD15574_1177 0.0 Click
17complement(1169995..1171065) icd-like protein; SD15574_1178 0.0 Click
18complement(1171080..1171205) hypothetical protein; SD15574_1179 0.0 Click
191171204..1171374 hypothetical protein; SD15574_1180 0.0 Click
20complement(1171783..1173024) PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; SD15574_1181; phage(gi16130540) 1e-127 Click
211173314..1173325 attR    GCTGCGCTACGT 0.0 Click

Region 8, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1229974..1230243) PHAGE_Entero_HK630: tail fiber assembly protein; SD15574_1243; phage(gi428782810) 8e-22 Click
21231950..1232927 60 kDa antigen domain protein; SD15574_1244 0.0 Click
3complement(1233107..1233670) PHAGE_Entero_phiP27: hypothetical protein P27p57; SD15574_1245; phage(gi18249921) 1e-80 Click
4complement(1233681..1234385) PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_1246; phage(gi18249920) 1e-17 Click
5complement(1234508..1234996) PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_1247; phage(gi18249920) 1e-37 Click
6complement(1235122..1235280) PHAGE_Entero_phiP27: putative tail fiber assembly protein; SD15574_1248; phage(gi18249919) 4e-15 Click
7complement(1235235..1235414) PHAGE_Entero_phiP27: putative tail fiber assembly protein; SD15574_1249; phage(gi18249919) 1e-21 Click
81235652..1235999 PHAGE_Stx2_c_1717: transposase; SD15574_1250; phage(gi209447152) 1e-32 Click
91236287..1237576 PHAGE_Stx2_c_1717: transposase; SD15574_1251; phage(gi209447153) 9e-148 Click
10complement(1237701..1238339) PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_1252; phage(gi16132099) 5e-118 Click
11complement(1238458..1239045) PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_1253; phage(gi16132099) 3e-85 Click
121239251..1240435 amino acid permease family protein; SD15574_1254 0.0 Click
131240519..1241550 PROPHAGE_Escher_EDL933: putative transposase; SD15574_1255; phage(gi15803522) 2e-145 Click
14complement(1241597..1242505) PHAGE_Burkho_phi1026b: gp58; SD15574_1256; phage(gi38707948) 2e-08 Click
151242605..1243195 NADPH-dependent FMN reductase family protein; SD15574_1257 0.0 Click
16complement(1243277..1244017) PHAGE_Entero_T4: NrdG anaerobic NTP reductase, small subunit; SD15574_1258; phage(gi9632803) 5e-07 Click
17complement(1244209..1246491) PHAGE_Klebsi_KP27: hypothetical protein; SD15574_1259; phage(gi448260626) 1e-22 Click

Region 9, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11332715..1332777 attL    TCAGATCGCACAATCCGGGCTAAGTTCCCTCAAAGTGATCTACTATTCCGCGCAGCTATTTAG 0.0 Click
21343640..1343993 PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_1352; phage(gi18249920) 7e-10 Click
31344354..1344917 PHAGE_Entero_phiP27: hypothetical protein P27p57; SD15574_1353; phage(gi18249921) 3e-82 Click
4complement(1345097..1346134) 60 kDa antigen; SD15574_1354 0.0 Click
51346970..1347149 PROPHAGE_Escher_CFT073: transposase; SD15574_1355; phage(gi26246249) 6e-06 Click
6complement(1347423..1348496) PHAGE_Entero_mEp235: integrase; SD15574_1356; phage(gi428781836) 0.0 Click
7complement(1348777..1349433) PHAGE_Entero_Min27: hypothetical protein; SD15574_1357; phage(gi170783645) 2e-46 Click
8complement(1349759..1350541) PHAGE_Stx2_c_II: putative antirepressor-like protein; SD15574_1358; phage(gi302393152) 1e-43 Click
9complement(1350684..1350806) PHAGE_Entero_phiP27: hypothetical protein P27p03; SD15574_1359; phage(gi18249867) 2e-10 Click
10complement(1351011..1351472) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; SD15574_1360; phage(gi20065868) 3e-45 Click
11complement(1351457..1352099) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SD15574_1361; phage(gi16130763) 1e-125 Click
121352100..1352499 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SD15574_1362; phage(gi24111655) 2e-73 Click
13complement(1352682..1353395) PROPHAGE_Escher_CFT073: transposase insF; SD15574_1363; phage(gi26249410) 3e-136 Click
141353640..1354791 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_1364; phage(gi16132105) 0.0 Click
15complement(1355042..1355707) putative transposase; SD15574_1365 0.0 Click
16complement(1355948..1356979) PROPHAGE_Escher_EDL933: putative transposase; SD15574_1366; phage(gi15803522) 6e-146 Click
171357021..1357083 attR    TCAGATCGCACAATCCGGGCTAAGTTCCCTCAAAGTGATCTACTATTCCGCGCAGCTATTTAG 0.0 Click

Region 10, total : 74 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11499485..1499496 attL    TCTACGCCAGTT 0.0 Click
2complement(1501704..1501880) PHAGE_Entero_phiP27: hypothetical protein P27p58; SD15574_1539; phage(gi18249922) 2e-12 Click
31501977..1502225 PHAGE_Entero_mEp460: DinI-like protein; SD15574_1540; phage(gi428782337) 1e-41 Click
4complement(1502709..1502849) hypothetical protein; SD15574_1541 0.0 Click
51503453..1504577 60 kDa antigen; SD15574_1542 0.0 Click
6complement(1504757..1505320) PHAGE_Entero_phiP27: hypothetical protein P27p57; SD15574_1543; phage(gi18249921) 9e-80 Click
7complement(1505331..1506743) PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_1544; phage(gi18249920) 6e-74 Click
8complement(1506807..1507364) PHAGE_Entero_mEp460: Lom protein; SD15574_1545; phage(gi428782335) 3e-93 Click
9complement(1507432..1510911) PHAGE_Entero_mEp460: host specificity protein; SD15574_1546; phage(gi428782334) 0.0 Click
10complement(1510972..1511574) PHAGE_Entero_mEp460: tail assembly protein; SD15574_1547; phage(gi428782333) 4e-79 Click
111511595..1511699 hypothetical protein; SD15574_1548 0.0 Click
12complement(1511700..1512413) PROPHAGE_Escher_CFT073: putative transposase; SD15574_1549; phage(gi26246170) 9e-121 Click
131512426..1512590 hypothetical protein; SD15574_1550 0.0 Click
141512597..1512655 attL    TGTTGCATTGACAGATTGAATCTACAACAGCGTATTTTGCACAGGAGTCGCTGAAAAAT 0.0 Click
151512804..1513517 PROPHAGE_Escher_CFT073: transposase insF; SD15574_1551; phage(gi26249410) 8e-135 Click
16complement(1513577..1513765) nitrite extrusion protein 2; SD15574_1552 0.0 Click
171513778..1514809 PROPHAGE_Escher_EDL933: putative transposase; SD15574_1553; phage(gi15803522) 2e-145 Click
181514880..1515227 hypothetical protein; SD15574_1554 0.0 Click
191515280..1515675 hypothetical protein; SD15574_1555 0.0 Click
201515716..1516459 PHAGE_Synech_S_CRM01: methyltransferase domain-containing protein; SD15574_1556; phage(gi333798309) 1e-24 Click
211516456..1517427 methyltransferase domain protein; SD15574_1557 0.0 Click
22complement(1517592..1518572) trimethylamine-N-oxide reductase 2 domain protein; SD15574_1558 0.0 Click
23complement(1518612..1520021) trimethylamine-N-oxide reductase 2 domain protein; SD15574_1559 0.0 Click
24complement(1520046..1521146) cytochrome c-type protein torY; SD15574_1560 0.0 Click
25complement(1521534..1522280) cutC family protein; SD15574_1561 0.0 Click
26complement(1522294..1522860) yecM family protein; SD15574_1562 0.0 Click
271523076..1524809 PHAGE_Acanth_mimivirus: arginyl-tRNA synthetase; SD15574_1563; phage(gi311978065) 5e-78 Click
281524986..1525474 hypothetical protein; SD15574_1564 0.0 Click
29complement(1525596..1525718) flagellar protein flhE; SD15574_1565 0.0 Click
30complement(1525912..1526040) hypothetical protein; SD15574_1566 0.0 Click
311526053..1527087 PROPHAGE_Escher_EDL933: putative transposase; SD15574_1567; phage(gi15803522) 1e-145 Click
321527068..1527247 PROPHAGE_Escher_CFT073: transposase insC; SD15574_1568; phage(gi26249447) 6e-18 Click
331527276..1528005 PROPHAGE_Escher_EDL933: putative transposase; SD15574_1569; phage(gi15803522) 3e-97 Click
34complement(1528064..1530142) flagellar biosynthesis protein FlhA; SD15574_1570 0.0 Click
35complement(1530135..1531283) flagellar biosynthetic protein FlhB; SD15574_1571 0.0 Click
36complement(1531485..1532129) chemotaxis protein cheZ; SD15574_1572 0.0 Click
37complement(1532140..1532529) PHAGE_Ectoca_1: EsV-1-65; SD15574_1573; phage(gi13242537) 3e-10 Click
38complement(1532544..1533593) response regulator; SD15574_1574 0.0 Click
39complement(1533596..1534456) chemotaxis protein methyltransferase; SD15574_1575 0.0 Click
40complement(1534475..1535575) PHAGE_Entero_HK629: tail fiber protein; SD15574_1576; phage(gi428782034) 9e-08 Click
41complement(1535672..1536076) methyl-accepting chemotaxis protein IV domain protein; SD15574_1577 0.0 Click
42complement(1536122..1536319) methyl-accepting chemotaxis protein II domain protein; SD15574_1578 0.0 Click
43complement(1536335..1537303) PHAGE_Pseudo_Bf7: putative tail fiber protein; SD15574_1579; phage(gi374531639) 8e-05 Click
44complement(1537319..1537783) methyl-accepting chemotaxis protein II domain protein; SD15574_1580 0.0 Click
45complement(1537928..1538431) chemotaxis protein cheW; SD15574_1581 0.0 Click
46complement(1538452..1538601) chemotaxis protein cheA domain protein; SD15574_1582 0.0 Click
471538680..1540026 PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_1583; phage(gi16132099) 0.0 Click
48complement(1540023..1541849) chemotaxis protein cheA; SD15574_1584 0.0 Click
49complement(1541860..1542786) chemotaxis protein motB; SD15574_1585 0.0 Click
50complement(1542783..1543613) chemotaxis protein motA; SD15574_1586 0.0 Click
51complement(1543761..1544375) flagellar transcriptional activator flhC; SD15574_1587 0.0 Click
52complement(1544378..1544632) flagellar transcriptional activator family protein; SD15574_1588 0.0 Click
53complement(1544994..1545410) PROPHAGE_Escher_CFT073: transposase; SD15574_1589; phage(gi26248352) 3e-71 Click
541545599..1545767 PROPHAGE_Escher_CFT073: transposase insI; SD15574_1590; phage(gi26250328) 7e-29 Click
551545861..1545919 attR    TGTTGCATTGACAGATTGAATCTACAACAGCGTATTTTGCACAGGAGTCGCTGAAAAAT 0.0 Click
561546069..1546782 PROPHAGE_Escher_CFT073: transposase insF; SD15574_1591; phage(gi26249410) 3e-136 Click
57complement(1546823..1546960) exonuclease VIII domain protein; SD15574_1592 0.0 Click
58complement(1546984..1547319) PHAGE_Gifsy_1: hypothetical protein STM2631.Gifsy1; SD15574_1593; phage(gi169257261) 4e-11 Click
591547602..1547890 PHAGE_Escher_HK75: RusA-like protein; SD15574_1594; phage(gi356870726) 3e-22 Click
601547887..1548708 PHAGE_Entero_HK225: late gene regulator Q; SD15574_1595; phage(gi428782441) 3e-88 Click
611548852..1548927 tRNA 0.0 Click
621549899..1550087 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; SD15574_1597; phage(gi209427766) 2e-28 Click
631550084..1550245 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; SD15574_1598; phage(gi116221995) 6e-17 Click
641550395..1550610 PHAGE_Escher_P13374: lysis protein, holin; SD15574_1599; phage(gi410491645) 2e-34 Click
651550615..1551145 PHAGE_Entero_mEp460: hypothetical protein; SD15574_1600; phage(gi428782371) 4e-37 Click
661551467..1552000 PHAGE_Entero_mEp460: endolysin; SD15574_1601; phage(gi428782372) 4e-98 Click
671552356..1552772 PHAGE_Escher_P13374: endopeptidase; SD15574_1602; phage(gi410491649) 1e-63 Click
681552975..1553496 PHAGE_Salmon_SPN3UB: KilA-N domain protein; SD15574_1603; phage(gi423262448) 7e-102 Click
69complement(1553636..1553812) hypothetical protein; SD15574_1604 0.0 Click
701554170..1554664 PHAGE_Entero_mEp460: terminase small subunit; SD15574_1605; phage(gi428782317) 7e-85 Click
711554664..1556766 PHAGE_Entero_mEp460: terminase large subunit; SD15574_1606; phage(gi428782318) 0.0 Click
721556763..1556975 PHAGE_Entero_mEp460: hypothetical protein; SD15574_1607; phage(gi428782319) 1e-29 Click
731557221..1558480 PHAGE_Entero_mEp460: portal protein; SD15574_1608; phage(gi428782320) 0.0 Click
741558494..1560485 PHAGE_Entero_mEp460: putative protease/scaffold protein; SD15574_1609; phage(gi428782321) 0.0 Click
751560572..1560895 PHAGE_Entero_mEp460: hypothetical protein; SD15574_1610; phage(gi428782322) 7e-55 Click
761561158..1562504 PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_1611; phage(gi16132099) 0.0 Click
771562574..1563272 PHAGE_Invert_6: 235L; SD15574_1612; phage(gi15078947) 1e-06 Click
78complement(1563276..1564190) hypothetical protein; SD15574_1613 0.0 Click
79complement(1564397..1565848) PHAGE_Microm_MpV1: hypothetical protein; SD15574_1614; phage(gi313768442) 2e-14 Click
801570193..1570204 attR    TCTACGCCAGTT 0.0 Click

Region 11, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11667725..1667739 attL    AAAATAAATTTTTTA 0.0 Click
2complement(1675815..1677455) PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; SD15574_1735; phage(gi169257204) 3e-07 Click
3complement(1677729..1678442) PROPHAGE_Escher_CFT073: transposase insF; SD15574_1736; phage(gi26249410) 2e-134 Click
4complement(1678632..1679356) PHAGE_Spirop_R8A2B: putative transposase; SD15574_1737; phage(gi9626114) 9e-12 Click
5complement(1679383..1679571) putative transposase; SD15574_1738 0.0 Click
61679684..1680034 PROPHAGE_Escher_MG1655: IS150 transposase B; SD15574_1739; phage(gi16131429) 1e-50 Click
71680300..1680539 PROPHAGE_Shewan_MR-1: ISSod3, transposase; SD15574_1740; phage(gi24375070) 5e-07 Click
81680550..1680708 putative transposase; SD15574_1741 0.0 Click
91680705..1681493 PROPHAGE_Shewan_MR-1: ISSod3, transposase; SD15574_1742; phage(gi24375070) 3e-30 Click
101681948..1682559 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SD15574_1743; phage(gi157166067) 1e-113 Click
11complement(1682599..1682787) PROPHAGE_Escher_CFT073: transposase insF; SD15574_1744; phage(gi26249410) 6e-26 Click
121682927..1683512 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_1745; phage(gi16132105) 3e-106 Click
13complement(1683513..1684519) PROPHAGE_Escher_EDL933: putative transposase; SD15574_1746; phage(gi15803522) 2e-146 Click
141684532..1684696 hypothetical protein; SD15574_1747 0.0 Click
151685007..1685120 hypothetical protein; SD15574_1748 0.0 Click
161685790..1685804 attR    AAAATAAATTTTTTA 0.0 Click
171686900..1687088 PROPHAGE_Escher_EDL933: putative transposase; SD15574_1749; phage(gi15803522) 6e-05 Click
181687075..1687230 putative transposase; SD15574_1750 0.0 Click
191687211..1687351 PROPHAGE_Escher_CFT073: transposase insI; SD15574_1751; phage(gi26250328) 5e-12 Click
201687541..1688254 PROPHAGE_Escher_CFT073: transposase insF; SD15574_1752; phage(gi26249410) 3e-136 Click

Region 12, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11802054..1802066 attL    ATAAAAAGGCGCG 0.0 Click
2complement(1804397..1804960) PHAGE_Stx2_c_1717: transposase; SD15574_1875; phage(gi209447153) 3e-61 Click
31805416..1806156 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_1876; phage(gi16132105) 8e-139 Click
41806114..1806566 PROPHAGE_Escher_CFT073: transposase insI; SD15574_1877; phage(gi26250328) 7e-78 Click
51806756..1807468 PROPHAGE_Escher_CFT073: transposase insF; SD15574_1878; phage(gi26249410) 4e-128 Click
61807469..1807906 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_1879; phage(gi16132105) 6e-81 Click
71807864..1808232 PROPHAGE_Escher_CFT073: transposase insI; SD15574_1880; phage(gi26250328) 8e-60 Click
8complement(1808215..1809270) PROPHAGE_Escher_EDL933: putative transposase; SD15574_1881; phage(gi15803522) 2e-146 Click
91809283..1809447 hypothetical protein; SD15574_1882 0.0 Click
101809662..1810375 PROPHAGE_Escher_CFT073: transposase insF; SD15574_1883; phage(gi26249410) 3e-136 Click
11complement(1810372..1811877) PHAGE_Escher_P13374: helicase; SD15574_1884; phage(gi410491631) 0.0 Click
12complement(1811871..1812257) PHAGE_Escher_P13374: hypothetical protein; SD15574_1885; phage(gi410491630) 4e-13 Click
131813128..1813847 PHAGE_Escher_P13374: prophage repressor CI; SD15574_1886; phage(gi410491627) 3e-89 Click
14complement(1814254..1814385) hicB family protein; SD15574_1887 0.0 Click
15complement(1814595..1814849) PHAGE_Entero_mEp234: HicA protein; SD15574_1888; phage(gi428782292) 2e-09 Click
161815574..1815586 attL    GCGGTTTTTTTAT 0.0 Click
171815751..1816389 PHAGE_Escher_P13374: regulatory protein; SD15574_1889; phage(gi410491624) 2e-84 Click
181816460..1816672 PHAGE_Escher_P13374: host killing protein; SD15574_1890; phage(gi410491620) 6e-34 Click
191816684..1816965 PHAGE_Escher_P13374: hypothetical protein; SD15574_1891; phage(gi410491619) 2e-45 Click
201816986..1817267 PHAGE_Escher_P13374: hypothetical protein; SD15574_1892; phage(gi410491618) 9e-50 Click
211817285..1817635 PHAGE_Escher_P13374: recombinase; SD15574_1893; phage(gi410491617) 2e-61 Click
22complement(1817676..1818389) PROPHAGE_Escher_CFT073: transposase insF; SD15574_1894; phage(gi26249410) 3e-135 Click
23complement(1818579..1819385) PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_1895; phage(gi16132105) 4e-156 Click
24complement(1819450..1819731) PROPHAGE_Escher_EDL933: partial putative transposase; SD15574_1896; phage(gi15801060) 4e-35 Click
251820282..1820686 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip087; SD15574_1897; phage(gi20065882) 3e-34 Click
26complement(1820870..1821481) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SD15574_1898; phage(gi157166067) 1e-113 Click
27complement(1821753..1821874) PHAGE_Stx2_c_II: putative transposase; SD15574_1899; phage(gi302393161) 5e-16 Click
28complement(1821875..1822237) PROPHAGE_Escher_CFT073: transposase insI; SD15574_1900; phage(gi26250328) 1e-63 Click
29complement(1822625..1823503) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SD15574_1901; phage(gi16130763) 9e-172 Click
30complement(1823461..1823826) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_1902; phage(gi17546153) 4e-45 Click
31complement(1823983..1824480) entry exclusion protein; SD15574_1903 0.0 Click
321824556..1825587 PROPHAGE_Escher_EDL933: putative transposase; SD15574_1904; phage(gi15803522) 1e-145 Click
33complement(1825809..1826168) hypothetical protein; SD15574_1905 0.0 Click
34complement(1826339..1826977) lysE type translocator family protein; SD15574_1906 0.0 Click
35complement(1827104..1828027) PHAGE_Burkho_phi1026b: gp58; SD15574_1907; phage(gi38707948) 1e-10 Click
361829250..1829262 attR    GCGGTTTTTTTAT 0.0 Click
371837732..1837744 attR    ATAAAAAGGCGCG 0.0 Click

Region 13, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11868148..1868161 attL    CTAAATAGCTGCGC 0.0 Click
21875911..1877239 PHAGE_Salmon_SSU5: putative terminase large subunit; SD15574_1959; phage(gi410491412) 2e-16 Click
31877257..1878693 hypothetical protein; SD15574_1960 0.0 Click
41878752..1879135 hypothetical protein; SD15574_1961 0.0 Click
51879517..1880112 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_1962; phage(gi16132105) 8e-111 Click
6complement(1880113..1880581) PROPHAGE_Escher_EDL933: putative transposase; SD15574_1963; phage(gi15803522) 7e-73 Click
7complement(1880625..1880987) PROPHAGE_Escher_CFT073: putative transposase; SD15574_1964; phage(gi26246170) 7e-53 Click
81881000..1881116 hypothetical protein; SD15574_1965 0.0 Click
91881417..1881462 attL    AGCGATGTGTCAGGTATTTGGTGTATCCAGGAGCGGTTATTACAAC 0.0 Click
101881526..1882239 PROPHAGE_Escher_CFT073: transposase insF; SD15574_1966; phage(gi26249410) 3e-136 Click
11complement(1882236..1882364) hypothetical protein; SD15574_1967 0.0 Click
121882416..1882703 PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0002; SD15574_1968; phage(gi89885983) 7e-14 Click
13complement(1882813..1883121) PHAGE_Salmon_ST64B: hypothetical protein sb32; SD15574_1969; phage(gi23505476) 8e-12 Click
14complement(1883327..1883503) PHAGE_Shigel_AG3: hypothetical protein; SD15574_1970; phage(gi282599330) 6e-14 Click
15complement(1883496..1883612) hypothetical protein; SD15574_1971 0.0 Click
16complement(1883725..1884321) PROPHAGE_Shewan_MR-1: ISSod3, transposase; SD15574_1972; phage(gi24375070) 7e-20 Click
17complement(1884311..1884919) PROPHAGE_Xantho_33913: IS1481 transposase; SD15574_1973; phage(gi21229606) 1e-26 Click
18complement(1885935..1886681) PHAGE_Gifsy_2: bacteriophage DNA replication protein; SD15574_1974; phage(gi169257280) 4e-79 Click
19complement(1886688..1887233) PHAGE_Salmon_SPN3UB: PrpO; SD15574_1975; phage(gi423262427) 3e-22 Click
20complement(1887752..1887940) hypothetical protein; SD15574_1976 0.0 Click
21complement(1887954..1888181) PHAGE_Pectob_ZF40: putative cro anti-repressor; SD15574_1977; phage(gi422936651) 1e-09 Click
22complement(1888340..1888552) hypothetical protein; SD15574_1978 0.0 Click
231888868..1889023 PHAGE_Salico_CGphi29: hypothetical protein; SD15574_1979; phage(gi472340166) 2e-09 Click
241889016..1889228 PHAGE_Cronob_phiES15: hypothetical protein; SD15574_1980; phage(gi401817573) 2e-10 Click
251889451..1890164 PROPHAGE_Escher_CFT073: transposase insF; SD15574_1981; phage(gi26249410) 3e-136 Click
261890192..1891382 PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_1982; phage(gi18249920) 6e-58 Click
271891578..1891955 PHAGE_Entero_phiP27: hypothetical protein P27p57; SD15574_1983; phage(gi18249921) 5e-52 Click
28complement(1892135..1893841) PHAGE_Ostreo_OlV1: hypothetical protein; SD15574_1984; phage(gi313843974) 1e-07 Click
29complement(1894218..1894931) PROPHAGE_Escher_CFT073: transposase insF; SD15574_1985; phage(gi26249410) 2e-135 Click
30complement(1895121..1896272) PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_1986; phage(gi16132105) 0.0 Click
31complement(1896330..1896596) PROPHAGE_Xantho_33913: ISxac3 transposase; SD15574_1987; phage(gi21231087) 2e-07 Click
321897081..1897461 PHAGE_Entero_P1: Ppp; SD15574_1988; phage(gi46401710) 1e-28 Click
33complement(1897472..1898110) PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_1989; phage(gi16132099) 4e-119 Click
341898158..1898735 PHAGE_Spirop_R8A2B: putative transposase; SD15574_1990; phage(gi9626114) 5e-11 Click
351898816..1898861 attR    AGCGATGTGTCAGGTATTTGGTGTATCCAGGAGCGGTTATTACAAC 0.0 Click
361898925..1899638 PROPHAGE_Escher_CFT073: transposase insF; SD15574_1991; phage(gi26249410) 1e-135 Click
371899880..1900152 cytochrome b561 family protein; SD15574_1992 0.0 Click
38complement(1901691..1902512) PHAGE_Entero_cdtI: Cytolethal distending toxin B subunit; SD15574_1993; phage(gi148609410) 4e-155 Click
39complement(1902509..1903222) PHAGE_Entero_cdtI: Cytolethal distending toxin A subunit; SD15574_1994; phage(gi148609409) 6e-139 Click
401903249..1903260 attL    TTTTTATAAAAA 0.0 Click
41complement(1903547..1903936) PROPHAGE_Shewan_MR-1: ISSod6, transposase; SD15574_1995; phage(gi24374783) 1e-14 Click
42complement(1904163..1904276) hypothetical protein; SD15574_1996 0.0 Click
43complement(1904624..1905205) PHAGE_Entero_HK630: tail fiber assembly protein; SD15574_1997; phage(gi428782810) 1e-105 Click
44complement(1905205..1906671) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; SD15574_1998; phage(gi16129506) 4e-132 Click
45complement(1906632..1907324) PHAGE_Human__8: LANA; SD15574_1999; phage(gi139472804) 2e-11 Click
46complement(1907410..1908315) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SD15574_2000; phage(gi16130763) 4e-178 Click
47complement(1908273..1908638) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_2001; phage(gi17546153) 4e-45 Click
48complement(1908943..1909407) PHAGE_Entero_cdtI: lysin; SD15574_2002; phage(gi148609441) 7e-68 Click
49complement(1909412..1909936) PHAGE_Entero_mEp460: endolysin; SD15574_2003; phage(gi428782372) 1e-100 Click
50complement(1909992..1910306) PHAGE_Entero_mEp460: hypothetical protein; SD15574_2004; phage(gi428782371) 8e-52 Click
51complement(1910311..1910526) PHAGE_Stx2_c_II: holin; SD15574_2005; phage(gi302393164) 3e-28 Click
52complement(1910778..1910945) hypothetical protein; SD15574_2006 0.0 Click
53complement(1912119..1912250) putative membrane protein; SD15574_2007 0.0 Click
54complement(1912709..1912785) tRNA 0.0 Click
55complement(1912886..1912961) tRNA 0.0 Click
56complement(1913105..1913926) PHAGE_Entero_HK225: late gene regulator Q; SD15574_2010; phage(gi428782441) 3e-88 Click
571915983..1915994 attR    TTTTTATAAAAA 0.0 Click
581916945..1916958 attR    CTAAATAGCTGCGC 0.0 Click

Region 14, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2066545..2067576) PROPHAGE_Escher_EDL933: putative transposase; SD15574_2176; phage(gi15803522) 2e-146 Click
22067589..2067744 hypothetical protein; SD15574_2177 0.0 Click
3complement(2067817..2067954) hypothetical protein; SD15574_2178 0.0 Click
42067974..2069164 PHAGE_Yersin_413C: gpFI; SD15574_2179; phage(gi30065725) 0.0 Click
52069416..2069694 PHAGE_Yersin_413C: FII; SD15574_2180; phage(gi30065726) 2e-45 Click
62069751..2070026 PHAGE_Yersin_413C: gpE; SD15574_2181; phage(gi30065727) 3e-44 Click
72070171..2072618 PHAGE_Yersin_413C: gpT; SD15574_2182; phage(gi30065729) 0.0 Click
82072633..2073112 PHAGE_Yersin_413C: gpU; SD15574_2183; phage(gi30065730) 6e-85 Click
92073112..2074275 PHAGE_Yersin_413C: gpD; SD15574_2184; phage(gi30065731) 0.0 Click

Region 15, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12186372..2186384 attL    TTCTGTTGGCTCG 0.0 Click
2complement(2199773..2201035) PROPHAGE_Escher_CFT073: prophage P4 integrase; SD15574_2297; phage(gi26248270) 1e-141 Click
32201126..2201153 attL    AAGGATTTTCACGCTAACTTACTGAATC 0.0 Click
4complement(2201197..2201272) tRNA 0.0 Click
52201598..2202515 PHAGE_Burkho_phi1026b: gp58; SD15574_2299; phage(gi38707948) 5e-09 Click
62202617..2203567 HTH-type transcriptional regulator cbl; SD15574_2300 0.0 Click
7complement(2203605..2203680) tRNA 0.0 Click
82203874..2205325 hypothetical protein; SD15574_2302 0.0 Click
92205426..2205501 tRNA 0.0 Click
10complement(2205956..2206672) hypothetical protein; SD15574_2304 0.0 Click
11complement(2207178..2207444) transposase domain protein; SD15574_2305 0.0 Click
122208192..2208407 hypothetical protein; SD15574_2306 0.0 Click
13complement(2208387..2208575) putative transposase; SD15574_2307 0.0 Click
142208928..2209062 hypothetical protein; SD15574_2308 0.0 Click
15complement(2209083..2210345) PROPHAGE_Escher_CFT073: prophage P4 integrase; SD15574_2309; phage(gi26248270) 6e-141 Click
162210436..2210463 attR    AAGGATTTTCACGCTAACTTACTGAATC 0.0 Click
17complement(2210507..2210582) tRNA 0.0 Click
18complement(2210683..2211480) hypothetical protein; SD15574_2311 0.0 Click
192211574..2211663 tRNA 0.0 Click
20complement(2211716..2212741) PHAGE_Salmon_ST64B: Integrase protein; SD15574_2313; phage(gi23505472) 7e-105 Click
21complement(2212741..2212863) hypothetical protein; SD15574_2314 0.0 Click
222213086..2213199 hypothetical protein; SD15574_2315 0.0 Click
232213426..2213815 PROPHAGE_Shewan_MR-1: ISSod6, transposase; SD15574_2316; phage(gi24374783) 1e-14 Click
24complement(2213804..2213917) hypothetical protein; SD15574_2317 0.0 Click
252213930..2214339 PROPHAGE_Escher_CFT073: putative transposase; SD15574_2318; phage(gi26246170) 2e-78 Click
262214340..2214606 PROPHAGE_Shewan_MR-1: ISSod3, transposase; SD15574_2319; phage(gi24375070) 4e-05 Click
27complement(2214725..2215408) hypothetical protein; SD15574_2320 0.0 Click
282215436..2215448 attL    AGGATTATAATAA 0.0 Click
29complement(2215495..2216400) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SD15574_2321; phage(gi16130763) 4e-178 Click
30complement(2216358..2216723) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_2322; phage(gi17546153) 1e-45 Click
31complement(2216860..2216979) putative membrane protein; SD15574_2323 0.0 Click
32complement(2217305..2217832) PHAGE_Yersin_413C: gpG; SD15574_2324; phage(gi30065723) 3e-75 Click
33complement(2217836..2218306) PHAGE_Salmon_SSU5: putative phage tail fiber protein; SD15574_2325; phage(gi410491431) 6e-35 Click
34complement(2218679..2219710) PROPHAGE_Escher_EDL933: putative transposase; SD15574_2326; phage(gi15803522) 6e-146 Click
352220620..2220632 attR    AGGATTATAATAA 0.0 Click
362229586..2229598 attR    TTCTGTTGGCTCG 0.0 Click

Region 16, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12438223..2439179 PHAGE_Burkho_phi1026b: gp58; SD15574_2541; phage(gi38707948) 3e-06 Click
2complement(2439218..2440213) 6-phosphogluconolactonase; SD15574_2542 0.0 Click
3complement(2440473..2440604) PHAGE_Escher_D108: G region invertase; SD15574_2543; phage(gi281199698) 4e-09 Click
42441783..2442814 PROPHAGE_Escher_EDL933: putative transposase; SD15574_2544; phage(gi15803522) 2e-146 Click
5complement(2442830..2443162) hypothetical protein; SD15574_2545 0.0 Click
6complement(2443166..2443939) PHAGE_Psychr_pOW20_A: hypothetical protein; SD15574_2546; phage(gi472339828) 2e-08 Click
7complement(2444291..2444749) PHAGE_Psychr_pOW20_A: phage head morphogenesis protein; SD15574_2547; phage(gi472339824) 4e-12 Click
8complement(2444925..2446007) PHAGE_Pectob_ZF40: putative portal protein; SD15574_2548; phage(gi422936682) 1e-29 Click
9complement(2446391..2447431) PHAGE_Psychr_pOW20_A: phage terminase large subunit; SD15574_2549; phage(gi472339822) 3e-102 Click
102447543..2447686 hypothetical protein; SD15574_2550 0.0 Click
11complement(2447745..2448509) PHAGE_Escher_TL_2011c: putative terminase small subunit; SD15574_2551; phage(gi418487072) 2e-16 Click
122449040..2449216 putative membrane protein; SD15574_2552 0.0 Click
13complement(2449305..2449775) PHAGE_Entero_HK620: endopeptidase; SD15574_2553; phage(gi13559860) 4e-76 Click
14complement(2449772..2450269) PHAGE_Stx2_c_1717: phage-related lysozyme; SD15574_2554; phage(gi209447172) 2e-93 Click
15complement(2450269..2450484) PHAGE_Entero_mEp460: porin; SD15574_2555; phage(gi428782370) 9e-30 Click
16complement(2451164..2451238) tRNA 0.0 Click
17complement(2451242..2451317) tRNA 0.0 Click
18complement(2451320..2451396) tRNA 0.0 Click
19complement(2451398..2451474) tRNA 0.0 Click
20complement(2451682..2452239) PHAGE_Stx2_c_II: putative antirepressor-like protein; SD15574_2560; phage(gi302393152) 5e-57 Click
212452718..2453980 PHAGE_Synech_S_SKS1: nucleotide-sugar epimerase; SD15574_2561; phage(gi472340882) 1e-09 Click

Region 17, total : 59 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12527974..2527989 attL    AGGCCTGATAAGACGC 0.0 Click
2complement(2533710..2534867) PHAGE_Parame_1: hypothetical protein; SD15574_2648; phage(gi9631622) 9e-14 Click
3complement(2535026..2536030) PHAGE_Yersin_413C: Int; SD15574_2649; phage(gi30065733) 2e-96 Click
42536150..2536635 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_2650; phage(gi17546153) 1e-07 Click
52536829..2537176 PHAGE_Stx2_c_1717: transposase; SD15574_2651; phage(gi209447152) 5e-43 Click
62537464..2537850 PHAGE_Stx2_c_1717: transposase; SD15574_2652; phage(gi209447153) 3e-26 Click
72537841..2538752 PHAGE_Stx2_c_1717: transposase; SD15574_2653; phage(gi209447153) 1e-106 Click
8complement(2538781..2541072) PHAGE_Yersin_413C: gpA; SD15574_2654; phage(gi30065742) 2e-77 Click
9complement(2541079..2541444) hypothetical protein; SD15574_2655 0.0 Click
10complement(2541517..2541747) hypothetical protein; SD15574_2656 0.0 Click
112541923..2541934 attL    GCACAAAAAAAC 0.0 Click
12complement(2542070..2542369) PHAGE_Entero_mEp213: hypothetical protein; SD15574_2657; phage(gi428782624) 2e-07 Click
13complement(2542366..2542611) hypothetical protein; SD15574_2658 0.0 Click
14complement(2542898..2543011) putative membrane protein; SD15574_2659 0.0 Click
15complement(2543008..2543250) hypothetical protein; SD15574_2660 0.0 Click
16complement(2543262..2543549) hypothetical protein; SD15574_2661 0.0 Click
17complement(2543560..2543901) hypothetical protein; SD15574_2662 0.0 Click
18complement(2544156..2545061) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SD15574_2663; phage(gi16130763) 1e-176 Click
19complement(2545019..2545384) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_2664; phage(gi17546153) 1e-45 Click
20complement(2545490..2545696) putative membrane protein; SD15574_2665 0.0 Click
21complement(2545703..2545840) PHAGE_Yersin_413C: Cox; SD15574_2666; phage(gi30065735) 1e-10 Click
22complement(2546524..2547813) PHAGE_Stx2_c_1717: transposase; SD15574_2667; phage(gi209447153) 9e-148 Click
23complement(2548101..2548448) PHAGE_Stx2_c_1717: transposase; SD15574_2668; phage(gi209447152) 5e-43 Click
24complement(2548642..2549127) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_2669; phage(gi17546153) 1e-07 Click
252549271..2550230 plasmid segregation protein parM; SD15574_2670 0.0 Click
262550235..2550546 hypothetical protein; SD15574_2671 0.0 Click
272550610..2550942 clpX C4-type zinc finger family protein; SD15574_2672 0.0 Click
282550939..2551253 hypothetical protein; SD15574_2673 0.0 Click
292551520..2551747 PHAGE_Pectob_ZF40: hypothetical protein; SD15574_2674; phage(gi422936676) 7e-21 Click
302551749..2552012 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SD15574_2675; phage(gi399498823) 8e-23 Click
312552417..2552428 attR    GCACAAAAAAAC 0.0 Click
32complement(2552774..2553790) PHAGE_Erwini_ENT90: phage portal protein; SD15574_2676; phage(gi431810941) 6e-90 Click
33complement(2553816..2555567) PHAGE_Yersin_413C: gpP; SD15574_2677; phage(gi30065706) 8e-132 Click
342555722..2556558 PHAGE_Salmon_RE_2010: capsid scaffolding protein; SD15574_2678; phage(gi418489698) 2e-45 Click
352556582..2557634 PHAGE_Yersin_413C: gpN; SD15574_2679; phage(gi30065708) 6e-73 Click
362557680..2558480 PHAGE_Ralsto_phiRSA1: terminase; SD15574_2680; phage(gi145708083) 2e-35 Click
372558582..2559076 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); SD15574_2681; phage(gi134288689) 1e-25 Click
382559076..2559276 PHAGE_Yersin_413C: gpX; SD15574_2682; phage(gi30065711) 9e-11 Click
392559279..2559602 PHAGE_Aeromo_phiO18P: putative holin; SD15574_2683; phage(gi148727161) 3e-09 Click
402559599..2559991 PHAGE_Entero_phiP27: putative endolysin; SD15574_2684; phage(gi18249894) 1e-53 Click
412559988..2560395 hypothetical protein; SD15574_2685 0.0 Click
422560533..2561000 PHAGE_Yersin_413C: gpR; SD15574_2686; phage(gi30065716) 6e-19 Click
432560993..2561628 PHAGE_Pseudo_phiCTX: predicted tail completion; SD15574_2687; phage(gi17313233) 1e-19 Click
442561625..2562206 PHAGE_Yersin_413C: gpV; SD15574_2688; phage(gi30065718) 7e-45 Click
452562257..2562553 PHAGE_Erwini_ENT90: baseplate assembly protein; SD15574_2689; phage(gi431810974) 3e-20 Click
462562557..2563204 PHAGE_Yersin_413C: gpJ; SD15574_2690; phage(gi30065720) 4e-61 Click
472563233..2563376 PROPHAGE_Salmon_Ty2: phage baseplate assembly protein; SD15574_2691; phage(gi29143752) 6e-07 Click
482563369..2563899 PHAGE_Yersin_413C: gpI; SD15574_2692; phage(gi30065721) 6e-62 Click
492563902..2566028 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; SD15574_2693; phage(gi16129506) 1e-77 Click
502566047..2566949 PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; SD15574_2694; phage(gi16765208) 5e-48 Click
512567119..2567253 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; SD15574_2695; phage(gi16129505) 4e-19 Click
522567254..2567535 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; SD15574_2696; phage(gi16129505) 3e-39 Click
53complement(2568308..2568796) PROPHAGE_Salmon_Ty2: putative phage tail protein; SD15574_2697; phage(gi29143763) 1e-39 Click
54complement(2568809..2571616) PHAGE_Yersin_413C: gpT; SD15574_2698; phage(gi30065729) 1e-106 Click
55complement(2571603..2571758) PHAGE_Yersin_413C: gpE+E'; SD15574_2699; phage(gi30065728) 3e-07 Click
56complement(2571767..2572141) PHAGE_Mannhe_phiMHaA1: tail protein E; SD15574_2700; phage(gi109289962) 4e-08 Click
57complement(2572307..2572708) PROPHAGE_Salmon_Ty2: major tail tube protein; SD15574_2701; phage(gi29143759) 2e-23 Click
58complement(2572708..2573892) PHAGE_Erwini_ENT90: tail sheath protein; SD15574_2702; phage(gi431810939) 6e-101 Click
592573872..2574003 hypothetical protein; SD15574_2703 0.0 Click
602574050..2574346 PHAGE_Yersin_413C: gpD; SD15574_2704; phage(gi30065731) 2e-20 Click
612574431..2575159 PHAGE_Yersin_413C: gpD; SD15574_2705; phage(gi30065731) 1e-56 Click
622575654..2575794 PHAGE_Escher_P13374: prophage host toxic membrane protein; SD15574_2706; phage(gi410491667) 4e-16 Click
632588786..2588801 attR    AGGCCTGATAAGACGC 0.0 Click

Region 18, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12811221..2811643 PHAGE_Cyanop_MED4_213: membrane protein; SD15574_2949; phage(gi472340360) 3e-06 Click
2complement(2811691..2812563) aldose 1-epimerase family protein; SD15574_2950 0.0 Click
3complement(2812575..2813636) PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; SD15574_2951; phage(gi326781942) 2e-15 Click
4complement(2813702..2814700) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; SD15574_2952; phage(gi163932195) 4e-06 Click
5complement(2814725..2815540) PHAGE_Plankt_PaV_LD: ABC transporter; SD15574_2953; phage(gi371496158) 7e-12 Click
6complement(2815521..2816552) PROPHAGE_Escher_EDL933: putative transposase; SD15574_2954; phage(gi15803522) 2e-146 Click
7complement(2816636..2817391) PHAGE_Plankt_PaV_LD: ABC transporter; SD15574_2955; phage(gi371496158) 4e-11 Click

Region 19, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12838775..2838786 attL    TTTATTTTCATA 0.0 Click
2complement(2842637..2843869) PHAGE_Stx2_c_1717: transposase; SD15574_2976; phage(gi209447153) 2e-119 Click
32844183..2844413 60 kDa antigen domain protein; SD15574_2977 0.0 Click
42844448..2844960 60 kDa antigen domain protein; SD15574_2978 0.0 Click
5complement(2845140..2845517) PHAGE_Entero_phiP27: hypothetical protein P27p57; SD15574_2979; phage(gi18249921) 1e-50 Click
6complement(2845713..2846417) PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_2980; phage(gi18249920) 1e-17 Click
7complement(2846443..2847024) PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_2981; phage(gi18249920) 1e-59 Click
8complement(2847150..2847308) PHAGE_Entero_phiP27: putative tail fiber assembly protein; SD15574_2982; phage(gi18249919) 4e-15 Click
9complement(2847263..2847685) PHAGE_Entero_phiP27: putative tail fiber assembly protein; SD15574_2983; phage(gi18249919) 3e-50 Click
10complement(2847688..2848161) PHAGE_Salmon_ST64B: tail protein; SD15574_2984; phage(gi23505468) 7e-23 Click
112848943..2849671 PHAGE_Escher_phiKT: tail fiber protein; SD15574_2985; phage(gi422936632) 2e-05 Click
122849705..2849878 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; SD15574_2986; phage(gi157166059) 2e-29 Click
13complement(2849917..2850082) PROPHAGE_Escher_CFT073: putative transposase; SD15574_2987; phage(gi26246170) 4e-26 Click
142850158..2850655 entry exclusion protein; SD15574_2988 0.0 Click
152850811..2851176 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_2989; phage(gi17546153) 1e-45 Click
162851134..2851496 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SD15574_2990; phage(gi24111655) 1e-43 Click
172851487..2852035 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SD15574_2991; phage(gi24112460) 4e-107 Click
18complement(2852218..2852931) PROPHAGE_Escher_CFT073: transposase insF; SD15574_2992; phage(gi26249410) 2e-135 Click
192853176..2854327 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_2993; phage(gi16132105) 0.0 Click
202867277..2867288 attR    TTTATTTTCATA 0.0 Click

Region 20, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13008812..3009201 PROPHAGE_Shewan_MR-1: ISSod6, transposase; SD15574_3153; phage(gi24374783) 1e-14 Click
2complement(3009190..3009399) hypothetical protein; SD15574_3154 0.0 Click
33009572..3009901 hypothetical protein; SD15574_3155 0.0 Click
43010149..3010394 PHAGE_Mycoba_Porky: gp37; SD15574_3156; phage(gi194303333) 3e-10 Click
53010391..3010801 PHAGE_Bacill_SP10: ribonucleotide reductase stimulatory protein; SD15574_3157; phage(gi418489617) 7e-14 Click
63010774..3012918 PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; SD15574_3158; phage(gi158079505) 0.0 Click
73012928..3013887 PHAGE_Mycoba_Myrna: gp256; SD15574_3159; phage(gi203454817) 5e-129 Click
83014243..3015445 PHAGE_Plankt_PaV_LD: ABC transporter; SD15574_3160; phage(gi371496158) 1e-24 Click
93015438..3016502 PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; SD15574_3161; phage(gi163932195) 1e-05 Click

Region 21, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3701793..3703292) PHAGE_Ostreo_OlV1: hypothetical protein; SD15574_3913; phage(gi313844203) 3e-08 Click
23703524..3704726 pyridine nucleotide-disulfide oxidoreductase family protein; SD15574_3914 0.0 Click
3complement(3705041..3705301) inner membrane protein yhiM domain protein; SD15574_3915 0.0 Click
4complement(3705529..3705918) PROPHAGE_Shewan_MR-1: ISSod6, transposase; SD15574_3916; phage(gi24374783) 1e-14 Click
5complement(3706145..3706258) hypothetical protein; SD15574_3917 0.0 Click
63706311..3706390 attL    TTCAGGAGGTAACAGGGGCTTGATGATGGTCCATGCCTCATCGGGAAGGTCGTAGCGAGCCATAGTTCAATATGTTGTGT 0.0 Click
73706497..3706712 PROPHAGE_Escher_CFT073: putative transposase; SD15574_3918; phage(gi26246170) 1e-32 Click
83706901..3707527 PROPHAGE_Escher_EDL933: putative transposase; SD15574_3919; phage(gi15803522) 3e-78 Click
93707726..3708150 PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_3920; phage(gi16132099) 3e-75 Click
10complement(3708151..3708324) putative transposase; SD15574_3921 0.0 Click
11complement(3708344..3708685) PROPHAGE_Escher_CFT073: transposase; SD15574_3922; phage(gi26248360) 3e-58 Click
12complement(3708699..3709034) PROPHAGE_Escher_CFT073: transposase; SD15574_3923; phage(gi26248360) 1e-33 Click
13complement(3709520..3710158) PROPHAGE_Escher_CFT073: transposase; SD15574_3924; phage(gi26248346) 2e-86 Click
14complement(3710866..3712017) PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_3925; phage(gi16132105) 0.0 Click
153712361..3712987 PHAGE_Entero_Sf6: putative transposase OrfB; SD15574_3926; phage(gi41057343) 1e-76 Click
16complement(3713186..3713341) hypothetical protein; SD15574_3927 0.0 Click
173713387..3713563 hypothetical protein; SD15574_3928 0.0 Click
183714023..3714136 hypothetical protein; SD15574_3929 0.0 Click
193714363..3714752 PROPHAGE_Shewan_MR-1: ISSod6, transposase; SD15574_3930; phage(gi24374783) 1e-14 Click
203715100..3715303 PROPHAGE_Salmon_Ty2: transposase; SD15574_3931; phage(gi29143766) 1e-31 Click
213715756..3716073 PROPHAGE_Escher_CFT073: transposase; SD15574_3932; phage(gi26246249) 5e-37 Click
223716077..3716601 PROPHAGE_Escher_CFT073: transposase; SD15574_3933; phage(gi26246249) 1e-58 Click
233716628..3716771 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SD15574_3934; phage(gi157166067) 1e-18 Click
24complement(3718128..3718337) PROPHAGE_Escher_MG1655: IS1 transposase B; SD15574_3935; phage(gi16131317) 2e-35 Click
25complement(3718550..3718774) PHAGE_Entero_P1: InsA; SD15574_3936; phage(gi46401643) 3e-36 Click
263719199..3719813 positive transcription regulator evgA; SD15574_3937 0.0 Click
273720027..3722351 PHAGE_Ectoca_1: EsV-1-65; SD15574_3938; phage(gi13242537) 1e-10 Click
283722733..3723884 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_3939; phage(gi16132105) 0.0 Click
293724074..3724787 PROPHAGE_Escher_CFT073: transposase insF; SD15574_3940; phage(gi26249410) 3e-136 Click
303732766..3732845 attR    TTCAGGAGGTAACAGGGGCTTGATGATGGTCCATGCCTCATCGGGAAGGTCGTAGCGAGCCATAGTTCAATATGTTGTGT 0.0 Click

Region 22, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14103832..4103843 attL    CTCTCACCATAC 0.0 Click
2complement(4111260..4111649) PROPHAGE_Shewan_MR-1: ISSod6, transposase; SD15574_4358; phage(gi24374783) 1e-14 Click
3complement(4111876..4112010) hypothetical protein; SD15574_4359 0.0 Click
4complement(4112007..4112642) PHAGE_Bacter_2: injection gp7; SD15574_4360; phage(gi212499729) 3e-60 Click
5complement(4112636..4113097) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; SD15574_4361; phage(gi89885999) 3e-61 Click
6complement(4113114..4113233) hypothetical protein; SD15574_4362 0.0 Click
74113458..4113571 hypothetical protein; SD15574_4363 0.0 Click
8complement(4113892..4116648) PHAGE_Entero_P4: DNA primase; SD15574_4364; phage(gi9627512) 6e-38 Click
9complement(4116999..4117340) hypothetical protein; SD15574_4365 0.0 Click
10complement(4117351..4117953) PHAGE_Entero_phiP27: hypothetical protein P27p06; SD15574_4366; phage(gi18249870) 2e-23 Click
11complement(4117946..4118167) hypothetical protein; SD15574_4367 0.0 Click
12complement(4118164..4118427) hypothetical protein; SD15574_4368 0.0 Click
13complement(4118611..4119678) PHAGE_Entero_phiP27: hypothetical protein P27p16; SD15574_4369; phage(gi18249880) 7e-17 Click
14complement(4119847..4120680) PHAGE_Escher_TL_2011c: putative antirepressor; SD15574_4370; phage(gi418487055) 6e-23 Click
15complement(4121124..4121321) PHAGE_Entero_P4: transcriptional regulator; SD15574_4371; phage(gi9627517) 8e-07 Click
16complement(4121519..4122397) hypothetical protein; SD15574_4372 0.0 Click
174122391..4122402 attR    CTCTCACCATAC 0.0 Click
18complement(4122543..4123757) PROPHAGE_Escher_CFT073: putative prophage integrase; SD15574_4373; phage(gi26250313) 1e-152 Click

Region 23, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4319641..4320690) PHAGE_Ectoca_1: EsV-1-14; SD15574_4575; phage(gi13242486) 5e-08 Click
2complement(4320896..4322305) PHAGE_Acanth_moumouvirus: glutamine synthetase; SD15574_4576; phage(gi441432525) 4e-05 Click
34322678..4324501 PHAGE_Lausan: putative translation elongation factor 1-alpha; SD15574_4577; phage(gi327409596) 2e-07 Click
4complement(4324553..4325899) PROPHAGE_Escher_MG1655: IS4 transposase; SD15574_4578; phage(gi16132099) 0.0 Click
5complement(4326003..4326698) PHAGE_Escher_D108: DNA modification protein Mom; SD15574_4579; phage(gi281199700) 9e-131 Click
6complement(4326959..4327339) PHAGE_Entero_phiP27: hypothetical protein P27p57; SD15574_4580; phage(gi18249921) 1e-43 Click
7complement(4327455..4327580) hypothetical protein; SD15574_4581 0.0 Click
8complement(4327889..4328242) PHAGE_Entero_phiP27: putative tail fiber protein; SD15574_4582; phage(gi18249920) 7e-10 Click

Region 24, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14851599..4851610 attL    ATAGTGGATAAA 0.0 Click
2complement(4860481..4861150) PROPHAGE_Escher_CFT073: putative transposase; SD15574_5134; phage(gi26246170) 1e-121 Click
34861163..4861276 hypothetical protein; SD15574_5135 0.0 Click
44861269..4861634 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_5136; phage(gi17546153) 1e-45 Click
54861592..4861987 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SD15574_5137; phage(gi24111655) 6e-68 Click
64862076..4862498 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SD15574_5138; phage(gi24112460) 4e-79 Click
74862483..4862623 hypothetical protein; SD15574_5139 0.0 Click
84862693..4862875 PHAGE_Entero_Sf6: gene 56 protein; SD15574_5140; phage(gi41057344) 3e-20 Click
9complement(4862872..4863585) PROPHAGE_Escher_CFT073: transposase insF; SD15574_5141; phage(gi26249410) 3e-136 Click
10complement(4863775..4864926) PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_5142; phage(gi16132105) 0.0 Click
114865291..4865647 PROPHAGE_Shewan_MR-1: ISSod3, transposase; SD15574_5143; phage(gi24375070) 7e-13 Click
12complement(4865820..4866305) acetyltransferase family protein; SD15574_5144 0.0 Click
13complement(4866293..4866559) hypothetical protein; SD15574_5145 0.0 Click
14complement(4867897..4869186) PHAGE_Stx2_c_1717: transposase; SD15574_5146; phage(gi209447153) 9e-148 Click
15complement(4869474..4869821) PHAGE_Stx2_c_1717: transposase; SD15574_5147; phage(gi209447152) 5e-43 Click
16complement(4870015..4870500) PHAGE_Stx2_c_1717: truncated transposase; SD15574_5148; phage(gi209447151) 4e-06 Click
174870704..4870937 PROPHAGE_Escher_CFT073: transposase/IS protein; SD15574_5149; phage(gi26248359) 2e-29 Click
18complement(4870989..4871129) N-acetylmuramoyl-L-alanine amidase family domain protein; SD15574_5150 0.0 Click
19complement(4871248..4871373) sugar phosphate transport protein-like protein; SD15574_5151 0.0 Click
204871951..4872235 ribbon-helix-helix protein, copG family protein; SD15574_5152 0.0 Click
21complement(4872201..4872356) hypothetical protein; SD15574_5153 0.0 Click
22complement(4872642..4872779) PHAGE_Erwini_phiEt88: hypothetical protein; SD15574_5154; phage(gi327198626) 2e-09 Click
234872853..4872864 attR    ATAGTGGATAAA 0.0 Click
24complement(4873268..4873765) plasmid segregation protein parM domain protein; SD15574_5155 0.0 Click
254873857..4874507 PHAGE_Stx2_c_1717: transposase; SD15574_5156; phage(gi209447153) 2e-22 Click
264874526..4874906 PHAGE_Stx2_c_1717: transposase; SD15574_5157; phage(gi209447153) 4e-19 Click

Region 25, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15078313..5078324 attL    CAGAAACTCGAT 0.0 Click
25084879..5085556 PHAGE_Strept_VWB: hypothetical protein VWBp55; SD15574_5378; phage(gi41057269) 2e-05 Click
35085942..5087165 PHAGE_Entero_cdtI: Phage integrase; SD15574_5379; phage(gi148609414) 0.0 Click
45087320..5088135 hypothetical protein; SD15574_5380 0.0 Click
5complement(5088465..5089076) PHAGE_Entero_cdtI: Valyl-tRNA synthetase; SD15574_5381; phage(gi148609417) 7e-87 Click
6complement(5089076..5089249) PHAGE_Entero_SfV: hypothetical protein SfVp29; SD15574_5382; phage(gi19549016) 1e-31 Click
7complement(5089429..5089965) PHAGE_Entero_SfV: hypothetical protein SfVp30; SD15574_5383; phage(gi19549017) 2e-101 Click
8complement(5090093..5090917) PHAGE_Entero_SfV: hypothetical protein SfVp31; SD15574_5384; phage(gi19549018) 1e-151 Click
9complement(5090983..5091321) PHAGE_Entero_SfV: hypothetical protein SfVp32; predicted; phage protein; SD15574_5385(gi19549019) 1e-58 Click
105092779..5092979 PHAGE_Entero_SfV: repressor; SD15574_5386; phage(gi19549022) 4e-33 Click
115093863..5094408 PHAGE_Entero_SfV: immunity region; SD15574_5387; phage(gi19549024) 6e-97 Click
125094401..5094637 PHAGE_Entero_SfV: hypothetical protein SfVp38; SD15574_5388; phage(gi19549025) 1e-35 Click
135094634..5095386 PHAGE_Entero_SfV: replication protein; SD15574_5389; phage(gi19549026) 2e-139 Click
145095626..5095877 PHAGE_Entero_SfV: hypothetical protein SfVp40; SD15574_5390; phage(gi19549027) 8e-41 Click
155095877..5096530 PHAGE_Entero_SfV: DNA adenine methylase; SD15574_5391; phage(gi19549028) 8e-126 Click
165096527..5096853 PHAGE_Entero_SfV: hypothetical protein SfVp42; SD15574_5392; phage(gi19549029) 9e-56 Click
175097042..5097239 PHAGE_Entero_SfV: crossover junction endodeoxyribonuclease; SD15574_5393; phage(gi19549030) 1e-30 Click
185097259..5098068 PHAGE_Entero_SfV: hypothetical protein SfVp44; SD15574_5394; phage(gi19549031) 1e-152 Click
195098076..5099065 PHAGE_Entero_SfV: hypothetical protein SfVp45; SD15574_5395; phage(gi19549032) 0.0 Click
205099079..5099831 PHAGE_Entero_SfV: antitermination protein Q; SD15574_5396; phage(gi19549033) 2e-145 Click
215100061..5100072 attR    CAGAAACTCGAT 0.0 Click
225100209..5101342 PROPHAGE_Escher_EDL933: putative transposase; SD15574_5397; phage(gi15803522) 2e-146 Click
235101915..5102118 PHAGE_Entero_SfV: hypothetical protein SfVp47; SD15574_5398; phage(gi19549034) 1e-06 Click
245102269..5103321 PHAGE_Entero_SfV: hypothetical protein SfVp48; SD15574_5399; phage(gi19549035) 0.0 Click
255103388..5103603 PHAGE_Stx2_c_II: holin; SD15574_5400; phage(gi302393164) 1e-28 Click
265103603..5104100 PHAGE_Entero_cdtI: lysin; SD15574_5401; phage(gi148609440) 3e-92 Click
275104097..5104564 PHAGE_Salmon_vB_SosS_Oslo: endopeptidase; SD15574_5402; phage(gi399528835) 8e-80 Click
285105356..5105569 PROPHAGE_Escher_EDL933: putative transposase; SD15574_5403; phage(gi15803522) 1e-10 Click
295105607..5105972 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_5404; phage(gi17546153) 1e-45 Click
305105930..5106835 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SD15574_5405; phage(gi16130763) 4e-178 Click

Region 26, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15123105..5123150 attL    GCTTGATGATGGTCCATGCCTCATCGGGAAGGTCGTAGCGAGCCAT 0.0 Click
25128943..5128957 attL    ATTGTTGTCGCCATT 0.0 Click
35132589..5133263 PHAGE_Stx2_c_1717: truncated transposase; SD15574_5428; phage(gi209447151) 1e-08 Click
45133260..5133607 PHAGE_Stx2_c_1717: transposase; SD15574_5429; phage(gi209447152) 2e-43 Click
55133895..5135184 PHAGE_Stx2_c_1717: transposase; SD15574_5430; phage(gi209447153) 9e-148 Click
6complement(5135822..5136235) PROPHAGE_Escher_CFT073: prophage P4 integrase; SD15574_5431; phage(gi26251024) 3e-62 Click
7complement(5136268..5136435) PROPHAGE_Escher_CFT073: prophage P4 integrase; SD15574_5432; phage(gi26249391) 4e-17 Click
85136568..5136795 PHAGE_Stx2_c_1717: transposase; SD15574_5433; phage(gi209447153) 1e-16 Click
9complement(5136912..5137640) PROPHAGE_Escher_CFT073: transposase insF; SD15574_5434; phage(gi26249410) 9e-132 Click
105137760..5137774 attR    ATTGTTGTCGCCATT 0.0 Click
11complement(5137830..5138981) PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_5435; phage(gi16132105) 0.0 Click
125139112..5139951 PHAGE_Entero_Sf6: putative transposase OrfB; SD15574_5436; phage(gi41057343) 1e-167 Click
13complement(5140172..5140651) PHAGE_Escher_TL_2011c: hypothetical protein; SD15574_5437; phage(gi418487087) 3e-81 Click
14complement(5140651..5141340) PHAGE_Escher_TL_2011c: putative exonuclease; SD15574_5438; phage(gi418487057) 1e-133 Click
15complement(5141337..5141726) PHAGE_Escher_TL_2011c: RecT; SD15574_5439; phage(gi418487123) 5e-68 Click
165142007..5142273 PROPHAGE_Xantho_33913: ISxac3 transposase; SD15574_5440; phage(gi21231087) 1e-06 Click
175142331..5143482 PROPHAGE_Escher_MG1655: IS30 transposase; SD15574_5441; phage(gi16132105) 0.0 Click
185143672..5144385 PROPHAGE_Escher_CFT073: transposase insF; SD15574_5442; phage(gi26249410) 3e-136 Click
19complement(5144481..5148368) PROPHAGE_Shigel_301: serine protease; SD15574_5443; phage(gi24114232) 0.0 Click
205148618..5148761 hypothetical protein; SD15574_5444 0.0 Click
21complement(5148954..5149070) hypothetical protein; SD15574_5445 0.0 Click
225149083..5150114 PROPHAGE_Escher_EDL933: putative transposase; SD15574_5446; phage(gi15803522) 2e-146 Click
23complement(5150148..5150336) PROPHAGE_Brucel_1330: ISBm1, transposase orfB; SD15574_5447; phage(gi23501425) 1e-08 Click
24complement(5150377..5150664) PROPHAGE_Shewan_MR-1: ISSod6, transposase; SD15574_5448; phage(gi24374783) 5e-08 Click
25complement(5150765..5150878) hypothetical protein; SD15574_5449 0.0 Click
265150948..5150993 attR    GCTTGATGATGGTCCATGCCTCATCGGGAAGGTCGTAGCGAGCCAT 0.0 Click
275151072..5151194 hypothetical protein; SD15574_5450 0.0 Click
28complement(5151191..5151349) PHAGE_Ralsto_RSM3: hypothetical protein RSM3_gp14; SD15574_5451; phage(gi209901327) 9e-05 Click
29complement(5151459..5151932) transcriptional regulator, AraC family; SD15574_5452 0.0 Click
30complement(5152179..5152388) PROPHAGE_Escher_EDL933: putative transposase; SD15574_5453; phage(gi15803522) 3e-09 Click
31complement(5152389..5153014) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SD15574_5454; phage(gi17546153) 2e-07 Click