Avibacterium paragallinarum AVPAR72 .0, whole genome [asmbl_id: NC_000000].2455863, GC%: 40.80%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1694230..700352 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; AVPAR72_0668; phage(gi414087138) 7e-16 Click
2700462..701305 PHAGE_Psychr_pOW20_A: phage terminase large subunit; AVPAR72_0669; phage(gi472339822) 1e-60 Click
3701308..702615 PHAGE_Erwini_phiEt88: portal protein; AVPAR72_0670; phage(gi327198564) 3e-41 Click
4702635..703741 PHAGE_Erwini_phiEt88: phage putative head morphogenesis protein; AVPAR72_0671; phage(gi327198565) 2e-21 Click
5703738..704172 hypothetical protein; AVPAR72_0672 0.0 Click
6704261..705316 PHAGE_Erwini_phiEt88: hypothetical protein; AVPAR72_0673; phage(gi327198566) 7e-60 Click
7705328..705744 PHAGE_Xantho_vB_XveM_DIBBI: hypothetical protein; AVPAR72_0674; phage(gi389060408) 5e-05 Click
8705818..706771 PHAGE_Erwini_phiEt88: hypothetical protein; AVPAR72_0675; phage(gi327198568) 4e-46 Click
9706771..706992 hypothetical protein; AVPAR72_0676 0.0 Click
10707002..707355 hypothetical protein; AVPAR72_0677 0.0 Click
11707342..707797 PHAGE_Erwini_phiEt88: hypothetical protein; AVPAR72_0678; phage(gi327198571) 2e-11 Click
12707845..708156 PHAGE_Erwini_phiEt88: hypothetical protein; AVPAR72_0679; phage(gi327198572) 3e-05 Click
13708158..708667 PHAGE_Erwini_phiEt88: hypothetical protein; AVPAR72_0680; phage(gi327198573) 2e-06 Click
14708654..709727 PHAGE_Erwini_phiEt88: hypothetical protein; AVPAR72_0681; phage(gi327198574) 2e-50 Click
15709779..710207 PHAGE_Pseudo_KPP10: putative structural protein; AVPAR72_0682; phage(gi327198186) 4e-21 Click
16710207..710692 hypothetical protein; AVPAR72_0683 0.0 Click
17710728..710880 hypothetical protein; AVPAR72_0684 0.0 Click
18710877..713135 PHAGE_Vibrio_vB_VpaS_MAR10: tail tape measure protein; AVPAR72_0685; phage(gi428782128) 1e-37 Click
19complement(713173..713592) PHAGE_Yersin_PY54: hypothetical protein PY54p57; AVPAR72_0686; phage(gi33770566) 7e-28 Click
20complement(713636..713818) ycfA-like family protein; AVPAR72_0687 0.0 Click
21713908..714501 PHAGE_Erwini_phiEt88: hypothetical protein; AVPAR72_0688; phage(gi327198578) 7e-14 Click
22714633..715784 type I restriction enzyme R domain protein; AVPAR72_0689 0.0 Click
23716088..716912 PHAGE_Salmon_epsilon34: Ant; AVPAR72_0690; phage(gi221328691) 6e-48 Click
24717020..717352 hypothetical protein; AVPAR72_0691 0.0 Click
25717330..718295 PHAGE_Erwini_phiEt88: hypothetical protein; AVPAR72_0692; phage(gi327198580) 7e-37 Click
26718288..718959 PHAGE_Erwini_phiEt88: phage baseplate assembly protein V; AVPAR72_0693; phage(gi327198581) 4e-22 Click
27718956..719321 PHAGE_Pseudo_PAK_P1: hypothetical protein; AVPAR72_0694; phage(gi326804412) 6e-13 Click
28719314..720750 PHAGE_Erwini_phiEt88: baseplate component; AVPAR72_0695; phage(gi327198583) 7e-46 Click
29720759..721373 PHAGE_Pseudo_PAK_P1: hypothetical protein; AVPAR72_0696; phage(gi326804414) 8e-19 Click
30721383..723062 PHAGE_Haemop_Aaphi23: putative tail fiber protein; AVPAR72_0697; phage(gi31544053) 3e-16 Click
31723063..723704 PHAGE_Haemop_Aaphi23: putative tail fiber assembly protein; AVPAR72_0698; phage(gi31544054) 7e-26 Click
32723682..723954 PHAGE_Aggreg_S1249: hypothetical protein; AVPAR72_0699; phage(gi273809543) 2e-29 Click
33724575..731390 PHAGE_Acanth_1: hypothetical protein ATCV1_Z492L; AVPAR72_0700; phage(gi155371439) 2e-05 Click

Region 2, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1905686..905700 attL    ATAATTCAGGTTTTT 0.0 Click
2905799..907010 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; AVPAR72_0864; phage(gi16130540) 8e-95 Click
3complement(907049..907474) PHAGE_Vibrio_CTX: RstR; AVPAR72_0865; phage(gi332672299) 6e-05 Click
4907807..908268 putative membrane protein; AVPAR72_0866 0.0 Click
5908327..908929 hypothetical protein; AVPAR72_0867 0.0 Click
6909059..909172 hypothetical protein; AVPAR72_0868 0.0 Click
7909299..909487 hypothetical protein; AVPAR72_0869 0.0 Click
8909539..909691 DNA binding , excisionase family domain protein; AVPAR72_0870 0.0 Click
9complement(909760..910395) primase family protein; AVPAR72_0871 0.0 Click
10complement(910456..910635) replication protein; AVPAR72_0872 0.0 Click
11911312..911869 glutaredoxin, GrxB family; AVPAR72_0873 0.0 Click
12912063..913994 threonyl-tRNA synthetase; AVPAR72_0874 0.0 Click
13complement(914258..914434) hypothetical protein; AVPAR72_0875 0.0 Click
14914615..914887 PHAGE_Burkho_phiE202: gp6, pANL56; AVPAR72_0876; phage(gi134288760) 9e-11 Click
15914868..915155 PHAGE_Burkho_phiE202: gp7, pANL12; AVPAR72_0877; phage(gi134288781) 5e-06 Click
16complement(915258..916889) PHAGE_Bacill_36: putative metalloprotein chaperonin subunit; AVPAR72_0878; phage(gi156564046) 3e-09 Click
17complement(916913..918619) PHAGE_Acidia_virus: hypothetical protein ATV_gp66; AVPAR72_0879; phage(gi75750456) 6e-15 Click
18complement(918868..919563) tellurite resistance protein TehB; AVPAR72_0880 0.0 Click
19complement(919581..919727) hypothetical protein; AVPAR72_0881 0.0 Click
20919963..920412 transcriptional regulator NrdR; AVPAR72_0882 0.0 Click
21920414..921538 PHAGE_Bacill_36: deoxycytidylate deaminase; AVPAR72_0883; phage(gi156564196) 2e-06 Click
22921552..922574 PROPHAGE_Escher_Sakai: serine endoprotease; AVPAR72_0884; phage(gi15833362) 7e-83 Click
23929466..929480 attR    ATAATTCAGGTTTTT 0.0 Click

Region 3, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11085853..1085864 attL    CTTTTTATTATA 0.0 Click
21085874..1086995 PHAGE_Synech_S_SKS1: GDP-D-mannose 4,6-dehydratase; AVPAR72_1061; phage(gi472340900) 3e-131 Click
31087006..1087965 PHAGE_Synech_S_SKS1: GDP-L-fucose synthase; AVPAR72_1062; phage(gi472340899) 1e-88 Click
41087977..1088933 PHAGE_Acanth_moumouvirus: glycosyltransferase family 10; AVPAR72_1063; phage(gi441432618) 8e-17 Click
51089083..1090048 PHAGE_Bacill_BCJA1c: integrase; AVPAR72_1064; phage(gi56694872) 1e-47 Click
61090048..1090710 PHAGE_Lactob_1: DNA methylase; AVPAR72_1065; phage(gi219563243) 1e-61 Click
71090860..1091093 hypothetical protein; AVPAR72_1066 0.0 Click
8complement(1091241..1092218) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF33; AVPAR72_1067; phage(gi157166018) 3e-94 Click
91092385..1093182 hypothetical protein; AVPAR72_1068 0.0 Click
101093255..1093267 attL    GGCTTTTTTTGTA 0.0 Click
111093284..1093544 hypothetical protein; AVPAR72_1069 0.0 Click
12complement(1093569..1093685) hypothetical protein; AVPAR72_1070 0.0 Click
131093794..1094417 PHAGE_Aggreg_S1249: possible bacteriophage antirepressor; AVPAR72_1071; phage(gi273809598) 2e-28 Click
141094510..1094848 hypothetical protein; AVPAR72_1072 0.0 Click
151095067..1095333 PHAGE_Staphy_vB_SepiS_phiIPLA5: hypothetical protein; AVPAR72_1073; phage(gi399528947) 5e-08 Click
161095323..1096270 riboflavin synthase subunit alpha domain protein; AVPAR72_1074 0.0 Click
171096280..1096555 PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p07c; AVPAR72_1075; phage(gi45862224) 2e-06 Click
181096545..1096700 hypothetical protein; AVPAR72_1076 0.0 Click
191096697..1096921 hypothetical protein; AVPAR72_1077 0.0 Click
201096918..1097418 PHAGE_Lister_A500: gp43; AVPAR72_1078; phage(gi157325002) 6e-20 Click
211097429..1098316 PHAGE_Myxoco_Mx8: hypothetical protein Mx8p81; AVPAR72_1079; phage(gi15320651) 8e-46 Click
221098316..1098795 PHAGE_Burkho_DC1: single stranded DNA binding protein; AVPAR72_1080; phage(gi401723026) 2e-43 Click
231099095..1099409 PHAGE_Brucel_Tb: hypothetical protein; AVPAR72_1081; phage(gi418487733) 2e-08 Click
24complement(1099432..1099614) PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p49; AVPAR72_1082; phage(gi109289984) 1e-08 Click
25complement(1099924..1100133) PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p49; AVPAR72_1083; phage(gi109289984) 9e-05 Click
26complement(1100406..1100552) hypothetical protein; AVPAR72_1084 0.0 Click
271100648..1101310 PHAGE_Aggreg_S1249: possible bacteriophage antirepressor; AVPAR72_1085; phage(gi273809598) 8e-17 Click
281101393..1101509 hypothetical protein; AVPAR72_1086 0.0 Click
291101554..1102150 PHAGE_Cafete_BV_PW1: putative DNA methyltransferase; AVPAR72_1087; phage(gi310831386) 9e-06 Click
301102223..1102504 PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p02; AVPAR72_1088; phage(gi31543999) 3e-31 Click
311102495..1103397 PHAGE_Haemop_Aaphi23: putative integrase; AVPAR72_1089; phage(gi62912537) 2e-157 Click
321112022..1112034 attR    GGCTTTTTTTGTA 0.0 Click
331114997..1115008 attR    CTTTTTATTATA 0.0 Click

Region 4, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11717738..1718310 PHAGE_Human__8: LANA; AVPAR72_1774; phage(gi139472804) 1e-05 Click
21718313..1719092 twin arginine-targeting protein translocase TatC; AVPAR72_1775 0.0 Click
31719171..1720184 delta-aminolevulinic acid dehydratase family protein; AVPAR72_1776 0.0 Click
41720334..1721122 DNase; AVPAR72_1777 0.0 Click
5complement(1721286..1721696) PHAGE_Cronob_vB_CsaP_GAP52: anaerobic nucleotide reductase subunit; AVPAR72_1778; phage(gi414087519) 7e-41 Click
6complement(1722035..1722793) PHAGE_Mannhe_phiMHaA1: CI repressor; AVPAR72_1779; phage(gi109289970) 1e-23 Click
71722913..1723113 PHAGE_Mannhe_phiMHaA1: Cro repressor; AVPAR72_1780; phage(gi109289971) 6e-10 Click
81723136..1723429 PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p14; AVPAR72_1781; phage(gi31544012) 1e-39 Click
9complement(1723623..1723844) PHAGE_Escher_HK75: regulatory protein cro; AVPAR72_1782; phage(gi356870715) 9e-11 Click
101723944..1724164 PHAGE_Stx2_c_I: CI protein; AVPAR72_1783; phage(gi20065916) 1e-14 Click
111724213..1724413 putative transposase; AVPAR72_1784 0.0 Click
121724506..1724721 hypothetical protein; AVPAR72_1785 0.0 Click
131724772..1724994 PROPHAGE_Escher_MG1655: IS150 transposase B; AVPAR72_1786; phage(gi16131429) 2e-12 Click
14complement(1724995..1725253) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p52; AVPAR72_1787; phage(gi45862234) 2e-29 Click
15complement(1725231..1725869) PHAGE_Haemop_Aaphi23: putative tail fiber assembly protein; AVPAR72_1788; phage(gi31544054) 3e-46 Click
16complement(1725885..1726803) PHAGE_Haemop_Aaphi23: putative tail fiber protein; AVPAR72_1789; phage(gi31544053) 1e-29 Click
17complement(1726804..1727660) hypothetical protein; AVPAR72_1790 0.0 Click
181728031..1729143 carboxylesterase; AVPAR72_1791 0.0 Click
19complement(1729223..1729531) PHAGE_Burkho_phi1026b: gp58; AVPAR72_1792; phage(gi38707948) 6e-05 Click

Region 5, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11980898..1980909 attL    TTTGTGAAATCT 0.0 Click
2complement(1985661..1986535) PHAGE_Haemop_HP2: tail fibers; AVPAR72_2037; phage(gi17981847) 2e-112 Click
3complement(1986561..1987091) PHAGE_Haemop_HP2: orf30; AVPAR72_2038; phage(gi17981846) 3e-72 Click
4complement(1987088..1988257) PHAGE_Haemop_HP2: orf29; AVPAR72_2039; phage(gi17981845) 5e-166 Click
5complement(1988250..1988582) PHAGE_Haemop_HP2: orf28; AVPAR72_2040; phage(gi17981844) 2e-36 Click
6complement(1988584..1990677) PHAGE_Haemop_HP2: orf27; AVPAR72_2041; phage(gi17981843) 3e-98 Click
7complement(1990686..1990847) PHAGE_Pasteu_F108: hypothetical protein F108p32; AVPAR72_2042; phage(gi109302928) 3e-17 Click
8complement(1990865..1991164) PHAGE_Haemop_HP2: orf26; AVPAR72_2043; phage(gi17981842) 2e-22 Click
9complement(1991186..1991404) hypothetical protein; AVPAR72_2044 0.0 Click
10complement(1991373..1991714) PHAGE_Haemop_HP2: orf25; AVPAR72_2045; phage(gi17981841) 3e-07 Click
11complement(1991699..1992193) PHAGE_Cronob_phiES15: putative endolysin; AVPAR72_2046; phage(gi401817587) 1e-34 Click
12complement(1992204..1992437) hypothetical protein; AVPAR72_2047 0.0 Click
13complement(1992524..1992979) PHAGE_Haemop_HP2: tail tube; AVPAR72_2048; phage(gi17981838) 4e-53 Click
14complement(1992984..1994111) PHAGE_Haemop_HP2: tail sheath; AVPAR72_2049; phage(gi17981837) 1e-155 Click
15complement(1994137..1994817) PHAGE_Haemop_HP2: orf22; AVPAR72_2050; phage(gi17981836) 2e-22 Click
16complement(1994810..1995280) PHAGE_Haemop_HP2: orf21; AVPAR72_2051; phage(gi17981835) 7e-41 Click
17complement(1995268..1995720) PHAGE_Haemop_HP2: packaging protein; AVPAR72_2052; phage(gi17981834) 2e-50 Click
18complement(1995713..1996534) PHAGE_Haemop_HP2: packaging protein; AVPAR72_2053; phage(gi17981833) 4e-63 Click
19complement(1996545..1997555) PHAGE_Haemop_HP2: capsid; AVPAR72_2054; phage(gi17981832) 1e-163 Click
20complement(1997558..1998457) PHAGE_Haemop_HP2: scaffold; AVPAR72_2055; phage(gi17981831) 9e-93 Click
211998618..2000432 PHAGE_Haemop_HP2: terminase; AVPAR72_2056; phage(gi17981830) 0.0 Click
222000436..2001473 PHAGE_Haemop_HP2: orf15; AVPAR72_2057; phage(gi17981829) 3e-146 Click
232001553..2001807 PHAGE_Pasteu_F108: hypothetical protein F108p17; AVPAR72_2058; phage(gi109302913) 3e-22 Click
242002117..2002344 hypothetical protein; AVPAR72_2059 0.0 Click
25complement(2002549..2002788) hypothetical protein; AVPAR72_2060 0.0 Click
26complement(2002816..2002956) hypothetical protein; AVPAR72_2061 0.0 Click
27complement(2003064..2003627) PHAGE_Liston_phiHSIC: hypothetical protein LPPPVgp47; AVPAR72_2062; phage(gi62362398) 6e-34 Click
28complement(2003608..2004153) PHAGE_Haemop_HP2: dam; AVPAR72_2063; phage(gi17981827) 1e-76 Click
29complement(2004186..2006573) PHAGE_Haemop_HP2: rep; AVPAR72_2064; phage(gi17981825) 0.0 Click
30complement(2006595..2006873) PHAGE_Haemop_HP2: hypothetical protein HP2p08; AVPAR72_2065; phage(gi17981823) 4e-13 Click
31complement(2006870..2007076) hypothetical protein; AVPAR72_2066 0.0 Click
32complement(2007063..2007452) PHAGE_Haemop_HP2: hypothetical protein HP2p06; AVPAR72_2067; phage(gi17981821) 3e-12 Click
33complement(2007469..2007945) hypothetical protein; AVPAR72_2068 0.0 Click
34complement(2008003..2008218) PHAGE_Haemop_HP2: orf2(S)cox; AVPAR72_2069; phage(gi17981819) 7e-18 Click
352008342..2008923 PHAGE_Haemop_HP2: cI repressor; AVPAR72_2070; phage(gi17981818) 6e-85 Click
362008923..2009777 hypothetical protein; AVPAR72_2071 0.0 Click
372009781..2010800 PHAGE_Haemop_HP2: integrase; AVPAR72_2072; phage(gi17981816) 2e-142 Click
38complement(2011033..2012124) PHAGE_Escher_HK639: integrase; AVPAR72_2073; phage(gi356870629) 3e-57 Click
39complement(2012376..2012881) PHAGE_Entero_Sf6: gene 2 protein; AVPAR72_2074; phage(gi41057280) 4e-70 Click
40complement(2012862..2013389) PHAGE_Erwini_phiEt88: phage terminase, small subunit; AVPAR72_2075; phage(gi327198562) 1e-21 Click
41complement(2013400..2013654) hypothetical protein; AVPAR72_2076 0.0 Click
42complement(2013638..2013850) PHAGE_Haemop_Aaphi23: putative lytic protein Rz1; AVPAR72_2077; phage(gi44829137) 2e-11 Click
43complement(2013819..2014181) PHAGE_Aggreg_S1249: putative lytic protein Rz; AVPAR72_2078; phage(gi273809574) 1e-10 Click
44complement(2014141..2014548) PHAGE_Entero_SPC35: lysozyme; AVPAR72_2079; phage(gi326632933) 3e-31 Click
45complement(2014541..2014873) PHAGE_Aeromo_phiO18P: putative holin; AVPAR72_2080; phage(gi148727161) 6e-12 Click
46complement(2014970..2015452) hypothetical protein; AVPAR72_2081 0.0 Click
47complement(2015528..2016040) PHAGE_Vibrio_VvAW1: single-stranded DNA-binding protein; AVPAR72_2082; phage(gi460042909) 8e-44 Click
482028397..2028408 attR    TTTGTGAAATCT 0.0 Click

Region 6, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2061838..2064462) PHAGE_Entero_P1: Res; AVPAR72_2132; phage(gi46401632) 2e-60 Click
2complement(2064473..2066383) PHAGE_Campyl_NCTC12673: possible methylase; AVPAR72_2133; phage(gi332672404) 5e-31 Click
3complement(2066384..2066965) PHAGE_Synech_S_SKS1: hypothetical protein; AVPAR72_2134; phage(gi472341052) 3e-05 Click
4complement(2066982..2067464) PHAGE_Lister_A118: putative methyltransferase; AVPAR72_2135; phage(gi16798837) 8e-48 Click
5complement(2067531..2067815) hypothetical protein; AVPAR72_2136 0.0 Click
6complement(2067891..2068124) hypothetical protein; AVPAR72_2137 0.0 Click
7complement(2068117..2068620) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p04; AVPAR72_2138; phage(gi31544001) 1e-06 Click
8complement(2068736..2069065) hypothetical protein; AVPAR72_2139 0.0 Click
9complement(2069068..2069265) PHAGE_Pasteu_F108: hypothetical protein F108p10; AVPAR72_2140; phage(gi109302906) 6e-06 Click
10complement(2069281..2069490) hypothetical protein; AVPAR72_2141 0.0 Click
11complement(2069487..2070383) PHAGE_Entero_P1: HrdC; nucleoid; phage component; AVPAR72_2142(gi46401690) 9e-66 Click
12complement(2070443..2070646) hypothetical protein; AVPAR72_2143 0.0 Click
13complement(2070835..2071152) PHAGE_Brucel_Tb: hypothetical protein; AVPAR72_2144; phage(gi418487733) 5e-08 Click
14complement(2071239..2071718) PHAGE_Vibrio_VvAW1: single-stranded DNA-binding protein; AVPAR72_2145; phage(gi460042909) 5e-43 Click
15complement(2071706..2072338) PHAGE_Aeromo_vB_AsaM_56: putative exonuclease; AVPAR72_2146; phage(gi422937501) 1e-27 Click
16complement(2072335..2073114) PHAGE_Entero_4795: putative Bet protein; AVPAR72_2147; phage(gi157165998) 2e-58 Click
17complement(2073125..2074303) PHAGE_Thalas_BA3: hypothetical protein BA3_0032; AVPAR72_2148; phage(gi160700626) 3e-11 Click
18complement(2074281..2074955) hypothetical protein; AVPAR72_2149 0.0 Click
19complement(2074945..2075220) PHAGE_Aggreg_S1249: hypothetical protein; AVPAR72_2150; phage(gi273809599) 3e-07 Click
20complement(2075242..2075550) hypothetical protein; AVPAR72_2151 0.0 Click
21complement(2075644..2076288) PHAGE_Strept_Sfi19: hypothetical protein Sfi19p28; AVPAR72_2152; phage(gi9632919) 3e-41 Click
22complement(2076961..2077182) hypothetical protein; AVPAR72_2153 0.0 Click
232077197..2077367 hypothetical protein; AVPAR72_2154 0.0 Click
24complement(2077746..2078186) PHAGE_Entero_mEp390: hypothetical protein; AVPAR72_2155; phage(gi428782704) 3e-09 Click
252078317..2079134 ccbE domain protein; AVPAR72_2156 0.0 Click
262079135..2079766 PHAGE_Vibrio_VvAW1: protein of unknown function (DUF1367); AVPAR72_2157; phage(gi460042925) 8e-17 Click
272079767..2080051 PHAGE_Entero_HK542: hypothetical protein; predicted; phage protein; AVPAR72_2158(gi428783392) 5e-30 Click
282080048..2080380 PHAGE_Pectob_phiTE: HNH endonuclease; AVPAR72_2159; phage(gi448244897) 5e-08 Click
292080458..2080727 PHAGE_Entero_mEp390: holliday-junction resolvase RusA; AVPAR72_2160; phage(gi428782708) 2e-10 Click
302080727..2081089 sigma-70, region 4 family protein; AVPAR72_2161 0.0 Click
312081334..2082338 hypothetical protein; AVPAR72_2162 0.0 Click
32complement(2082636..2082806) hypothetical protein; AVPAR72_2163 0.0 Click
332082821..2083042 hypothetical protein; AVPAR72_2164 0.0 Click
342083302..2083616 hypothetical protein; AVPAR72_2165 0.0 Click
352083620..2083877 PHAGE_Staphy_vB_SepiS_phiIPLA5: hypothetical protein; AVPAR72_2166; phage(gi399528947) 3e-14 Click

Region 7, total : 34 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12405171..2405188 attL    TTTTTTTAGAAAAAGGCT 0.0 Click
2complement(2414812..2415454) PHAGE_Haemop_Aaphi23: putative tail fiber protein; AVPAR72_2519; phage(gi31544053) 5e-45 Click
3complement(2415459..2416037) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p49; AVPAR72_2520; phage(gi31544052) 8e-74 Click
4complement(2416037..2417167) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p48; AVPAR72_2521; phage(gi31544051) 1e-143 Click
5complement(2417218..2417568) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p47; AVPAR72_2522; phage(gi31544050) 2e-43 Click
6complement(2417565..2418212) PHAGE_Haemop_Aaphi23: putative baseplate protein; AVPAR72_2523; phage(gi31544048) 1e-80 Click
7complement(2418209..2419045) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p45; AVPAR72_2524; phage(gi31544047) 2e-116 Click
82419428..2419456 attL    AAAAACAGAATGAGCCATTTACGATGGCT 0.0 Click
92419565..2420089 putative integrase; AVPAR72_2525 0.0 Click
10complement(2420889..2421596) hmcB; AVPAR72_2526 0.0 Click
11complement(2421599..2422195) PHAGE_Bacill_SPBc2: ABC transporter; AVPAR72_2527; phage(gi9630145) 6e-05 Click
12complement(2422158..2423006) hmcD; AVPAR72_2528 0.0 Click
132423155..2423183 attR    AAAAACAGAATGAGCCATTTACGATGGCT 0.0 Click
142423164..2423733 integrase; AVPAR72_2529 0.0 Click
15complement(2424133..2424255) hypothetical protein; AVPAR72_2530 0.0 Click
16complement(2424301..2424534) replication domain protein; AVPAR72_2531 0.0 Click
17complement(2424494..2425030) PHAGE_Burkho_KS14: gp37; AVPAR72_2532; phage(gi327198306) 5e-20 Click
18complement(2425006..2425308) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p44; AVPAR72_2533; phage(gi44829138) 2e-28 Click
19complement(2425312..2426073) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p43; AVPAR72_2534; phage(gi31544045) 2e-74 Click
202426141..2426395 putative cytotoxic translational repressor of toxin-antitoxin stability system protein; AVPAR72_2535 0.0 Click
212426379..2426726 helix-turn-helix family protein; AVPAR72_2536 0.0 Click
22complement(2426729..2428663) PHAGE_Haemop_Aaphi23: putative tail length tape measure protein; AVPAR72_2537; phage(gi31544043) 4e-89 Click
23complement(2428650..2428766) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p40a; AVPAR72_2538; phage(gi45862233) 2e-06 Click
24complement(2428793..2429218) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p41; AVPAR72_2539; phage(gi31544042) 2e-36 Click
25complement(2429221..2429649) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p40; AVPAR72_2540; phage(gi31544041) 4e-61 Click
26complement(2429659..2431161) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p39; AVPAR72_2541; phage(gi31544040) 0.0 Click
27complement(2431165..2431644) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p38; AVPAR72_2542; phage(gi31544039) 5e-35 Click
28complement(2431601..2431948) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p37a; AVPAR72_2543; phage(gi31544038) 6e-26 Click
29complement(2431945..2432388) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p37; AVPAR72_2544; phage(gi31544037) 1e-32 Click
30complement(2432385..2432735) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p36; AVPAR72_2545; phage(gi31544036) 4e-25 Click
31complement(2432744..2433646) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p35; AVPAR72_2546; phage(gi31544035) 2e-104 Click
32complement(2433659..2434111) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p34; AVPAR72_2547; phage(gi31544034) 3e-35 Click
33complement(2434111..2435232) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p33; AVPAR72_2548; phage(gi31544033) 1e-102 Click
34complement(2435300..2435581) hypothetical protein; AVPAR72_2549 0.0 Click
35complement(2435584..2436861) PHAGE_Haemop_Aaphi23: putative minor head protein; AVPAR72_2550; phage(gi31544030) 9e-47 Click
36complement(2436902..2438185) PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p31; AVPAR72_2551; phage(gi31544029) 1e-122 Click
37complement(2438215..2439057) PHAGE_Psychr_pOW20_A: phage terminase large subunit; AVPAR72_2552; phage(gi472339822) 3e-58 Click
382453513..2453530 attR    TTTTTTTAGAAAAAGGCT 0.0 Click