Escherichia coli 2534-86 .0, whole genome shotgun [asmbl_id: NC_000000].5290142, GC%: 50.53%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 172 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15171..6197 PHAGE_Entero_2008: putative tail protein; EC253486_5469; phage(gi209427785) 3e-173 Click
2complement(6373..6684) PHAGE_Entero_2008: putative DNAse; EC253486_5470; phage(gi209427773) 4e-48 Click
36780..6980 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; EC253486_5471; phage(gi209427772) 1e-20 Click
4complement(7112..7444) tonB family C-terminal domain protein; EC253486_5472 0.0 Click
5complement(7777..8205) PHAGE_Entero_2008: putative endopeptidase; EC253486_5473; phage(gi209427771) 2e-68 Click
6complement(8247..8360) PHAGE_Escher_P13374: hypothetical protein; EC253486_5474; phage(gi410491648) 1e-12 Click
7complement(8381..8494) putative membrane protein; EC253486_5475 0.0 Click
8complement(8473..8649) PHAGE_Cronob_ENT47670: phage antirepressor protein; EC253486_5476; phage(gi431810509) 3e-18 Click
98726..9067 PHAGE_Stx2_c_II: putative transposase; EC253486_5477; phage(gi302393161) 9e-56 Click
109116..9493 PHAGE_Stx2_c_1717: transposase; EC253486_5478; phage(gi209447179) 4e-68 Click
11complement(9496..10035) PHAGE_Cronob_ENT47670: phage antirepressor protein; EC253486_5479; phage(gi431810509) 4e-23 Click
12complement(10309..10842) PHAGE_Entero_2008: putative endolysin; EC253486_5480; phage(gi209427769) 2e-101 Click
13complement(10893..11237) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; EC253486_5481; phage(gi209427768) 1e-56 Click
14complement(11242..11457) PHAGE_Stx2_c_1717: holin protein S-like protein; EC253486_5482; phage(gi209447171) 1e-33 Click
15complement(11607..13460) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EC253486_5483; phage(gi209427766) 0.0 Click
16complement(13547..13647) PHAGE_Stx2_c_1717: transposase; EC253486_5484; phage(gi209447179) 1e-13 Click
17complement(13644..13880) PHAGE_Stx2_c_II: putative transposase; EC253486_5485; phage(gi302393161) 2e-40 Click
1814024..14521 PHAGE_Stx2_c_1717: phage-related lysozyme; EC253486_5491; phage(gi209447172) 1e-94 Click
1914518..14985 PHAGE_Entero_cdtI: lysin; EC253486_5492; phage(gi148609441) 4e-62 Click
2015068..15208 hypothetical protein; EC253486_5493 0.0 Click
2116019..16199 PHAGE_Entero_2008: putative DNAse; EC253486_5494; phage(gi209427773) 9e-26 Click
2216200..16433 PHAGE_Entero_2008: putative tail protein; EC253486_5495; phage(gi209427785) 4e-35 Click
2316426..16767 PHAGE_Entero_2008: putative minor tail protein; EC253486_5496; phage(gi209427786) 3e-60 Click
2416767..17341 PHAGE_Entero_2008: putative tail protein; EC253486_5497; phage(gi209427787) 5e-107 Click
2517342..17826 PROPHAGE_Escher_EDL933: putative transposase; EC253486_5498; phage(gi15803516) 1e-79 Click
2618093..18614 PHAGE_Entero_2008: putative portal protein; EC253486_5499; phage(gi209427777) 3e-93 Click
2718631..19107 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; EC253486_5500; phage(gi209427775) 2e-60 Click
2819098..19385 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; EC253486_5501; phage(gi209427775) 1e-40 Click
2919432..21369 PHAGE_Entero_2008: putative major head protein/prohead proteinase; EC253486_5502; phage(gi209427776) 0.0 Click
3021581..22179 PHAGE_Entero_2008: putative portal protein; EC253486_5503; phage(gi209427777) 1e-114 Click
31complement(22221..22481) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; EC253486_5504; phage(gi209427768) 3e-43 Click
3222699..22860 hypothetical protein; EC253486_5505 0.0 Click
33complement(23139..24989) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EC253486_5506; phage(gi209427766) 0.0 Click
34complement(25288..25446) PHAGE_Entero_P1: TciB; EC253486_5507; phage(gi46401695) 3e-06 Click
35complement(25532..26248) putative membrane protein; EC253486_5508 0.0 Click
36complement(26460..27149) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; EC253486_5509; phage(gi169257244) 3e-81 Click
3727374..27586 hypothetical protein; EC253486_5510 0.0 Click
3827626..28585 systemic factor protein A; EC253486_5511 0.0 Click
39complement(28982..29344) PHAGE_Escher_HK75: RusA-like protein; EC253486_5512; phage(gi356870726) 4e-64 Click
40complement(29624..29836) PHAGE_Entero_c_1: hypothetical protein; EC253486_5513; phage(gi428781792) 2e-37 Click
41complement(30005..30364) PHAGE_Entero_IME10: ninX; EC253486_5514; phage(gi422934274) 3e-64 Click
42complement(30540..30950) PHAGE_Escher_HK75: NinB; EC253486_5515; phage(gi356870721) 7e-73 Click
43complement(30922..31284) PHAGE_Entero_mEp213: hypothetical protein; EC253486_5516; phage(gi428782648) 1e-34 Click
44complement(31302..31466) PHAGE_Escher_HK75: hypothetical protein; EC253486_5517; phage(gi356870720) 5e-24 Click
45complement(31949..32083) PHAGE_Stx2_c_1717: transposase; EC253486_5518; phage(gi209447179) 3e-20 Click
46complement(32065..32262) PHAGE_Stx2_c_1717: transposase; EC253486_5519; phage(gi209447179) 2e-26 Click
4732264..33202 PHAGE_Entero_2008: putative tail protein; EC253486_5520; phage(gi209427785) 2e-166 Click
4833327..33419 hypothetical protein; EC253486_5521 0.0 Click
4933420..33740 isoleucyl-tRNA synthetase domain protein; EC253486_5522 0.0 Click
50complement(33772..34413) PHAGE_Entero_2008: putative tail protein; EC253486_5523; phage(gi209427793) 5e-106 Click
51complement(34454..34591) PHAGE_Entero_2008: putative tail protein; EC253486_5524; phage(gi209427793) 4e-14 Click
52complement(34749..34907) hypothetical protein; EC253486_5525 0.0 Click
53complement(34907..35353) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; EC253486_5526; phage(gi209427792) 2e-75 Click
54complement(35422..36192) PHAGE_Entero_2008: phage-related tail protein; EC253486_5527; phage(gi209427791) 3e-141 Click
55complement(36144..38831) PHAGE_Entero_2008: phage-related tail protein; EC253486_5528; phage(gi209427791) 0.0 Click
5638872..38988 hypothetical protein; EC253486_5529 0.0 Click
57complement(39145..39663) PHAGE_Entero_2008: putative tail assembly protein; EC253486_5530; phage(gi209427790) 7e-91 Click
58complement(39722..40396) PHAGE_Entero_2008: putative tail component K-like protein; EC253486_5531; phage(gi209427789) 2e-130 Click
59complement(40471..41169) PHAGE_Entero_2008: putative tail protein; EC253486_5532; phage(gi209427787) 6e-127 Click
60complement(41169..41498) PROPHAGE_Escher_Sakai: putative minor tail protein; EC253486_5533; phage(gi15832202) 4e-60 Click
61complement(41495..44140) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; EC253486_5534; phage(gi15832203) 0.0 Click
62complement(44184..44468) PROPHAGE_Escher_Sakai: putative minor tail protein; EC253486_5535; phage(gi15832204) 4e-52 Click
63complement(44519..44941) PROPHAGE_Escher_Sakai: putative minor tail protein; EC253486_5536; phage(gi15832205) 2e-76 Click
64complement(44955..45272) PHAGE_Entero_HK630: major tail protein V; EC253486_5537; phage(gi428782800) 6e-33 Click
65complement(45286..45752) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF59; EC253486_5538; phage(gi157166044) 2e-75 Click
66complement(45749..45910) PHAGE_Entero_2008: putative portal protein; EC253486_5539; phage(gi209427777) 9e-13 Click
67complement(45907..47211) PHAGE_Entero_2008: putative portal protein; EC253486_5540; phage(gi209427777) 0.0 Click
68complement(47217..47438) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; EC253486_5541; phage(gi209427801) 6e-36 Click
69complement(47483..49420) PHAGE_Entero_2008: putative major head protein/prohead proteinase; EC253486_5542; phage(gi209427776) 0.0 Click
7049542..49797 PHAGE_Entero_2008: putative portal protein; EC253486_5543; phage(gi209427777) 2e-32 Click
7149800..50105 PHAGE_Entero_2008: putative portal protein; EC253486_5544; phage(gi209427777) 6e-49 Click
72complement(50122..50874) PHAGE_Entero_HK630: major tail protein V; EC253486_5545; phage(gi428782800) 1e-112 Click
73complement(50882..51280) PROPHAGE_Escher_Sakai: putative minor tail protein U; EC253486_5546; phage(gi15832207) 1e-72 Click
74complement(51293..51916) PROPHAGE_Escher_Sakai: putative minor tail protein; EC253486_5547; phage(gi15832208) 6e-101 Click
75complement(51919..52146) PHAGE_Entero_mEp213: hypothetical protein; EC253486_5548; phage(gi428782596) 1e-17 Click
76complement(52193..52519) PHAGE_Entero_mEp213: hypothetical protein; EC253486_5549; phage(gi428782595) 1e-32 Click
77complement(52607..54562) PHAGE_Entero_mEp213: head maturation protease; EC253486_5550; phage(gi428782594) 0.0 Click
78complement(54576..56078) PROPHAGE_Escher_Sakai: putative portal protein; EC253486_5551; phage(gi15832215) 0.0 Click
79complement(56078..56266) PHAGE_Entero_mEp460: hypothetical protein; EC253486_5552; phage(gi428782319) 2e-23 Click
80complement(56287..58299) PROPHAGE_Escher_Sakai: putative terminase large subunit; EC253486_5553; phage(gi15832217) 0.0 Click
81complement(58407..58883) PHAGE_Entero_mEp460: terminase small subunit; EC253486_5554; phage(gi428782317) 2e-46 Click
82complement(58972..59130) hypothetical protein; EC253486_5555 0.0 Click
83complement(59297..59764) PHAGE_Entero_2008: putative endopeptidase; EC253486_5556; phage(gi209427771) 2e-75 Click
84complement(59766..59903) hypothetical protein; EC253486_5557 0.0 Click
85complement(60548..60817) PHAGE_Entero_2008: Shiga toxin 1 subunit B; EC253486_5558; phage(gi209427764) 4e-46 Click
86complement(60827..61774) PHAGE_Entero_2008: Shiga toxin 1 subunit A; EC253486_5559; phage(gi209427763) 1e-176 Click
87complement(62281..62715) PHAGE_Stx1_converting: antitermination protein Q; EC253486_5560; phage(gi302861194) 2e-83 Click
88complement(62899..63504) PHAGE_Entero_2008: putative recombination endonuclease; EC253486_5561; phage(gi209427761) 3e-117 Click
89complement(63504..63983) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip139; EC253486_5562; phage(gi20065934) 2e-86 Click
90complement(64066..64233) PHAGE_Entero_2008: DNA-binding protein Roi; EC253486_5563; phage(gi209427760) 7e-16 Click
91complement(64302..65006) PHAGE_Stx2_c_II: putative antirepressor-like protein; EC253486_5564; phage(gi302393152) 1e-111 Click
92complement(65460..65987) PHAGE_Entero_2008: putative DNA N-6-adenine-methyltransferase; EC253486_5565; phage(gi209427758) 1e-101 Click
93complement(65984..66430) PHAGE_Entero_2008: putative recombination protein; EC253486_5566; phage(gi209427757) 2e-83 Click
94complement(66387..66749) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp32; EC253486_5567; phage(gi209447157) 2e-67 Click
95complement(66982..67260) PHAGE_Entero_2008: hypothetical protein YYZ_gp30; EC253486_5568; phage(gi209427755) 2e-51 Click
96complement(67330..67599) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp61; EC253486_5569; phage(gi302393144) 1e-46 Click
97complement(67599..69035) PHAGE_Entero_mEp235: replicative DNA helicase; EC253486_5570; phage(gi428781855) 0.0 Click
98complement(69025..69924) PHAGE_Stx2_c_86: replication protein O; EC253486_5571; phage(gi116222059) 7e-177 Click
99complement(69917..70063) PHAGE_Entero_mEp235: hypothetical protein; EC253486_5572; phage(gi428781853) 4e-22 Click
100complement(70098..70376) PHAGE_Entero_mEpX2: CII protein; EC253486_5573; phage(gi428765658) 5e-46 Click
10170469..70630 PHAGE_Stx2_c_II: putative transposase; EC253486_5574; phage(gi302393161) 5e-24 Click
10270720..70993 PHAGE_Entero_2008: putative tail protein; EC253486_5575; phage(gi209427787) 2e-47 Click
103complement(71010..71228) hypothetical protein; EC253486_5576 0.0 Click
10471438..71611 PHAGE_Salmon_SPN3UB: hypothetical protein; EC253486_5577; phage(gi423262397) 4e-24 Click
10571628..72287 PHAGE_Entero_2008: antirepressor protein Ant; EC253486_5578; phage(gi209427788) 3e-108 Click
10672721..73391 PHAGE_Entero_2008: putative tail component K-like protein; EC253486_5579; phage(gi209427789) 2e-129 Click
107complement(73392..74792) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; EC253486_5580; phage(gi209427775) 0.0 Click
10874822..75106 colicin-D domain protein; EC253486_5581 0.0 Click
10975369..75695 colicin-D domain protein; EC253486_5582 0.0 Click
11075692..75859 colicin D immunity protein; EC253486_5583 0.0 Click
11175866..76081 PHAGE_Entero_2008: putative portal protein; EC253486_5584; phage(gi209427777) 6e-31 Click
11276078..76339 PHAGE_Entero_2008: putative portal protein; EC253486_5585; phage(gi209427777) 1e-32 Click
11376349..77714 PHAGE_Entero_2008: putative tail protein; EC253486_5586; phage(gi209427785) 0.0 Click
11477715..77922 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; EC253486_5587; phage(gi157166067) 1e-27 Click
11578056..78454 PHAGE_Escher_HK75: phage recombination-related protein; EC253486_5588; phage(gi356870709) 1e-74 Click
11678623..78967 PHAGE_Entero_Sf6: gene 27 protein; EC253486_5589; phage(gi41057305) 6e-49 Click
11778981..79274 PHAGE_Entero_HK633: Abc2 protein; EC253486_5590; phage(gi428782555) 4e-52 Click
11879285..79452 PHAGE_Entero_Sf6: gene 23 protein; EC253486_5591; phage(gi41057301) 1e-25 Click
11979449..80048 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; EC253486_5592; phage(gi209427735) 9e-76 Click
12080278..80397 PHAGE_Entero_2008: hypothetical protein YYZ_gp07; EC253486_5593; phage(gi209427733) 4e-11 Click
121complement(80400..80714) PHAGE_Stx2_c_1717: transposase; EC253486_5594; phage(gi209447179) 3e-56 Click
12280715..81226 PHAGE_Entero_2008: putative tail assembly protein; EC253486_5595; phage(gi209427790) 5e-88 Click
12381569..82426 PHAGE_Entero_2008: phage-related tail protein; EC253486_5596; phage(gi209427791) 5e-164 Click
12482649..83083 PHAGE_Entero_2008: antitermination protein Q; EC253486_5597; phage(gi209427762) 4e-82 Click
12583304..83483 PHAGE_Stx2_c_86: DNA modification methylase; EC253486_5598; phage(gi116222073) 4e-14 Click
12683524..83599 tRNA 0.0 Click
12783609..83685 tRNA 0.0 Click
12883699..83775 tRNA 0.0 Click
12983866..84825 PHAGE_Escher_TL_2011c: Shiga toxin 2 subunit A; EC253486_5602; phage(gi418487067) 0.0 Click
13084837..85106 PHAGE_Escher_TL_2011c: Shiga toxin 2 subunit B; EC253486_5603; phage(gi418487068) 1e-46 Click
13185593..86288 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip148; EC253486_5604; phage(gi20065943) 3e-133 Click
13286298..86861 PHAGE_Entero_2008: putative phage terminase; EC253486_5606; phage(gi209427774) 3e-101 Click
13386858..87855 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; EC253486_5607; phage(gi209427775) 0.0 Click
13487887..88417 PHAGE_Entero_2008: putative DNAse; EC253486_5608; phage(gi209427773) 5e-55 Click
13588707..89030 PHAGE_Entero_2008: putative phage terminase; EC253486_5609; phage(gi209427774) 3e-49 Click
13689091..89187 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; EC253486_5610; phage(gi209427775) 9e-14 Click
13789188..89530 PHAGE_Stx2_c_1717: transposase; EC253486_5611; phage(gi209447179) 8e-62 Click
13889676..89918 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; EC253486_5612; phage(gi116221997) 1e-32 Click
13989961..90494 PHAGE_Entero_2008: putative endolysin; EC253486_5613; phage(gi209427769) 2e-98 Click
14090653..90790 hypothetical protein; EC253486_5614 0.0 Click
14190792..91259 PHAGE_Stx2_c_I: endopeptidase; EC253486_5615; phage(gi20065955) 2e-69 Click
14291342..91482 hypothetical protein; EC253486_5616 0.0 Click
143complement(91571..91685) hypothetical protein; EC253486_5617 0.0 Click
14491686..92303 PHAGE_Entero_2008: putative portal protein; EC253486_5618; phage(gi209427777) 1e-105 Click
14592373..93758 PHAGE_Entero_2008: putative portal protein; EC253486_5619; phage(gi209427777) 0.0 Click
14693755..94081 PHAGE_Entero_2008: hypothetical protein YYZ_gp55; EC253486_5620; phage(gi209427778) 9e-56 Click
14794091..94441 PHAGE_Entero_2008: putative head-tail adaptor; EC253486_5621; phage(gi209427779) 3e-61 Click
14894438..94884 PHAGE_Entero_2008: hypothetical protein YYZ_gp57; EC253486_5622; phage(gi209427780) 6e-79 Click
14995291..96007 PHAGE_Entero_2008: putative tail protein; EC253486_5623; phage(gi209427782) 8e-122 Click
15096013..96387 PHAGE_Entero_2008: putative tail assembly protein; EC253486_5624; phage(gi209427783) 7e-66 Click
15196489..96692 PHAGE_Entero_2008: hypothetical protein YYZ_gp61; EC253486_5625; phage(gi209427784) 3e-32 Click
15296744..97055 PHAGE_Entero_2008: putative tail protein; EC253486_5626; phage(gi209427785) 6e-50 Click
15397197..97502 PHAGE_Entero_2008: putative portal protein; EC253486_5627; phage(gi209427777) 2e-46 Click
15497499..98021 PHAGE_Entero_2008: putative portal protein; EC253486_5628; phage(gi209427777) 2e-78 Click
15598240..98362 putative membrane protein; EC253486_5629 0.0 Click
15698411..99106 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EC253486_5630; phage(gi209427766) 1e-102 Click
15799125..100348 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; EC253486_5631; phage(gi209447169) 0.0 Click
158100704..100976 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip154; EC253486_5632; phage(gi20065949) 1e-43 Click
159101105..101269 PHAGE_Entero_2008: lysis protein; EC253486_5633; phage(gi209427767) 2e-24 Click
160101273..101422 hypothetical protein; EC253486_5634 0.0 Click
161101501..101740 PHAGE_Stx2_c_II: putative transposase; EC253486_5635; phage(gi302393161) 6e-42 Click
162complement(101827..102012) exonuclease family domain protein; EC253486_5636 0.0 Click
163complement(101999..102766) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; EC253486_5637; phage(gi169257272) 4e-06 Click
164complement(102796..103791) PHAGE_Pectob_ZF40: putative exonuclease; EC253486_5638; phage(gi422936647) 5e-09 Click
165103854..104459 hypothetical protein; EC253486_5639 0.0 Click
166complement(104744..104962) hypothetical protein; EC253486_5640 0.0 Click
167complement(105152..106368) PHAGE_Entero_2008: putative tail protein; EC253486_5641; phage(gi209427785) 0.0 Click
168complement(106420..106623) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; EC253486_5642; phage(gi209427784) 3e-32 Click
169complement(106725..107099) PHAGE_Entero_2008: putative tail assembly protein; EC253486_5643; phage(gi209427783) 7e-66 Click
170complement(107105..107602) PHAGE_Entero_2008: putative tail protein; EC253486_5644; phage(gi209427782) 1e-80 Click
171107633..107752 hypothetical protein; EC253486_5645 0.0 Click
172complement(107889..108062) PHAGE_Entero_2008: putative prophage structural protein; EC253486_5646; phage(gi209427781) 1e-25 Click
173complement(108230..108592) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; EC253486_5647; phage(gi209427780) 4e-62 Click
174complement(108674..109024) PHAGE_Entero_2008: putative head-tail adaptor; EC253486_5648; phage(gi209427779) 2e-61 Click
175complement(109133..109738) PHAGE_Entero_2008: putative major head protein/prohead proteinase; EC253486_5649; phage(gi209427776) 2e-109 Click
176complement(109801..110177) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; EC253486_5650; phage(gi209427775) 3e-63 Click

Region 2, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1619682..619693 attL    CCGCGCCGGTAT 0.0 Click
2633867..635081 PROPHAGE_Escher_CFT073: putative prophage integrase; EC253486_0519; phage(gi26250313) 2e-153 Click
3635224..636105 hypothetical protein; EC253486_0520 0.0 Click
4636303..636500 PHAGE_Entero_P4: transcriptional regulator; EC253486_0521; phage(gi9627517) 8e-07 Click
5636626..636931 hypothetical protein; EC253486_0522 0.0 Click
6636944..637777 PHAGE_Escher_TL_2011c: putative antirepressor; EC253486_0523; phage(gi418487055) 6e-23 Click
7637911..638237 PHAGE_Stx2_c_II: putative transposase; EC253486_0524; phage(gi302393161) 1e-58 Click
8638234..639124 PROPHAGE_Escher_Sakai: putative transposase; EC253486_0525; phage(gi15834498) 2e-173 Click
9complement(639403..639519) PHAGE_Salmon_vB_SemP_Emek: terminase small subunit; EC253486_0526; phage(gi399498792) 1e-08 Click
10639921..640115 hypothetical protein; EC253486_0527 0.0 Click
11640108..640326 hypothetical protein; EC253486_0528 0.0 Click
12640510..640773 hypothetical protein; EC253486_0529 0.0 Click
13640875..640991 hypothetical protein; EC253486_0530 0.0 Click
14640984..641586 PHAGE_Entero_phiP27: hypothetical protein P27p06; EC253486_0531; phage(gi18249870) 2e-23 Click
15641597..641938 hypothetical protein; EC253486_0532 0.0 Click
16641931..642302 hypothetical protein; EC253486_0533 0.0 Click
17642289..642939 PHAGE_Entero_P4: DNA primase; EC253486_0534; phage(gi9627512) 1e-18 Click
18642945..643271 PHAGE_Stx2_c_II: putative transposase; EC253486_0535; phage(gi302393161) 1e-58 Click
19643268..643370 PHAGE_Stx2_c_1717: transposase; EC253486_0536; phage(gi209447179) 5e-15 Click
20643371..643795 PHAGE_Stx2_c_1717: transposase; EC253486_0537; phage(gi209447179) 6e-78 Click
21643887..644297 PHAGE_Erwini_phiEaH2: hypothetical protein; EC253486_0538; phage(gi431810676) 1e-28 Click
22644363..645301 hypothetical protein; EC253486_0539 0.0 Click
23645391..646209 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; EC253486_0540; phage(gi414086954) 3e-46 Click
24646301..646786 PHAGE_Pseudo_YuA: hypothetical protein; EC253486_0541; phage(gi162135127) 8e-14 Click
25646802..647278 DNA repair protein RadC family protein; EC253486_0542 0.0 Click
26complement(647275..647394) hypothetical protein; EC253486_0543 0.0 Click
27647374..647568 hypothetical protein; EC253486_0544 0.0 Click
28647795..647806 attR    CCGCGCCGGTAT 0.0 Click
29complement(648451..649341) PROPHAGE_Escher_Sakai: putative transposase; EC253486_0545; phage(gi15834498) 2e-173 Click
30complement(649338..649664) PHAGE_Stx2_c_II: putative transposase; EC253486_0546; phage(gi302393161) 1e-58 Click

Region 3, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1918781..919353 PHAGE_Entero_HK630: capsid assembly protein nu3; EC253486_0808; phage(gi428782793) 8e-97 Click
2919363..919695 PHAGE_Entero_HK630: head decoration protein D; EC253486_0809; phage(gi428782794) 4e-57 Click
3919757..920776 PHAGE_Entero_HK630: major head subunit E; EC253486_0810; phage(gi428782795) 0.0 Click
4920818..921213 PHAGE_Entero_HK630: DNA packaging protein Fi; EC253486_0811; phage(gi428782796) 3e-57 Click
5921225..921524 PHAGE_Entero_HK630: head-tail connector Fii; EC253486_0812; phage(gi428782797) 1e-46 Click
6921581..921892 PROPHAGE_Xantho_33913: ISxac3 transposase; EC253486_0813; phage(gi21231087) 1e-06 Click
7922081..922758 PHAGE_Entero_Sf6: putative transposase OrfB; EC253486_0814; phage(gi41057343) 2e-80 Click
8922851..923429 PHAGE_Entero_HK630: minor tail protein Z; EC253486_0815; phage(gi428782798) 7e-101 Click
9923426..923821 PHAGE_Entero_HK630: minor tail protein U; EC253486_0816; phage(gi428782799) 3e-71 Click
10923850..924569 PHAGE_Entero_HK630: major tail protein V; EC253486_0817; phage(gi428782800) 7e-132 Click
11924585..925007 PHAGE_Entero_HK630: minor tail protein G; EC253486_0818; phage(gi428782801) 2e-73 Click
12924989..925423 PHAGE_Entero_HK630: tail assembly protein GT; EC253486_0819; phage(gi428782802) 2e-81 Click
13925416..927596 PHAGE_Entero_HK630: tail length tape measure protein H; EC253486_0820; phage(gi428782803) 0.0 Click
14927602..927928 PHAGE_Stx2_c_II: putative transposase; EC253486_0821; phage(gi302393161) 1e-58 Click
15927925..928815 PROPHAGE_Escher_Sakai: putative transposase; EC253486_0822; phage(gi15834498) 2e-173 Click
16929610..929915 PHAGE_Entero_HK630: tail fiber assembly protein; EC253486_0823; phage(gi428782810) 1e-14 Click

Region 4, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11160424..1160438 attL    GCTTTTTTATACTAA 0.0 Click
2complement(1160512..1161204) PHAGE_Entero_HK630: integrase; EC253486_1057; phage(gi428782814) 3e-125 Click
3complement(1161417..1162304) PROPHAGE_Escher_Sakai: putative transposase; EC253486_1058; phage(gi15834498) 6e-173 Click
4complement(1162288..1162629) PHAGE_Stx2_c_II: putative transposase; EC253486_1059; phage(gi302393161) 5e-58 Click
5complement(1162635..1162832) PHAGE_Stx2_c_1717: phage-related lysozyme; EC253486_1060; phage(gi209447172) 2e-22 Click
6complement(1162832..1163038) PHAGE_Stx2_c_1717: holin protein S-like protein; EC253486_1061; phage(gi209447171) 6e-33 Click
71163046..1163192 hypothetical protein; EC253486_1062 0.0 Click
8complement(1163215..1163340) hypothetical protein; EC253486_1063 0.0 Click
9complement(1163738..1163902) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; EC253486_1064; phage(gi209427772) 5e-08 Click
101164284..1164895 PHAGE_Entero_HK630: terminase small subunit nu1; EC253486_1065; phage(gi428782788) 4e-22 Click
111164948..1166795 PHAGE_Entero_HK630: terminase large subunit A; EC253486_1066; phage(gi428782789) 0.0 Click
121166779..1166985 PHAGE_Entero_HK630: head-tail connector W; EC253486_1067; phage(gi428782790) 1e-11 Click
131166982..1168574 PHAGE_Entero_HK630: portal protein B; EC253486_1068; phage(gi428782791) 0.0 Click
141168564..1170069 PHAGE_Entero_HK630: head maturation protease C; EC253486_1069; phage(gi428782792) 7e-107 Click
151170106..1170453 PHAGE_Entero_HK630: head decoration protein D; EC253486_1070; phage(gi428782794) 1e-24 Click
161170511..1171539 PHAGE_Entero_HK630: major head subunit E; EC253486_1071; phage(gi428782795) 2e-114 Click
171171591..1171974 PHAGE_Gifsy_1: bacteriophage accessory DNA packaging protein; Lambda FI homolog; EC253486_1072; phage(gi169257229) 5e-12 Click
181171967..1172320 PHAGE_Entero_HK630: head-tail connector Fii; EC253486_1073; phage(gi428782797) 5e-43 Click
191172336..1172869 PHAGE_Entero_HK630: minor tail protein Z; EC253486_1074; phage(gi428782798) 2e-66 Click
201172866..1173261 PHAGE_Entero_HK630: minor tail protein U; EC253486_1075; phage(gi428782799) 8e-59 Click
211173269..1173595 PHAGE_Entero_HK630: major tail protein V; EC253486_1076; phage(gi428782800) 2e-47 Click
221173618..1174022 PHAGE_Entero_HK630: major tail protein V; EC253486_1077; phage(gi428782800) 2e-50 Click
231174036..1174136 PHAGE_Entero_HK630: minor tail protein G; EC253486_1078; phage(gi428782801) 2e-06 Click
24complement(1174137..1174238) PHAGE_Stx2_c_1717: transposase; EC253486_1079; phage(gi209447179) 5e-15 Click
25complement(1174235..1174561) PHAGE_Stx2_c_II: putative transposase; EC253486_1080; phage(gi302393161) 1e-58 Click
261174615..1174818 PHAGE_Stx2_c_II: putative tail fiber protein; EC253486_1081; phage(gi302393091) 2e-30 Click
271174924..1175805 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; EC253486_1082; phage(gi148609405) 5e-157 Click
281176022..1176858 PHAGE_Entero_cdtI: truncated nonfunctional Cif; EC253486_1083; phage(gi148609406) 7e-153 Click
29complement(1177478..1177603) hypothetical protein; EC253486_1084 0.0 Click
301179096..1179437 PHAGE_Stx2_c_II: putative transposase; EC253486_1085; phage(gi302393161) 5e-58 Click
311179418..1180308 PROPHAGE_Escher_Sakai: putative transposase; EC253486_1086; phage(gi15834498) 2e-173 Click
321181634..1181648 attR    GCTTTTTTATACTAA 0.0 Click

Region 5, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11405112..1405123 attL    CAAAAAACAAAG 0.0 Click
2complement(1405165..1405767) PHAGE_Camelp_virus: CMLV006; EC253486_1296; phage(gi18640240) 3e-12 Click
3complement(1406026..1406154) putative lipoprotein; EC253486_1297 0.0 Click
4complement(1406232..1406501) PHAGE_Pectob_ZF40: putative integrase; EC253486_1298; phage(gi422936642) 6e-12 Click
5complement(1406534..1407130) PHAGE_Pectob_ZF40: putative integrase; EC253486_1299; phage(gi422936642) 4e-43 Click
6complement(1407535..1408575) PHAGE_Entero_mEp460: putative exonuclease; EC253486_1300; phage(gi428782342) 3e-59 Click
7complement(1408630..1409241) PROPHAGE_Escher_Sakai: putative transposase; EC253486_1301; phage(gi15834498) 1e-113 Click
8complement(1409213..1409366) PHAGE_Stx2_c_1717: transposase; EC253486_1302; phage(gi209447179) 3e-18 Click
9complement(1409367..1409749) PROPHAGE_Escher_Sakai: putative transposase; EC253486_1303; phage(gi15834498) 5e-56 Click
10complement(1409749..1410075) PHAGE_Stx2_c_II: putative transposase; EC253486_1304; phage(gi302393161) 1e-58 Click
11complement(1410127..1410420) exonuclease family domain protein; EC253486_1305 0.0 Click
12complement(1410399..1411550) PHAGE_Pectob_ZF40: putative exonuclease; EC253486_1306; phage(gi422936647) 9e-13 Click
131411613..1412218 hypothetical protein; EC253486_1307 0.0 Click
14complement(1412551..1412925) PHAGE_Escher_TL_2011c: hypothetical protein; EC253486_1308; phage(gi418487085) 4e-06 Click
15complement(1412937..1413089) PHAGE_Salico_CGphi29: hypothetical protein; EC253486_1309; phage(gi472340166) 3e-09 Click
16complement(1413362..1414036) PHAGE_Pectob_ZF40: putative cI repressor; EC253486_1310; phage(gi422936650) 6e-50 Click
171414128..1414343 PHAGE_Pectob_ZF40: putative cro anti-repressor; EC253486_1311; phage(gi422936651) 2e-11 Click
181414340..1414765 PHAGE_Pectob_ZF40: putative cII repressor; EC253486_1312; phage(gi422936652) 3e-05 Click
191414837..1415913 PHAGE_Entero_phiP27: hypothetical protein P27p17; EC253486_1313; phage(gi18249881) 5e-29 Click
201415947..1416369 hypothetical protein; EC253486_1314 0.0 Click
211416396..1416662 PHAGE_Klebsi_phiKO2: Gp58; EC253486_1315; phage(gi46402144) 6e-23 Click
221416659..1417120 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; EC253486_1316; phage(gi89152464) 3e-11 Click
231417098..1417454 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; EC253486_1317; phage(gi20065868) 9e-08 Click
241417505..1417717 hypothetical protein; EC253486_1318 0.0 Click
251418024..1418233 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; EC253486_1319; phage(gi399498823) 2e-12 Click
261418244..1419113 PHAGE_Escher_P13374: hypothetical protein; EC253486_1320; phage(gi410491607) 1e-121 Click
271419184..1419333 hypothetical protein; EC253486_1321 0.0 Click
28complement(1419919..1420098) hypothetical protein; EC253486_1322 0.0 Click
291420181..1421230 PHAGE_Entero_mEp460: hypothetical protein; EC253486_1323; phage(gi428782365) 1e-111 Click
301421243..1421614 PHAGE_Escher_HK75: RusA-like protein; EC253486_1324; phage(gi356870726) 1e-36 Click
311421604..1421975 PHAGE_Entero_2008: antitermination protein Q; EC253486_1325; phage(gi209427762) 1e-54 Click
321422441..1422944 CAAX amino terminal protease family protein; EC253486_1326 0.0 Click
331423231..1423428 PHAGE_Entero_phiP27: hypothetical protein P27p23; EC253486_1327; phage(gi18249887) 2e-28 Click
341433651..1433662 attR    CAAAAAACAAAG 0.0 Click

Region 6, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11425047..1426897 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EC253486_1333; phage(gi209427766) 0.0 Click
2complement(1427176..1427337) hypothetical protein; EC253486_1334 0.0 Click
31427345..1427551 PHAGE_Stx2_c_1717: holin protein S-like protein; EC253486_1335; phage(gi209447171) 4e-32 Click
4complement(1427807..1428121) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; EC253486_1336; phage(gi116221998) 4e-18 Click
51428239..1428772 PHAGE_Entero_2008: putative endolysin; EC253486_1337; phage(gi209427769) 2e-99 Click
61428993..1429106 putative membrane protein; EC253486_1338 0.0 Click
71429108..1429575 PHAGE_Entero_4795: putative endopeptidase Rz; EC253486_1339; phage(gi157166036) 1e-73 Click
81429658..1429798 hypothetical protein; EC253486_1340 0.0 Click
9complement(1429924..1430037) hypothetical protein; EC253486_1341 0.0 Click
10complement(1430436..1430600) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; EC253486_1342; phage(gi209427772) 5e-08 Click
11complement(1430710..1431357) PROPHAGE_Escher_EDL933: IS629 transposase; EC253486_1343; phage(gi15803526) 9e-122 Click
12complement(1431419..1431598) PHAGE_Stx2_c_1717: transposase; EC253486_1344; phage(gi209447179) 7e-29 Click
13complement(1431595..1431921) PHAGE_Stx2_c_II: putative transposase; EC253486_1345; phage(gi302393161) 1e-58 Click
14complement(1432008..1432436) PHAGE_Grapev_virus: hypothetical protein GFkVgp3; EC253486_1346; phage(gi18138528) 9e-05 Click
15complement(1433206..1433376) PHAGE_Entero_4795: putative avirulence protein; EC253486_1347; phage(gi157166069) 6e-20 Click

Region 7, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11662649..1663602 PHAGE_Entero_SfV: hypothetical protein SfVp45; EC253486_1618; phage(gi19549032) 1e-80 Click
21663603..1663968 PHAGE_Escher_HK75: RusA-like protein; EC253486_1619; phage(gi356870726) 4e-39 Click
31663965..1664654 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; EC253486_1620; phage(gi169257244) 1e-79 Click
41664850..1664925 tRNA 0.0 Click
51665016..1665092 tRNA 0.0 Click
61665266..1665403 PHAGE_Pseudo_AF: putative tellurite resistance protein; EC253486_1623; phage(gi431810338) 2e-07 Click
71665551..1665697 PHAGE_Pseudo_AF: putative tellurite resistance protein; EC253486_1624; phage(gi431810338) 4e-07 Click
81665694..1665861 PHAGE_Entero_P1: TciB; EC253486_1625; phage(gi46401695) 3e-08 Click
91665999..1666127 hypothetical protein; EC253486_1626 0.0 Click
101666176..1666401 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; EC253486_1627; phage(gi209447169) 2e-24 Click
111666435..1666932 PHAGE_Stx2_c_1717: phage minor tail protein L; EC253486_1628; phage(gi209447192) 8e-92 Click
121667125..1667355 PHAGE_Stx2_c_1717: putative tail component K-like protein; EC253486_1629; phage(gi209447194) 2e-39 Click
131667579..1668427 PHAGE_Stx2_c_1717: putative tail component; EC253486_1630; phage(gi209447195) 8e-103 Click
141668497..1671970 PHAGE_Stx2_c_1717: putative tail fiber component J; EC253486_1631; phage(gi209447196) 0.0 Click
151672038..1672637 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; EC253486_1632; phage(gi209447197) 7e-97 Click
161672789..1674102 PHAGE_Stx2_c_1717: putative tail fiber protein; EC253486_1633; phage(gi209447198) 0.0 Click
171674125..1674373 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; EC253486_1634; phage(gi209447199) 2e-38 Click
181676146..1676628 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; EC253486_1635; phage(gi148609405) 3e-75 Click
19complement(1677175..1677561) PHAGE_Stx2_c_1717: transposase; EC253486_1636; phage(gi209447179) 1e-70 Click
201677893..1678285 PROPHAGE_Escher_Sakai: putative tail assembly protein; EC253486_1637; phage(gi15832200) 8e-76 Click
211678282..1678863 PHAGE_Stx2_c_1717: putative tail component; EC253486_1638; phage(gi209447195) 1e-102 Click
221678970..1679095 hypothetical protein; EC253486_1639 0.0 Click
231679167..1680078 PHAGE_Stx2_c_1717: putative tail fiber component J; EC253486_1640; phage(gi209447196) 4e-173 Click
241680113..1682581 PHAGE_Stx2_c_1717: putative tail fiber component J; EC253486_1641; phage(gi209447196) 0.0 Click
251682648..1683247 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; EC253486_1642; phage(gi209447197) 6e-112 Click
261683312..1683941 PHAGE_Stx2_c_1717: putative tail fiber protein; EC253486_1643; phage(gi209447198) 9e-103 Click
271684636..1684905 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; EC253486_1644; phage(gi209447199) 9e-43 Click
281685121..1686872 PHAGE_Staphy_vB_SauM_Romulus: pentapeptide repeat-containing protein; EC253486_1645; phage(gi472437873) 6e-07 Click

Region 8, total : 79 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11804216..1804228 attL    ATATAAAGAAATA 0.0 Click
21805431..1805979 PHAGE_Sodali_phiSG1: resolvase; EC253486_1764; phage(gi89886020) 1e-21 Click
31807826..1808152 PHAGE_Stx2_c_II: putative transposase; EC253486_1765; phage(gi302393161) 1e-58 Click
41808149..1809039 PROPHAGE_Escher_Sakai: putative transposase; EC253486_1766; phage(gi15834498) 2e-173 Click
51809103..1809639 hypothetical protein; EC253486_1767 0.0 Click
61809699..1809953 hypothetical protein; EC253486_1768 0.0 Click
71809980..1810246 PHAGE_Klebsi_phiKO2: Gp58; EC253486_1769; phage(gi46402144) 8e-23 Click
81810243..1810704 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; EC253486_1770; phage(gi209427735) 2e-08 Click
91810682..1811038 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; EC253486_1771; phage(gi20065868) 5e-08 Click
101811134..1811505 PHAGE_Entero_2008: hypothetical protein YYZ_gp06; EC253486_1772; phage(gi209427732) 4e-51 Click
111811502..1811855 PHAGE_Entero_2008: hypothetical protein YYZ_gp05; EC253486_1773; phage(gi209427731) 4e-37 Click
12complement(1812061..1812360) plasmid stabilization system family protein; EC253486_1774 0.0 Click
13complement(1812366..1812623) antitoxin of a toxin/antitoxin system; EC253486_1775 0.0 Click
14complement(1812652..1812837) hypothetical protein; EC253486_1776 0.0 Click
151813039..1814088 PHAGE_Entero_mEp460: hypothetical protein; EC253486_1777; phage(gi428782365) 1e-110 Click
161814137..1814475 PHAGE_Entero_mEpX2: endodeoxyribonuclease RusA; EC253486_1778; phage(gi428765669) 8e-31 Click
171814472..1814972 PHAGE_Entero_HK225: late gene regulator Q; EC253486_1779; phage(gi428782441) 2e-40 Click
181814966..1815292 PHAGE_Entero_mEp237: late gene regulator Q; EC253486_1780; phage(gi435439320) 2e-41 Click
191815519..1815716 PHAGE_Entero_phiP27: hypothetical protein P27p23; EC253486_1781; phage(gi18249887) 1e-29 Click
201815867..1816925 PHAGE_Entero_phiP27: putative DNA methylase; EC253486_1782; phage(gi18249888) 0.0 Click
211816967..1817041 tRNA 0.0 Click
221817520..1819466 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; EC253486_1784; phage(gi302861197) 0.0 Click
231819824..1820069 PHAGE_Escher_P13374: hypothetical protein; EC253486_1785; phage(gi410491644) 4e-38 Click
241820147..1820362 PHAGE_Escher_P13374: lysis protein, holin; EC253486_1786; phage(gi410491645) 2e-35 Click
251820366..1820611 hypothetical protein; EC253486_1787 0.0 Click
261820637..1820963 PHAGE_Stx2_c_II: putative transposase; EC253486_1788; phage(gi302393161) 1e-58 Click
271820963..1821220 PHAGE_Stx2_c_1717: transposase; EC253486_1789; phage(gi209447179) 2e-42 Click
28complement(1821221..1821803) PROPHAGE_Escher_Sakai: putative transposase; EC253486_1790; phage(gi15834498) 4e-112 Click
29complement(1821800..1822126) PHAGE_Stx2_c_II: putative transposase; EC253486_1791; phage(gi302393161) 1e-58 Click
30complement(1822152..1822289) PROPHAGE_Escher_CFT073: transposase; EC253486_1792; phage(gi26246249) 2e-10 Click
31complement(1822319..1822615) PROPHAGE_Escher_CFT073: transposase; EC253486_1793; phage(gi26246249) 3e-26 Click
321824971..1825561 ipaB/EvcA family protein; EC253486_1794 0.0 Click
33complement(1825780..1825926) hypothetical protein; EC253486_1795 0.0 Click
34complement(1825995..1826177) PROPHAGE_Escher_EDL933: putative transposase; EC253486_1796; phage(gi15803522) 6e-20 Click
35complement(1826187..1826381) PROPHAGE_Escher_EDL933: putative transposase; EC253486_1797; phage(gi15803522) 8e-22 Click
36complement(1826672..1826836) PROPHAGE_Escher_CFT073: putative transposase; EC253486_1798; phage(gi26246170) 3e-21 Click
371827356..1827718 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; EC253486_1799; phage(gi209427795) 3e-19 Click
381828511..1829230 PHAGE_Parame_NY2A: hypothetical protein NY2A_B554R; EC253486_1800; phage(gi157952858) 3e-13 Click
39complement(1829270..1829668) thioesterase superfamily protein; EC253486_1801 0.0 Click
40complement(1829773..1830312) intracellular septation protein A; EC253486_1802 0.0 Click
41complement(1830342..1831085) hypothetical protein; EC253486_1803 0.0 Click
421831442..1832080 outer membrane protein W; EC253486_1804 0.0 Click
43complement(1832126..1833256) PHAGE_Entero_mEp235: integrase; EC253486_1805; phage(gi428781836) 4e-56 Click
44complement(1833234..1833386) excisionase; EC253486_1806 0.0 Click
45complement(1833547..1835035) PHAGE_Entero_mEp460: putative exonuclease; EC253486_1807; phage(gi428782342) 6e-58 Click
46complement(1835036..1835499) PHAGE_Pectob_ZF40: putative exonuclease; EC253486_1808; phage(gi422936647) 7e-06 Click
47complement(1835593..1835784) hypothetical protein; EC253486_1809 0.0 Click
48complement(1835781..1835969) division inhibition protein dicB; EC253486_1810 0.0 Click
491835995..1836108 hypothetical protein; EC253486_1811 0.0 Click
50complement(1836270..1836611) PHAGE_Stx2_c_II: putative transposase; EC253486_1812; phage(gi302393161) 5e-58 Click
51complement(1836831..1837010) hypothetical protein; EC253486_1813 0.0 Click
521837231..1838286 PHAGE_Entero_mEp460: hypothetical protein; EC253486_1814; phage(gi428782365) 2e-88 Click
531838287..1838652 PHAGE_Escher_HK75: RusA-like protein; EC253486_1815; phage(gi356870726) 4e-39 Click
541838661..1839191 hypothetical protein; EC253486_1816 0.0 Click
551839346..1839630 PHAGE_Entero_phiP27: hypothetical protein P27p23; EC253486_1817; phage(gi18249887) 1e-29 Click
561839781..1840839 PHAGE_Entero_phiP27: putative DNA methylase; EC253486_1818; phage(gi18249888) 0.0 Click
571840880..1840955 tRNA 0.0 Click
581841036..1841112 tRNA 0.0 Click
591841636..1842124 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EC253486_1821; phage(gi209427766) 5e-86 Click
601842571..1843488 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EC253486_1822; phage(gi209427766) 3e-173 Click
611843638..1843853 PHAGE_Stx2_c_1717: holin protein S-like protein; EC253486_1823; phage(gi209447171) 4e-34 Click
621843858..1844202 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; EC253486_1824; phage(gi209427768) 2e-59 Click
631844253..1844786 PHAGE_Entero_2008: putative endolysin; EC253486_1825; phage(gi209427769) 3e-100 Click
641845057..1845626 PHAGE_Entero_2008: putative antirepressor; EC253486_1826; phage(gi209427770) 7e-107 Click
651845626..1845772 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; EC253486_1827; phage(gi302861202) 2e-20 Click
661845780..1846247 PHAGE_Entero_2008: putative endopeptidase; EC253486_1828; phage(gi209427771) 1e-81 Click
671846595..1846607 attR    ATATAAAGAAATA 0.0 Click
68complement(1846609..1846776) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; EC253486_1829; phage(gi209427772) 7e-26 Click
691847040..1847243 PHAGE_Entero_2008: putative DNAse; EC253486_1830; phage(gi209427773) 5e-29 Click
701847533..1847832 PHAGE_Entero_2008: putative phage terminase; EC253486_1831; phage(gi209427774) 1e-42 Click
711847814..1848095 PHAGE_Entero_2008: putative phage terminase; EC253486_1832; phage(gi209427774) 5e-43 Click
721848092..1848835 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; EC253486_1833; phage(gi209427775) 5e-139 Click
731848810..1849308 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; EC253486_1834; phage(gi209427775) 5e-86 Click
741849309..1850401 PHAGE_Entero_2008: phage-related tail protein; EC253486_1835; phage(gi209427791) 0.0 Click
751850537..1851811 PHAGE_Entero_2008: phage-related tail protein; EC253486_1836; phage(gi209427791) 0.0 Click
761851879..1852478 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; EC253486_1837; phage(gi209427792) 2e-108 Click
77complement(1852479..1852607) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; EC253486_1838; phage(gi157166059) 9e-19 Click
78complement(1852766..1853542) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; EC253486_1839; phage(gi20065820) 8e-36 Click
791853578..1853856 PHAGE_Stx2_c_1717: putative tail fiber protein; EC253486_1840; phage(gi209447198) 2e-50 Click
801853879..1854127 PHAGE_Entero_2008: hypothetical protein YYZ_gp71; EC253486_1841; phage(gi209427794) 3e-39 Click
811854439..1854663 PHAGE_Entero_P1: InsA; EC253486_1842; phage(gi46401643) 9e-37 Click
821854792..1854974 PROPHAGE_Escher_MG1655: IS1 transposase B; EC253486_1843; phage(gi16131317) 2e-16 Click
831855263..1855853 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; EC253486_1844; phage(gi148609405) 4e-09 Click
841856129..1856401 PHAGE_Entero_phiP27: hypothetical protein P27p57; EC253486_1845; phage(gi18249921) 4e-12 Click

Region 9, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1952624..1953559) PHAGE_Parame_FR483: hypothetical protein FR483_N404R; EC253486_1951; phage(gi155370502) 3e-08 Click
21953580..1953591 attL    AAATGGGGCAAA 0.0 Click
3complement(1953611..1954846) PHAGE_Gifsy_2: bacteriophage integrase; EC253486_1952; phage(gi169257268) 4e-90 Click
4complement(1954848..1955033) hypothetical protein; EC253486_1953 0.0 Click
5complement(1955163..1955423) hypothetical protein; EC253486_1954 0.0 Click
6complement(1955594..1956403) PHAGE_Entero_epsilon15: RecT; EC253486_1955; phage(gi30387413) 1e-80 Click
7complement(1956396..1958996) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; EC253486_1956; phage(gi169257272) 3e-75 Click
8complement(1959098..1959373) rac prophage, predicted protein; EC253486_1957 0.0 Click
9complement(1959448..1959624) PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; EC253486_1958; phage(gi169257274) 5e-06 Click
10complement(1959618..1959794) protein kil; EC253486_1959 0.0 Click
111960341..1960769 phage superinfection exclusion protein; EC253486_1960 0.0 Click
12complement(1960766..1960921) PHAGE_Salico_CGphi29: hypothetical protein; EC253486_1961; phage(gi472340166) 7e-10 Click
13complement(1960932..1961111) hypothetical protein; EC253486_1962 0.0 Click
14complement(1961354..1961773) PHAGE_Entero_HK022: regulatory protein cI; EC253486_1963; phage(gi19343388) 4e-21 Click
151961853..1962107 PHAGE_Escher_HK75: regulatory protein cro; EC253486_1964; phage(gi356870715) 5e-19 Click
161962104..1962526 PHAGE_Entero_mEp237: CII protein; EC253486_1965; phage(gi435439306) 1e-08 Click
171962604..1963392 PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; EC253486_1966; phage(gi169257279) 2e-22 Click
181963399..1964145 PHAGE_Gifsy_2: bacteriophage DNA replication protein; EC253486_1967; phage(gi169257280) 3e-76 Click
191964168..1964929 hypothetical protein; EC253486_1968 0.0 Click
201964945..1965367 hypothetical protein; EC253486_1969 0.0 Click
211965473..1965685 hypothetical protein; EC253486_1970 0.0 Click
221965937..1966200 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; EC253486_1971; phage(gi399498823) 3e-23 Click
231966211..1966372 PHAGE_Salmon_c341: Truncated P22 EaA protein; EC253486_1972; phage(gi255252704) 1e-15 Click
241966574..1966696 PHAGE_Entero_N15: gp45; EC253486_1973; phage(gi9630511) 1e-05 Click
251967128..1968279 PHAGE_Ostreo_2: putative cytosine-specific methyltransferase; EC253486_1974; phage(gi314055145) 7e-27 Click
26complement(1968247..1969236) hypothetical protein; EC253486_1975 0.0 Click
27complement(1969382..1970626) hypothetical protein; EC253486_1976 0.0 Click
281971125..1971724 PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; EC253486_1977; phage(gi169257286) 6e-55 Click
291971865..1972014 PHAGE_Erwini_phiEt88: hypothetical protein; EC253486_1978; phage(gi327198620) 1e-11 Click
301972011..1972565 PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; EC253486_1979; phage(gi399528832) 7e-07 Click
311972705..1972780 tRNA 0.0 Click
321972881..1972957 tRNA 0.0 Click
331973127..1973558 PHAGE_Pseudo_AF: putative tellurite resistance protein; EC253486_1982; phage(gi431810338) 3e-30 Click
341973555..1973722 PHAGE_Entero_P1: TciB; EC253486_1983; phage(gi46401695) 1e-08 Click
351974126..1974440 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EC253486_1984; phage(gi209427766) 7e-56 Click
361974441..1974651 PHAGE_Entero_4795: putative tail component; EC253486_1985; phage(gi157166056) 2e-19 Click
371974648..1974782 PHAGE_Stx2_c_1717: putative tail component; EC253486_1986; phage(gi209447195) 3e-18 Click
38complement(1974973..1975500) PHAGE_Gifsy_2: bacteriophage virulence determinant; superoxide dismutase precursor; EC253486_1987; phage(gi169257313) 4e-55 Click
391975634..1979131 PHAGE_Entero_cdtI: putative tail tip assembly protein; EC253486_1988; phage(gi148609400) 0.0 Click
401979202..1979801 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; EC253486_1989; phage(gi209427792) 6e-112 Click
41complement(1979802..1979930) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; EC253486_1990; phage(gi157166059) 9e-19 Click
42complement(1980089..1980865) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; EC253486_1991; phage(gi20065820) 3e-39 Click
431980901..1981179 PHAGE_Entero_2008: putative tail protein; EC253486_1992; phage(gi209427793) 2e-50 Click
441981202..1981450 PHAGE_Stx2_c_II: putative tail fiber protein; EC253486_1993; phage(gi302393091) 3e-40 Click
451982439..1982564 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; EC253486_1994; phage(gi209427795) 5e-16 Click
461983067..1983561 PHAGE_Entero_2008: hypothetical protein YYZ_gp73; EC253486_1995; phage(gi209427796) 2e-91 Click
471983801..1983812 attR    AAATGGGGCAAA 0.0 Click

Region 10, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12172380..2172391 attL    AGCCAGCCAGTT 0.0 Click
22183949..2184152 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; EC253486_2184; phage(gi410491512) 1e-13 Click
3complement(2184188..2185648) PHAGE_Microm_MpV1: hypothetical protein; EC253486_2185; phage(gi313768442) 2e-40 Click
4complement(2185737..2187020) PHAGE_Burkho_phi1026b: gp59; EC253486_2186; phage(gi38707949) 1e-33 Click
52187188..2187394 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; EC253486_2187; phage(gi148609412) 7e-27 Click
62187513..2187662 hypothetical protein; EC253486_2188 0.0 Click
72187804..2188640 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; EC253486_2189; phage(gi209447201) 1e-100 Click
8complement(2188865..2189740) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp77; EC253486_2190; phage(gi209447200) 4e-114 Click
9complement(2189881..2190150) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; EC253486_2191; phage(gi209447199) 1e-46 Click
10complement(2190240..2191130) PROPHAGE_Escher_Sakai: putative transposase; EC253486_2192; phage(gi15834498) 2e-173 Click
11complement(2191127..2191453) PHAGE_Stx2_c_1717: putative transposase; EC253486_2193; phage(gi209447180) 1e-58 Click
12complement(2191505..2193274) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; EC253486_2194; phage(gi209447169) 0.0 Click
13complement(2193361..2193619) PHAGE_Stx2_c_1717: transposase; EC253486_2195; phage(gi209447179) 3e-48 Click
14complement(2193619..2193945) PHAGE_Stx2_c_1717: putative transposase; EC253486_2196; phage(gi209447180) 1e-58 Click
152194023..2194232 PROPHAGE_Escher_CFT073: transposase insC; EC253486_2197; phage(gi26249447) 5e-32 Click
162194028..2194039 attR    AGCCAGCCAGTT 0.0 Click
172194291..2195130 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; EC253486_2198; phage(gi16130763) 1e-153 Click

Region 11, total : 47 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12383205..2383229 attL    AAAGAAAAAAGGCCGCAGAGCGGCC 0.0 Click
2complement(2383742..2384407) PHAGE_Yersin_413C: Int; EC253486_2396; phage(gi30065733) 4e-56 Click
3complement(2384523..2384693) hypothetical protein; EC253486_2397 0.0 Click
42384731..2385009 hypothetical protein; EC253486_2398 0.0 Click
52385021..2385263 hypothetical protein; EC253486_2399 0.0 Click
6complement(2385328..2385948) PROPHAGE_Escher_Sakai: putative transposase; EC253486_2400; phage(gi15834498) 1e-116 Click
72386395..2387675 PHAGE_Yersin_413C: gpA; EC253486_2401; phage(gi30065742) 2e-23 Click
82387781..2388740 plasmid segregation protein parM; EC253486_2402 0.0 Click
92388745..2389056 hypothetical protein; EC253486_2403 0.0 Click
102389850..2389984 hypothetical protein; EC253486_2404 0.0 Click
112389981..2390109 hypothetical protein; EC253486_2405 0.0 Click
122390253..2390777 hypothetical protein; EC253486_2406 0.0 Click
13complement(2390792..2391811) PHAGE_Salmon_RE_2010: capsid packaging protein; EC253486_2407; phage(gi418489696) 1e-91 Click
14complement(2391838..2393589) PHAGE_Yersin_413C: gpP; EC253486_2408; phage(gi30065706) 1e-132 Click
152393744..2394580 PHAGE_Salmon_RE_2010: capsid scaffolding protein; EC253486_2409; phage(gi418489698) 5e-45 Click
162394604..2395656 PHAGE_Yersin_413C: gpN; EC253486_2410; phage(gi30065708) 1e-73 Click
17complement(2395657..2395797) hypothetical protein; EC253486_2411 0.0 Click
182395771..2396502 PHAGE_Ralsto_phiRSA1: terminase; EC253486_2412; phage(gi145708083) 7e-33 Click
192396611..2397099 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); EC253486_2413; phage(gi134288689) 3e-25 Click
202397099..2397299 PHAGE_Yersin_413C: gpX; EC253486_2414; phage(gi30065711) 9e-11 Click
212397302..2397625 PHAGE_Aeromo_phiO18P: putative holin; EC253486_2415; phage(gi148727161) 1e-09 Click
222397622..2398014 PHAGE_Entero_phiP27: putative endolysin; EC253486_2416; phage(gi18249894) 1e-53 Click
232398011..2398418 hypothetical protein; EC253486_2417 0.0 Click
242398556..2399023 PHAGE_Yersin_413C: gpR; EC253486_2418; phage(gi30065716) 8e-19 Click
252399037..2399651 PHAGE_Pseudo_phiCTX: predicted tail completion; EC253486_2419; phage(gi17313233) 6e-19 Click
262399663..2400229 PHAGE_Yersin_413C: gpV; EC253486_2420; phage(gi30065718) 1e-41 Click
272400247..2400576 PHAGE_Erwini_ENT90: baseplate assembly protein; EC253486_2421; phage(gi431810974) 2e-21 Click
282400580..2401476 PHAGE_Yersin_413C: gpJ; EC253486_2422; phage(gi30065720) 2e-85 Click
292401469..2401999 PHAGE_Yersin_413C: gpI; EC253486_2423; phage(gi30065721) 6e-62 Click
302402002..2404134 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; EC253486_2424; phage(gi16129506) 5e-133 Click
312404146..2404664 PHAGE_Entero_HK630: tail fiber assembly protein; EC253486_2425; phage(gi428782810) 6e-68 Click
32complement(2404754..2405326) bacterial transferase hexapeptide family protein; EC253486_2426 0.0 Click
33complement(2405483..2405971) PROPHAGE_Salmon_Ty2: putative phage tail protein; EC253486_2427; phage(gi29143763) 1e-39 Click
34complement(2405984..2408791) PHAGE_Yersin_413C: gpT; EC253486_2428; phage(gi30065729) 2e-104 Click
35complement(2408778..2408933) PHAGE_Yersin_413C: gpE+E'; EC253486_2429; phage(gi30065728) 3e-07 Click
36complement(2408942..2409316) PHAGE_Yersin_413C: gpE; EC253486_2430; phage(gi30065727) 7e-08 Click
37complement(2409372..2409884) PROPHAGE_Salmon_Ty2: major tail tube protein; EC253486_2431; phage(gi29143759) 4e-35 Click
38complement(2409884..2410036) PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp24; EC253486_2432; phage(gi17313241) 8e-06 Click
392410157..2410483 PHAGE_Stx2_c_II: putative transposase; EC253486_2433; phage(gi302393161) 3e-58 Click
402410480..2411370 PROPHAGE_Escher_Sakai: putative transposase; EC253486_2434; phage(gi15834498) 2e-173 Click
41complement(2411410..2412381) PHAGE_Erwini_ENT90: tail sheath protein; EC253486_2435; phage(gi431810939) 3e-82 Click
422412361..2412492 hypothetical protein; EC253486_2436 0.0 Click
432412539..2413279 PHAGE_Yersin_413C: gpD; EC253486_2437; phage(gi30065731) 2e-62 Click
442413276..2413647 PHAGE_Yersin_413C: gpD; EC253486_2438; phage(gi30065731) 5e-27 Click
452413873..2415375 hypothetical protein; EC253486_2439 0.0 Click
462415619..2415879 PHAGE_Yersin_413C: Ogr; EC253486_2440; phage(gi30065732) 7e-08 Click
472416070..2416210 PHAGE_Escher_P13374: prophage host toxic membrane protein; EC253486_2441; phage(gi410491667) 3e-16 Click
482416475..2416499 attR    AAAGAAAAAAGGCCGCAGAGCGGCC 0.0 Click
49complement(2416517..2416816) PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; EC253486_2442; phage(gi9630187) 4e-15 Click

Region 12, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12681836..2681847 attL    ATAGCTTTTATC 0.0 Click
2complement(2682199..2682447) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp76; EC253486_2731; phage(gi209447199) 2e-38 Click
3complement(2682470..2682748) PHAGE_Stx2_c_1717: putative tail fiber protein; EC253486_2732; phage(gi209447198) 2e-50 Click
42682784..2683560 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; EC253486_2733; phage(gi20065820) 8e-36 Click
52683719..2683847 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; EC253486_2734; phage(gi157166059) 9e-19 Click
6complement(2683848..2684447) PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; EC253486_2735; phage(gi209447197) 7e-112 Click
7complement(2684515..2687925) PHAGE_Stx2_c_1717: putative tail fiber component J; EC253486_2736; phage(gi209447196) 0.0 Click
82687965..2688081 hypothetical protein; EC253486_2737 0.0 Click
9complement(2688238..2688480) PHAGE_Stx2_c_1717: putative tail component; EC253486_2738; phage(gi209447195) 6e-39 Click
10complement(2688477..2688821) PHAGE_Stx2_c_1717: putative tail component; EC253486_2739; phage(gi209447195) 2e-38 Click
11complement(2688818..2689210) PROPHAGE_Escher_Sakai: putative tail assembly protein; EC253486_2740; phage(gi15832200) 8e-76 Click
122689172..2689691 hypothetical protein; EC253486_2741 0.0 Click
13complement(2689753..2690184) PHAGE_Pseudo_AF: putative tellurite resistance protein; EC253486_2742; phage(gi431810338) 3e-30 Click
142690335..2690697 PHAGE_Stx2_c_1717: truncated transposase; EC253486_2743; phage(gi209447151) 9e-11 Click
152690748..2691044 PHAGE_Stx2_c_1717: transposase; EC253486_2744; phage(gi209447152) 4e-31 Click
162691075..2692688 PHAGE_Stx2_c_1717: transposase; EC253486_2745; phage(gi209447153) 0.0 Click
17complement(2692894..2692970) tRNA 0.0 Click
18complement(2692984..2693060) tRNA 0.0 Click
19complement(2693070..2693145) tRNA 0.0 Click
20complement(2693174..2693887) transcriptional regulator, AraC family; EC253486_2749 0.0 Click
21complement(2694024..2694221) PHAGE_Entero_phiP27: hypothetical protein P27p23; EC253486_2750; phage(gi18249887) 4e-29 Click
22complement(2694445..2694999) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; EC253486_2751; phage(gi399528832) 2e-06 Click
23complement(2695008..2695367) PHAGE_Escher_HK75: RusA-like protein; EC253486_2752; phage(gi356870726) 1e-37 Click
24complement(2695380..2696429) PHAGE_Entero_mEp460: hypothetical protein; EC253486_2753; phage(gi428782365) 3e-112 Click
25complement(2696431..2696580) PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; EC253486_2754; phage(gi169257287) 9e-08 Click
26complement(2696825..2697157) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; EC253486_2755; phage(gi20065865) 2e-56 Click
27complement(2697735..2698292) PHAGE_Escher_TL_2011c: hypothetical protein; EC253486_2756; phage(gi418487081) 6e-28 Click
28complement(2698640..2698933) PHAGE_Entero_mEp213: hypothetical protein; EC253486_2757; phage(gi428782634) 1e-20 Click
29complement(2698944..2699171) PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; EC253486_2758; phage(gi169257161) 2e-16 Click
30complement(2699168..2699422) hypothetical protein; EC253486_2759 0.0 Click
31complement(2699482..2700198) hypothetical protein; EC253486_2760 0.0 Click
32complement(2700220..2700966) PHAGE_Gifsy_2: bacteriophage DNA replication protein; EC253486_2761; phage(gi169257280) 1e-74 Click
33complement(2700973..2702043) PHAGE_Entero_phiP27: hypothetical protein P27p17; EC253486_2762; phage(gi18249881) 1e-28 Click
34complement(2702115..2702540) PHAGE_Escher_HK639: cII; EC253486_2763; phage(gi356870652) 8e-06 Click
352703114..2703323 hypothetical protein; EC253486_2764 0.0 Click
362703589..2703741 PHAGE_Salico_CGphi29: hypothetical protein; EC253486_2765; phage(gi472340166) 3e-09 Click
372703753..2704391 PHAGE_Escher_TL_2011c: hypothetical protein; EC253486_2766; phage(gi418487085) 6e-09 Click
38complement(2704392..2704613) hypothetical protein; EC253486_2767 0.0 Click
39complement(2705063..2705578) hypothetical protein; EC253486_2768 0.0 Click
402705641..2707674 PHAGE_Salmon_ST64B: Integrase protein; EC253486_2769; phage(gi23505472) 6e-46 Click
412707770..2708027 PHAGE_Salmon_ST64B: Integrase protein; EC253486_2770; phage(gi23505472) 3e-24 Click
42complement(2708080..2708169) tRNA 0.0 Click
432708263..2709060 hypothetical protein; EC253486_2772 0.0 Click
442709161..2709236 tRNA 0.0 Click
452709219..2709237 attL    GTCCAGTCAGAGGAGCCAA 0.0 Click
462709416..2710690 PROPHAGE_Escher_CFT073: prophage P4 integrase; EC253486_2774; phage(gi26251024) 8e-141 Click
47complement(2710760..2711011) PHAGE_Clostr_phiMMP02: hypothetical protein; EC253486_2775; phage(gi414090415) 7e-05 Click
482711376..2711492 hypothetical protein; EC253486_2776 0.0 Click
492712571..2712708 hypothetical protein; EC253486_2777 0.0 Click
502712763..2712984 putative membrane protein; EC253486_2778 0.0 Click
51complement(2713738..2714904) PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; EC253486_2779; phage(gi414087138) 1e-06 Click
522715084..2715410 PHAGE_Stx2_c_1717: putative transposase; EC253486_2780; phage(gi209447180) 1e-58 Click
532715407..2716051 PROPHAGE_Escher_Sakai: putative transposase; EC253486_2781; phage(gi15834498) 6e-124 Click
542716052..2716207 PHAGE_Stx2_c_1717: transposase; EC253486_2782; phage(gi209447179) 3e-25 Click
55complement(2716247..2717041) ADP-heptose:LPS heptosyltransferase-like domain protein; EC253486_2783 0.0 Click
562717356..2718087 PHAGE_Burkho_phi1026b: gp59; EC253486_2784; phage(gi38707949) 1e-35 Click
572718123..2718644 PHAGE_Burkho_phi1026b: gp59; EC253486_2785; phage(gi38707949) 2e-07 Click
582726002..2726020 attR    GTCCAGTCAGAGGAGCCAA 0.0 Click
592727047..2727058 attR    ATAGCTTTTATC 0.0 Click

Region 13, total : 61 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12731648..2731662 attL    CTGCCGCCCATTGTG 0.0 Click
2complement(2740476..2741648) PHAGE_Stx2_c_1717: penicillin-binding protein 6b; EC253486_2820; phage(gi209447203) 0.0 Click
3complement(2741986..2742117) PHAGE_Entero_N15: UmuD; EC253486_2821; phage(gi9630490) 8e-09 Click
42742496..2743404 PHAGE_Escher_TL_2011b: hypothetical protein; EC253486_2822; phage(gi418487678) 2e-13 Click
5complement(2743445..2745382) PHAGE_Entero_HK620: tail spike protein; EC253486_2823; phage(gi13559880) 1e-58 Click
62745638..2745772 PHAGE_Salmon_ST160: Mnt; EC253486_2824; phage(gi318065963) 1e-05 Click
7complement(2746008..2746736) PHAGE_Entero_P1: Ant2; EC253486_2825; phage(gi46401670) 8e-21 Click
8complement(2746825..2747451) PHAGE_Salmon_SPN3UB: hypothetical protein; EC253486_2826; phage(gi423262398) 3e-89 Click
9complement(2748706..2750571) PHAGE_Entero_P22: injection protein; EC253486_2827; phage(gi51236731) 2e-163 Click
10complement(2750571..2751935) PHAGE_Entero_P22: injection protein; EC253486_2828; phage(gi9635545) 6e-155 Click
11complement(2751946..2752641) PHAGE_Entero_HK620: DNA transfer protein; EC253486_2829; phage(gi13559875) 9e-126 Click
12complement(2752644..2753099) PHAGE_Entero_HK620: head assembly protein; EC253486_2830; phage(gi13559874) 7e-86 Click
13complement(2753099..2753947) PHAGE_Entero_HK620: DNA stabilization protein; EC253486_2831; phage(gi13559873) 9e-38 Click
14complement(2753947..2755365) PHAGE_Entero_HK620: DNA stabilization protein; EC253486_2832; phage(gi13559872) 0.0 Click
15complement(2755375..2755767) PHAGE_Entero_HK620: DNA stabilization protein; EC253486_2833; phage(gi13559871) 9e-21 Click
16complement(2755817..2755972) hypothetical protein; EC253486_2834 0.0 Click
17complement(2756047..2757300) PHAGE_Entero_P22: coat protein; EC253486_2835; phage(gi9635538) 3e-34 Click
18complement(2757319..2758212) PHAGE_Entero_HK620: scaffold protein; EC253486_2836; phage(gi13559868) 2e-28 Click
19complement(2758303..2760486) PHAGE_Entero_HK620: portal protein; EC253486_2837; phage(gi13559867) 0.0 Click
20complement(2760502..2761917) PHAGE_Entero_HK620: terminase large subunit; EC253486_2838; phage(gi13559866) 0.0 Click
21complement(2761914..2762342) PHAGE_Entero_HK620: terminase small subunit; EC253486_2839; phage(gi13559865) 5e-77 Click
22complement(2762360..2762539) PHAGE_Entero_HK620: hypothetical protein HK620p41; EC253486_2840; phage(gi13559864) 1e-24 Click
23complement(2762840..2763079) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; EC253486_2841; phage(gi399498861) 2e-36 Click
24complement(2763380..2763904) PHAGE_Escher_HK639: rha protein; EC253486_2842; phage(gi356870673) 2e-89 Click
25complement(2764105..2764542) PHAGE_Escher_HK75: Rz; EC253486_2843; phage(gi356870731) 2e-75 Click
26complement(2764539..2765012) PHAGE_Escher_HK75: lysozyme; EC253486_2844; phage(gi356870730) 5e-88 Click
27complement(2764999..2765316) PHAGE_Entero_mEp213: holin protein; EC253486_2845; phage(gi428782657) 2e-54 Click
282765433..2765615 hypothetical protein; EC253486_2846 0.0 Click
292765661..2765795 hypothetical protein; EC253486_2847 0.0 Click
30complement(2765757..2766335) PHAGE_Entero_mEp213: late gene regulator protein Q; EC253486_2848; phage(gi428782656) 2e-108 Click
31complement(2766562..2766924) PHAGE_Entero_mEpX2: endodeoxyribonuclease RusA; EC253486_2849; phage(gi428765669) 8e-65 Click
32complement(2766921..2767085) PHAGE_Salmon_SPN9CC: hypothetical protein; EC253486_2850; phage(gi389060524) 3e-26 Click
33complement(2767769..2768296) PHAGE_Entero_mEp213: DNA N-6-adenine-methyltransferase (Dam); EC253486_2851; phage(gi428782650) 3e-101 Click
34complement(2768293..2768739) PHAGE_Stx2_c_1717: NinB protein; EC253486_2852; phage(gi209447158) 8e-84 Click
35complement(2768696..2769058) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp32; EC253486_2853; phage(gi209447157) 2e-67 Click
36complement(2769291..2769569) PHAGE_Entero_2008: hypothetical protein YYZ_gp30; EC253486_2854; phage(gi209427755) 2e-51 Click
37complement(2769639..2769908) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp61; EC253486_2855; phage(gi302393144) 1e-46 Click
38complement(2769908..2771344) PHAGE_Entero_HK620: replication protein P; EC253486_2856; phage(gi13559848) 0.0 Click
39complement(2771334..2772233) PHAGE_Stx2_c_86: replication protein O; EC253486_2857; phage(gi116222059) 5e-176 Click
40complement(2772407..2772685) PHAGE_Entero_mEpX2: CII protein; EC253486_2858; phage(gi428765658) 1e-45 Click
41complement(2772794..2772988) PHAGE_Entero_HK620: cro; EC253486_2859; phage(gi13559844) 2e-30 Click
422773095..2773811 PHAGE_Entero_HK620: repressor protein cI; EC253486_2860; phage(gi13559843) 1e-132 Click
432774565..2774837 PHAGE_Entero_HK620: antitermination protein N; EC253486_2861; phage(gi13559841) 5e-41 Click
442775276..2775398 PHAGE_Entero_HK544: restriction alleviation protein; EC253486_2862; phage(gi428783253) 2e-16 Click
452775620..2775772 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip113; EC253486_2863; phage(gi20065908) 7e-24 Click
462775804..2775935 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip113; EC253486_2864; phage(gi20065908) 4e-19 Click
472776130..2776300 PHAGE_Salmon_SPN9CC: hypothetical protein; EC253486_2865; phage(gi389060502) 3e-26 Click
482776376..2776546 PHAGE_Entero_mEp234: hypothetical protein; EC253486_2866; phage(gi428782284) 2e-26 Click
492776557..2777162 PHAGE_Entero_HK542: essential recombination function protein; EC253486_2867; phage(gi428783375) 1e-111 Click
502777162..2777545 PHAGE_Entero_HK106: hypothetical protein; EC253486_2868; phage(gi428783315) 2e-68 Click
512777569..2777862 PHAGE_Entero_HK633: Abc2 protein; EC253486_2869; phage(gi428782555) 4e-53 Click
522777873..2778040 PHAGE_Entero_HK620: hypothetical protein HK620p09; EC253486_2870; phage(gi13559832) 1e-21 Click
532778037..2778336 PHAGE_Escher_HK75: hypothetical protein; EC253486_2871; phage(gi356870704) 7e-55 Click
542778338..2778892 PHAGE_Entero_HK620: hypothetical protein HK620p07; EC253486_2872; phage(gi13559830) 2e-56 Click
552779124..2779243 hypothetical protein; EC253486_2873 0.0 Click
562779255..2779464 PHAGE_Entero_phiV10: hypothetical protein PhiV10p52; EC253486_2874; phage(gi89152466) 3e-35 Click
572779461..2779787 PHAGE_Salmon_SPN3UB: putative Eaa protein; EC253486_2875; phage(gi423262432) 2e-30 Click
582779805..2780263 PHAGE_Salmon_ST64B: hypothetical protein sb31; EC253486_2876; phage(gi23505475) 4e-43 Click
592780256..2780540 PHAGE_Entero_ST104: ORF6; EC253486_2877; phage(gi46358654) 5e-51 Click
602780600..2780911 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip084; EC253486_2878; phage(gi20065879) 1e-54 Click
612780993..2781184 PHAGE_Entero_mEp234: hypothetical protein; EC253486_2879; phage(gi428782280) 8e-33 Click
62complement(2781165..2782343) PHAGE_Entero_mEp234: integrase; EC253486_2880; phage(gi428782279) 0.0 Click
632784066..2784080 attR    CTGCCGCCCATTGTG 0.0 Click

Region 14, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13014677..3014688 attL    GTCTTATCTGGC 0.0 Click
23025597..3026919 PHAGE_Entero_4795: NleA4795 protein; EC253486_3110; phage(gi157166068) 0.0 Click
33027195..3027410 PROPHAGE_Escher_CFT073: transposase; EC253486_3111; phage(gi26246249) 1e-14 Click
43028289..3028615 PHAGE_Stx2_c_1717: putative transposase; EC253486_3112; phage(gi209447180) 1e-58 Click
53028612..3029502 PROPHAGE_Escher_Sakai: putative transposase; EC253486_3113; phage(gi15834498) 2e-173 Click
6complement(3029542..3030066) PHAGE_Entero_P22: Rha; EC253486_3114; phage(gi9635533) 1e-86 Click
7complement(3030216..3030653) PHAGE_Stx2_c_1717: putative Rz lysis protein; EC253486_3115; phage(gi209447173) 1e-75 Click
8complement(3030650..3031147) PHAGE_Stx2_c_1717: phage-related lysozyme; EC253486_3116; phage(gi209447172) 1e-91 Click
9complement(3031147..3031362) PHAGE_Stx2_c_1717: holin protein S-like protein; EC253486_3117; phage(gi209447171) 7e-35 Click
10complement(3031733..3031879) hypothetical protein; EC253486_3118 0.0 Click
11complement(3031984..3032142) PHAGE_Entero_P1: TciB; EC253486_3119; phage(gi46401695) 3e-06 Click
123032407..3032520 hypothetical protein; EC253486_3120 0.0 Click
13complement(3032478..3032954) putative membrane protein; EC253486_3121 0.0 Click
14complement(3033234..3033857) PHAGE_Entero_mEpX1: late gene regulator Q; EC253486_3122; phage(gi428781929) 2e-116 Click
15complement(3033854..3034003) PHAGE_Entero_mEp234: NinI protein; EC253486_3123; phage(gi428782306) 2e-22 Click
16complement(3034045..3034518) PHAGE_Stx2_c_1717: NinI protein; EC253486_3124; phage(gi209447164) 9e-76 Click
17complement(3034515..3035117) PHAGE_Stx2_c_1717: NinG protein; EC253486_3125; phage(gi209447163) 6e-103 Click
18complement(3035809..3035979) hypothetical protein; EC253486_3126 0.0 Click
193036146..3037132 hypothetical protein; EC253486_3127 0.0 Click
203037171..3037998 hypothetical protein; EC253486_3128 0.0 Click
213038850..3039185 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp03; EC253486_3129; phage(gi209447128) 2e-58 Click
223039487..3040557 PHAGE_Entero_mEp235: integrase; EC253486_3130; phage(gi428781836) 0.0 Click
233054857..3054868 attR    GTCTTATCTGGC 0.0 Click

Region 15, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13165836..3165859 attL    GTCCTCTTAGTTAAATGGATATAA 0.0 Click
2complement(3165982..3174351) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp35; EC253486_3252; phage(gi116222027) 0.0 Click
3complement(3174420..3175685) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; EC253486_3253; phage(gi302393102) 0.0 Click
4complement(3175696..3175947) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; EC253486_3254; phage(gi302393101) 2e-40 Click
5complement(3175957..3176169) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; EC253486_3255; phage(gi302393100) 1e-33 Click
6complement(3176406..3177062) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; EC253486_3256; phage(gi302393099) 5e-122 Click
7complement(3177156..3177533) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; EC253486_3257; phage(gi302393098) 1e-69 Click
8complement(3177614..3177754) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp17; EC253486_3258; phage(gi302393097) 1e-21 Click
9complement(3178082..3178720) PHAGE_Stx2_c_II: outer membrane protein Lom precursor; EC253486_3259; phage(gi302393096) 5e-114 Click
10complement(3178811..3179428) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; EC253486_3260; phage(gi302393095) 4e-122 Click
11complement(3179727..3180995) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; EC253486_3261; phage(gi302393093) 0.0 Click
12complement(3180992..3182617) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; EC253486_3262; phage(gi302393092) 0.0 Click
13complement(3182921..3183154) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip029; EC253486_3263; phage(gi20065825) 2e-40 Click
143183393..3183719 PHAGE_Stx2_c_II: putative transposase; EC253486_3264; phage(gi302393161) 1e-58 Click
153183719..3184136 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; EC253486_3265; phage(gi302393160) 2e-77 Click
16complement(3184137..3184237) PHAGE_Stx2_c_I: Q protein; EC253486_3266; phage(gi20065938) 4e-10 Click
17complement(3184373..3184978) PHAGE_Stx2_c_II: NinG protein; EC253486_3267; phage(gi302393154) 5e-116 Click
18complement(3184978..3185700) PHAGE_Stx2_c_1717: putative DNA-binding protein Roi of bacteriophage; EC253486_3268; phage(gi209447162) 3e-131 Click
19complement(3185775..3186167) PHAGE_Stx2_c_II: putative antirepressor-like protein; EC253486_3269; phage(gi302393152) 2e-73 Click
20complement(3186906..3187433) PHAGE_Stx2_c_1717: putative DNA N-6-adenine-methyltransferase of bacteriophage; EC253486_3270; phage(gi209447159) 1e-101 Click
21complement(3187430..3187876) PHAGE_Stx2_c_II: NinB protein; EC253486_3271; phage(gi302393148) 5e-83 Click
22complement(3187833..3188195) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp32; EC253486_3272; phage(gi209447157) 2e-67 Click
23complement(3188428..3188706) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp62; EC253486_3273; phage(gi302393145) 5e-51 Click
24complement(3188776..3189045) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp61; EC253486_3274; phage(gi302393144) 1e-46 Click
25complement(3189045..3190481) PHAGE_Entero_mEp235: replicative DNA helicase; EC253486_3275; phage(gi428781855) 0.0 Click
26complement(3190471..3191370) PHAGE_Stx2_c_86: replication protein O; EC253486_3276; phage(gi116222059) 4e-176 Click
27complement(3191542..3191838) PHAGE_Stx2_c_II: CII protein; EC253486_3277; phage(gi302393140) 7e-50 Click
28complement(3192008..3192127) hypothetical protein; EC253486_3278 0.0 Click
293192336..3193028 PHAGE_Erwini_phiEt88: phage repressor protein; EC253486_3279; phage(gi327198606) 4e-69 Click
30complement(3193164..3193304) hypothetical protein; EC253486_3280 0.0 Click
313193936..3194406 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip113; EC253486_3281; phage(gi20065908) 1e-90 Click
323194557..3194925 PHAGE_Stx2_c_I: Ea10 protein; EC253486_3282; phage(gi20065907) 5e-68 Click
333195146..3195274 PHAGE_Stx2_c_86: putative host killing protein Kil; EC253486_3283; phage(gi116222047) 1e-17 Click
343195350..3195646 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; EC253486_3284; phage(gi116222045) 9e-53 Click
353195652..3196437 PHAGE_Stx2_c_I: Bet protein; EC253486_3285; phage(gi20065900) 2e-151 Click
363196590..3197111 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip102; EC253486_3286; phage(gi20065897) 2e-100 Click
373197344..3197457 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp43; EC253486_3287; phage(gi302393126) 4e-14 Click
383197534..3197749 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp41; EC253486_3288; phage(gi302393124) 5e-35 Click
393198066..3198839 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp38; EC253486_3289; phage(gi302393121) 1e-145 Click
403198850..3199179 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp37; EC253486_3290; phage(gi302393120) 3e-63 Click
413199181..3199390 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp36; EC253486_3291; phage(gi302393119) 5e-37 Click
423199387..3199842 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp45; EC253486_3292; phage(gi116222037) 5e-87 Click
433200013..3200219 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp33; EC253486_3293; phage(gi302393116) 7e-27 Click
443200858..3201481 PHAGE_Stx2_c_II: putative antirepressor protein AntB; EC253486_3294; phage(gi302393111) 3e-87 Click
453201524..3201691 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp41; EC253486_3295; phage(gi116222033) 9e-29 Click
463201918..3202550 PHAGE_Stx2_c_86: adenine methylase; EC253486_3296; phage(gi116222031) 2e-124 Click
473202777..3203103 PHAGE_Stx2_c_II: putative transposase; EC253486_3297; phage(gi302393161) 1e-58 Click
483203100..3203990 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; EC253486_3298; phage(gi302393160) 2e-173 Click
493204066..3204425 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; EC253486_3299; phage(gi116222030) 1e-61 Click
503204504..3204686 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; EC253486_3300; phage(gi116222029) 4e-29 Click
51complement(3204670..3205884) PHAGE_Stx2_c_86: integrase; EC253486_3301; phage(gi116222028) 0.0 Click
523206035..3206058 attR    GTCCTCTTAGTTAAATGGATATAA 0.0 Click

Region 16, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13470261..3470272 attL    CATCTGGCGCAG 0.0 Click
23475283..3476944 PHAGE_Human__8: LANA; EC253486_3569; phage(gi139472804) 2e-05 Click
33477093..3477434 smpA / OmlA family protein; EC253486_3570 0.0 Click
4complement(3477496..3477786) hypothetical protein; EC253486_3571 0.0 Click
5complement(3477776..3478165) polyketide cyclase / dehydrase and lipid transport family protein; EC253486_3572 0.0 Click
63478384..3478866 ssrA-binding protein; EC253486_3573 0.0 Click
73479081..3479443 tRNA 0.0 Click
83479757..3479963 PHAGE_Entero_4795: putative damage-inducible protein DinI; EC253486_3574; phage(gi157166070) 3e-18 Click
9complement(3480331..3480600) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF76; EC253486_3575; phage(gi157166061) 4e-43 Click
10complement(3480978..3481178) PROPHAGE_Escher_Sakai: putative tail fiber protein; EC253486_3576; phage(gi15832195) 2e-31 Click
113481157..3481699 hypothetical protein; EC253486_3577 0.0 Click
123481858..3481986 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; EC253486_3578; phage(gi157166059) 9e-19 Click
13complement(3481983..3482585) PHAGE_Entero_4795: outer membrane protein Lom precursor; EC253486_3579; phage(gi157166058) 2e-85 Click
14complement(3482653..3486129) PHAGE_Entero_4795: putative tail component; EC253486_3580; phage(gi157166057) 0.0 Click
15complement(3486376..3487056) PHAGE_Entero_4795: putative tail component; EC253486_3581; phage(gi157166056) 1e-123 Click
163487098..3487410 hypothetical protein; EC253486_3582 0.0 Click
17complement(3487411..3487595) PHAGE_Stx2_c_1717: transposase; EC253486_3583; phage(gi209447179) 1e-32 Click
18complement(3487592..3487918) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; EC253486_3584; phage(gi157166062) 1e-58 Click
193488116..3488127 attR    CATCTGGCGCAG 0.0 Click
203488231..3488944 PROPHAGE_Entero_Fels-2: integrase-like protein; EC253486_3585; phage(gi16766052) 2e-71 Click
21complement(3489469..3491148) hypothetical protein; EC253486_3586 0.0 Click
22complement(3491219..3493063) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; EC253486_3587; phage(gi9631364) 2e-05 Click

Region 17, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15062317..5062332 attL    ATGCCTGAAAAAACTG 0.0 Click
25062520..5063056 PHAGE_Entero_mEp460: hypothetical protein; EC253486_5201; phage(gi428782339) 2e-100 Click
35063253..5063426 PHAGE_Entero_mEp460: hypothetical protein; EC253486_5202; phage(gi428782340) 4e-26 Click
4complement(5063474..5063755) PHAGE_Entero_mEp460: hypothetical protein; EC253486_5203; phage(gi428782341) 1e-48 Click
5complement(5063792..5064352) PHAGE_Entero_mEp460: putative exonuclease; EC253486_5204; phage(gi428782342) 3e-105 Click
6complement(5064364..5065098) PHAGE_Entero_mEp460: hypothetical protein; EC253486_5205; phage(gi428782343) 3e-129 Click
7complement(5065101..5065292) PHAGE_Entero_mEp460: hypothetical protein; EC253486_5206; phage(gi428782344) 3e-27 Click
8complement(5065345..5065761) PHAGE_Entero_mEp460: hypothetical protein; EC253486_5207; phage(gi428782343) 6e-14 Click
9complement(5065908..5066381) PHAGE_Pectob_ZF40: putative methylase; EC253486_5208; phage(gi422936660) 2e-66 Click
10complement(5066378..5066722) PHAGE_Escher_P13374: hypothetical protein; EC253486_5209; phage(gi410491610) 4e-38 Click
11complement(5066719..5067255) PHAGE_Entero_mEp460: hypothetical protein; EC253486_5210; phage(gi428782349) 8e-99 Click
12complement(5067383..5068207) PHAGE_Entero_mEp460: hypothetical protein; EC253486_5211; phage(gi428782350) 1e-150 Click
13complement(5068273..5068635) PHAGE_Entero_mEp460: hypothetical protein; EC253486_5212; phage(gi428782351) 3e-63 Click
14complement(5069339..5070031) PHAGE_Entero_mEp460: prophage repressor; EC253486_5213; phage(gi428782354) 1e-118 Click
155070174..5070389 PHAGE_Entero_mEp460: putative antirepressor Cro; EC253486_5214; phage(gi428782355) 6e-33 Click
165070382..5070933 PHAGE_Entero_mEp460: hypothetical protein; EC253486_5215; phage(gi428782356) 3e-102 Click
17complement(5070939..5071052) hypothetical protein; EC253486_5216 0.0 Click
18complement(5071036..5071683) PROPHAGE_Escher_EDL933: IS629 transposase; EC253486_5217; phage(gi15803526) 9e-122 Click
195071845..5072432 PHAGE_Entero_mEp460: hypothetical protein; EC253486_5218; phage(gi428782365) 2e-112 Click
205072446..5073198 PHAGE_Entero_mEp460: late gene regulator; EC253486_5219; phage(gi428782366) 3e-145 Click
215073508..5073660 PHAGE_Entero_mEp460: DNA methylase; EC253486_5220; phage(gi428782369) 1e-07 Click
225073701..5073776 tRNA 0.0 Click
235073786..5073862 tRNA 0.0 Click
245073876..5073952 tRNA 0.0 Click
255074478..5076328 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; EC253486_5224; phage(gi209427766) 0.0 Click
26complement(5076623..5076769) hypothetical protein; EC253486_5225 0.0 Click
275076777..5076983 PHAGE_Stx2_c_1717: holin protein S-like protein; EC253486_5226; phage(gi209447171) 3e-33 Click
285076983..5077448 PHAGE_Stx2_c_1717: phage-related lysozyme; EC253486_5227; phage(gi209447172) 1e-86 Click
295077449..5078679 PHAGE_Entero_4795: putative tail component; EC253486_5228; phage(gi157166052) 0.0 Click
305078672..5079013 PHAGE_Stx2_c_1717: minor tail protein; EC253486_5229; phage(gi209447191) 4e-62 Click
315079013..5079711 PHAGE_Stx2_c_1717: phage minor tail protein L; EC253486_5230; phage(gi209447192) 5e-131 Click
325079786..5079950 PHAGE_Entero_mEp460: tail fiber component; EC253486_5231; phage(gi428782332) 3e-13 Click
335079908..5080462 PHAGE_Entero_mEp460: tail fiber component; EC253486_5232; phage(gi428782332) 1e-97 Click
345080459..5081040 PHAGE_Entero_4795: putative tail component; EC253486_5233; phage(gi157166056) 1e-101 Click
355081276..5084752 PHAGE_Entero_4795: putative tail component; EC253486_5234; phage(gi157166057) 0.0 Click
365084785..5085444 PHAGE_Entero_HK630: outer host membrane protein; EC253486_5235; phage(gi428782809) 1e-70 Click
375085509..5086822 PHAGE_Entero_4795: putative tail fiber protein; EC253486_5236; phage(gi157166060) 0.0 Click
385086845..5087093 PHAGE_Stx2_c_II: putative tail fiber protein; EC253486_5237; phage(gi302393091) 3e-39 Click
39complement(5087805..5088863) hypothetical protein; EC253486_5238 0.0 Click
405088893..5089006 putative membrane protein; EC253486_5239 0.0 Click
415089498..5089665 hypothetical protein; EC253486_5240 0.0 Click
425089775..5090365 ipaB/EvcA family protein; EC253486_5241 0.0 Click
435090453..5090584 hypothetical protein; EC253486_5242 0.0 Click
44complement(5090867..5091073) PHAGE_Entero_mEp460: DinI-like protein; EC253486_5243; phage(gi428782337) 2e-32 Click
45complement(5091392..5091505) hypothetical protein; EC253486_5244 0.0 Click
46complement(5091510..5092274) PHAGE_Entero_mEp460: integrase; EC253486_5245; phage(gi428782338) 4e-145 Click
475092408..5092423 attR    ATGCCTGAAAAAACTG 0.0 Click

Region 18, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15261646..5261658 attL    GCGATTTGCCGCA 0.0 Click
25262007..5263272 PROPHAGE_Escher_Sakai: integrase; EC253486_5423; phage(gi15833097) 0.0 Click
3complement(5263388..5264008) PHAGE_Stx2_c_1717: transposase; EC253486_5424; phage(gi209447153) 2e-115 Click
45264262..5264591 putative transposase; EC253486_5425 0.0 Click
55264933..5265280 PHAGE_Stx2_c_1717: transposase; EC253486_5426; phage(gi209447152) 4e-42 Click
65265300..5266748 PHAGE_Stx2_c_1717: transposase; EC253486_5427; phage(gi209447153) 2e-141 Click
7complement(5267602..5268135) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; EC253486_5428; phage(gi148609401) 4e-18 Click
8complement(5268723..5268878) hypothetical protein; EC253486_5429 0.0 Click
95269074..5269277 putative transposase; EC253486_5430 0.0 Click
105269887..5270249 PROPHAGE_Escher_EDL933: putative transposase; EC253486_5431; phage(gi15803516) 1e-66 Click
11complement(5270289..5270636) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; EC253486_5432; phage(gi302393160) 3e-63 Click
125270655..5271662 PHAGE_Escher_TL_2011c: hypothetical protein; EC253486_5433; phage(gi418487095) 0.0 Click
135272015..5272287 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp80; EC253486_5434; phage(gi302393163) 3e-43 Click
145272364..5272579 PHAGE_Stx2_c_II: holin; EC253486_5435; phage(gi302393164) 2e-35 Click
155272584..5273117 PHAGE_Stx2_c_II: endolysin; EC253486_5436; phage(gi302393165) 2e-100 Click
165273391..5273960 PHAGE_Stx2_c_II: putative antirepressor protein Ant; EC253486_5437; phage(gi302393166) 1e-102 Click
175273960..5274109 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; EC253486_5438; phage(gi302861202) 7e-18 Click
185274117..5274581 PHAGE_Stx2_c_II: endopeptidase Rz; EC253486_5439; phage(gi302393167) 5e-69 Click
19complement(5274613..5274906) PHAGE_Stx2_c_II: Bor protein precursor; EC253486_5440; phage(gi302393169) 2e-50 Click
205275146..5275259 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; EC253486_5441; phage(gi20065959) 6e-17 Click
215275315..5276121 PHAGE_Stx2_c_II: terminase, small subunit; EC253486_5442; phage(gi302393081) 1e-150 Click
225276147..5277808 PHAGE_Stx2_c_II: terminase, large subunit; EC253486_5443; phage(gi302393082) 0.0 Click
235277808..5278056 PHAGE_Stx2_c_II: portal protein; EC253486_5444; phage(gi302393083) 1e-30 Click
24complement(5278059..5278445) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; EC253486_5445; phage(gi302393160) 1e-70 Click
25complement(5278607..5278838) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; EC253486_5446; phage(gi302393160) 7e-43 Click
26complement(5278838..5279164) PHAGE_Stx2_c_II: putative transposase; EC253486_5447; phage(gi302393161) 1e-58 Click
275279305..5279317 attR    GCGATTTGCCGCA 0.0 Click