Methylocystis sp. ATCC 49242 whole genome shotgun sequence. [asmbl_id: NC_000000].4625807, GC%: 62.83%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1596943..598400 PROPHAGE_Shewan_MR-1: serine protease; Met49242DRAFT_0583; phage(gi24375430) 2e-74 Click
2598400..598720 CutA1 divalent ion tolerance protein; Met49242DRAFT_0584 0.0 Click
3598811..599782 PHAGE_Erwini_4: putative prohead protease; Met49242DRAFT_0585; phage(gi219681309) 6e-23 Click
4599834..600124 PHAGE_Burkho_BcepMu: gp04; Met49242DRAFT_0586; phage(gi48696914) 2e-13 Click
5600241..600588 hypothetical protein; Met49242DRAFT_0587 0.0 Click
6600728..600803 tRNA 0.0 Click
7600730..600743 attL    CGCAATAGCTCAGC 0.0 Click
8601103..601792 PHAGE_Rhodot_RM378: similar to DNA helicase; Met49242DRAFT_0588; phage(gi30044094) 1e-12 Click
9601889..603427 PROPHAGE_Escher_CFT073: transposase; Met49242DRAFT_0589; phage(gi26248360) 7e-17 Click
10603424..604266 PROPHAGE_Escher_CFT073: transposase/IS protein; Met49242DRAFT_0590; phage(gi26248359) 1e-41 Click
11complement(604381..606990) PHAGE_Lactoc_949: putative exodeoxyribonuclease; Met49242DRAFT_0591; phage(gi327197845) 2e-08 Click
12complement(607607..607968) hypothetical protein; Met49242DRAFT_0592 0.0 Click
13complement(608125..608586) PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_0593; phage(gi23501424) 3e-09 Click
14complement(608731..608946) hypothetical protein; Met49242DRAFT_0594 0.0 Click
15609192..609608 hypothetical protein; Met49242DRAFT_0595 0.0 Click
16complement(609584..610969) PHAGE_Parame_1: Capsid protein; Met49242DRAFT_0596; phage(gi340025832) 2e-06 Click
17625446..625459 attR    CGCAATAGCTCAGC 0.0 Click

Region 2, total : 56 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2579551..2580276) PHAGE_Pseudo_DMS3: putative c repressor; Met49242DRAFT_2482; phage(gi156523050) 9e-20 Click
22580366..2580683 PHAGE_Escher_D108: Ner; Met49242DRAFT_2483; phage(gi281199646) 4e-06 Click
32580801..2580986 hypothetical protein; Met49242DRAFT_2484 0.0 Click
42580987..2581847 PHAGE_Rhodob_RcapMu: ParB-like nuclease; Met49242DRAFT_2485; phage(gi356870851) 2e-09 Click
52581834..2582085 hypothetical protein; Met49242DRAFT_2486 0.0 Click
62582027..2582040 attL    GGCGCGACGCCGAC 0.0 Click
72582088..2584205 PHAGE_Rhodob_RC1: integrase; Met49242DRAFT_2487; phage(gi472339716) 9e-138 Click
82584282..2585070 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2488; phage(gi472339715) 6e-41 Click
92585067..2585708 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2489; phage(gi472339714) 1e-05 Click
102585705..2586109 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2490; phage(gi472339713) 9e-19 Click
112586102..2586503 hypothetical protein; Met49242DRAFT_2491 0.0 Click
122586500..2586763 hypothetical protein; Met49242DRAFT_2492 0.0 Click
132586760..2587548 Chromosomal replication initiator DnaA domain; Met49242DRAFT_2493 0.0 Click
142587541..2588074 PHAGE_Rhodob_RcapMu: host-nuclease inhibitor Gam; Met49242DRAFT_2494; phage(gi356870857) 4e-37 Click
152588074..2588265 hypothetical protein; Met49242DRAFT_2495 0.0 Click
162588262..2588501 hypothetical protein; Met49242DRAFT_2496 0.0 Click
172588498..2588695 hypothetical protein; Met49242DRAFT_2497 0.0 Click
182588698..2589381 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2498; phage(gi472339703) 1e-20 Click
192589408..2589764 hypothetical protein; Met49242DRAFT_2499 0.0 Click
202589777..2590157 response regulator receiver protein; Met49242DRAFT_2500 0.0 Click
212590154..2590369 hypothetical protein; Met49242DRAFT_2501 0.0 Click
222590366..2590914 phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase-like protein; Met49242DRAFT_2502 0.0 Click
232590914..2591090 hypothetical protein; Met49242DRAFT_2503 0.0 Click
242591087..2591308 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2504; phage(gi472339701) 2e-05 Click
252591305..2591727 hypothetical protein; Met49242DRAFT_2505 0.0 Click
262591822..2592316 PHAGE_Synech_S_CRM01: RlpA-like lipoprotein precursor; Met49242DRAFT_2506; phage(gi333798269) 9e-13 Click
272592318..2592698 PHAGE_Entero_phiP27: putative endolysin; Met49242DRAFT_2507; phage(gi18249894) 1e-35 Click
282592695..2592832 hypothetical protein; Met49242DRAFT_2508 0.0 Click
292592836..2592961 hypothetical protein; Met49242DRAFT_2509 0.0 Click
302592999..2593175 major facilitator superfamily MFS_1; Met49242DRAFT_2510 0.0 Click
312593238..2593474 hypothetical protein; Met49242DRAFT_2511 0.0 Click
322593438..2593776 hypothetical protein; Met49242DRAFT_2512 0.0 Click
332593779..2593994 integral membrane sensor signal transduction histidine kinase; Met49242DRAFT_2513 0.0 Click
342593948..2594208 hypothetical protein; Met49242DRAFT_2514 0.0 Click
352594190..2594282 hypothetical protein; Met49242DRAFT_2515 0.0 Click
362594275..2594781 hypothetical protein; Met49242DRAFT_2516 0.0 Click
372594778..2595077 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2517; phage(gi472339695) 5e-20 Click
382595079..2595645 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2518; phage(gi472339694) 5e-25 Click
392595642..2595932 hypothetical protein; Met49242DRAFT_2519 0.0 Click
402595929..2596162 PHAGE_Burkho_KL1: hypothetical protein; Met49242DRAFT_2520; phage(gi399528751) 6e-10 Click
412596159..2597745 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2521; phage(gi472339692) 6e-110 Click
422597739..2599436 PHAGE_Rhodob_RC1: hypothetical protein; Met49242DRAFT_2522; phage(gi472339690) 9e-64 Click
432599438..2600556 PHAGE_Escher_D108: virion morphogenesis; Met49242DRAFT_2523; phage(gi281199673) 3e-37 Click
442600537..2600833 PHAGE_Brucel_Tb: hypothetical protein; Met49242DRAFT_2524; phage(gi418487733) 9e-11 Click
452600974..2601972 PHAGE_Rhodob_RC1: I protein; Met49242DRAFT_2525; phage(gi472339684) 3e-17 Click
462601999..2602373 PHAGE_Pseudo_B3: hypothetical protein B3ORF37; Met49242DRAFT_2526; phage(gi56692606) 2e-11 Click
472602409..2603374 PHAGE_Pseudo_B3: capsid protein; Met49242DRAFT_2527; phage(gi56692607) 1e-63 Click
482603441..2603671 DNA polymerase lambda; Met49242DRAFT_2528 0.0 Click
492603678..2603754 tRNA 0.0 Click
502603896..2604360 protein of unknown function DUF1320; Met49242DRAFT_2529 0.0 Click
512604274..2604287 attR    GGCGCGACGCCGAC 0.0 Click
522604360..2604842 PHAGE_Rhodob_RcapMu: virion morphogenesis protein; Met49242DRAFT_2530; phage(gi356870876) 8e-06 Click
532604839..2605360 hypothetical protein; Met49242DRAFT_2531 0.0 Click
542605357..2605986 PHAGE_Vibrio_VP882: phage baseplate assembly protein V; Met49242DRAFT_2532; phage(gi126010859) 2e-06 Click
552605995..2606222 hypothetical protein; Met49242DRAFT_2533 0.0 Click
562606235..2606630 PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; Met49242DRAFT_2534; phage(gi428782737) 2e-08 Click
572606627..2607571 PROPHAGE_Salmon_Ty2: phage baseplate assembly protein; Met49242DRAFT_2535; phage(gi29143752) 5e-30 Click
582607568..2608173 PHAGE_Ralsto_phiRSA1: phage tail protein gpI; Met49242DRAFT_2536; phage(gi145708096) 5e-07 Click
592608170..2609711 PHAGE_Synech_S_CBS2: PE_PGRS family protein; Met49242DRAFT_2537; phage(gi331027957) 2e-16 Click

Region 3, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13982137..3982152 attL    CGCCGCATTCGCGCGA 0.0 Click
23994774..3996312 PROPHAGE_Escher_CFT073: transposase; Met49242DRAFT_3886; phage(gi26248360) 2e-18 Click
33996302..3996946 PROPHAGE_Escher_CFT073: transposase/IS protein; Met49242DRAFT_3887; phage(gi26248359) 3e-17 Click
43997020..3997209 transposase of ISMdi7, IS21 family (ORF 1); Met49242DRAFT_3888 0.0 Click
5complement(3997210..3998167) PHAGE_Tetras_SI1: hypothetical protein; Met49242DRAFT_3889; phage(gi472342232) 4e-14 Click
6complement(3998176..4002051) PHAGE_Tetras_SI1: hypothetical protein; Met49242DRAFT_3890; phage(gi472342233) 2e-33 Click
7complement(4002080..4002517) PHAGE_Roseob_1: phage cell wall peptidase; Met49242DRAFT_3891; phage(gi331028137) 8e-30 Click
8complement(4002514..4003404) PHAGE_Tetras_SI1: hypothetical protein; Met49242DRAFT_3892; phage(gi472342235) 2e-36 Click
9complement(4003414..4004052) PHAGE_phiJL001: gp83; Met49242DRAFT_3893; phage(gi62327177) 3e-35 Click
10complement(4004074..4004661) PHAGE_Vibrio_vB_VpaS_MAR10: tail tape measure protein; Met49242DRAFT_3894; phage(gi428782128) 5e-12 Click
11complement(4004902..4005258) gene transfer agent (GTA) like protein; Met49242DRAFT_3895 0.0 Click
12complement(4005267..4005677) PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; Met49242DRAFT_3896; phage(gi461474972) 5e-23 Click
13complement(4005698..4006108) PHAGE_Rhodob_RcapNL: gene transfer agent (GTA) orfg8-like protein; Met49242DRAFT_3897; phage(gi461474971) 7e-08 Click
14complement(4006119..4006448) PHAGE_Geobac_E2: putative head-tail adaptor; Met49242DRAFT_3898; phage(gi148747735) 2e-08 Click
15complement(4006445..4007020) PHAGE_Rhodob_RcapNL: hypothetical protein; Met49242DRAFT_3899; phage(gi461474967) 5e-12 Click
16complement(4007091..4008317) PHAGE_Salmon_ST64B: Major capsid protein precursor; Met49242DRAFT_3900; phage(gi23505451) 9e-76 Click
17complement(4008458..4009081) PHAGE_Tetras_SI1: phage prohead protease; Met49242DRAFT_3901; phage(gi472342256) 1e-26 Click
18complement(4009081..4009257) hypothetical protein; Met49242DRAFT_3902 0.0 Click
19complement(4009257..4009442) hypothetical protein; Met49242DRAFT_3903 0.0 Click
20complement(4009439..4010182) PHAGE_Salmon_ST64B: Portal Protein; Met49242DRAFT_3904; phage(gi23505449) 2e-17 Click
21complement(4010195..4010647) PHAGE_Xantho_CP1: putative head portal protein; Met49242DRAFT_3905; phage(gi431811001) 6e-12 Click
22complement(4010674..4011993) PHAGE_Strept_6: terminase large subunit; Met49242DRAFT_3906; phage(gi93007440) 2e-63 Click
234017861..4017876 attR    CGCCGCATTCGCGCGA 0.0 Click

Region 4, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14108103..4108116 attL    TGTCGCGGCGGCGG 0.0 Click
2complement(4108162..4108989) PHAGE_Entero_Sf6: putative transposase OrfB; Met49242DRAFT_3998; phage(gi41057343) 4e-28 Click
3complement(4108986..4109294) transposase IS3/IS911 family protein; Met49242DRAFT_3999 0.0 Click
44109494..4110069 hypothetical protein; Met49242DRAFT_4000 0.0 Click
5complement(4110209..4110412) zinc-binding alcohol dehydrogenase; Met49242DRAFT_4001 0.0 Click
6complement(4110556..4110810) indoleamine-pyrrole 2,3-dioxygenase; Met49242DRAFT_4002 0.0 Click
7complement(4110774..4111673) indoleamine 23-dioxygenase; Met49242DRAFT_4003 0.0 Click
8complement(4111675..4112829) hypothetical protein; Met49242DRAFT_4004 0.0 Click
94113212..4113532 PHAGE_Europe_virus: hypothetical protein; Met49242DRAFT_4005; phage(gi388260157) 8e-06 Click
104113730..4114236 Usg family protein; Met49242DRAFT_4006 0.0 Click
11complement(4114401..4115117) PHAGE_Caulob_CcrMagneto: putative ArdC-like antirestriction protein; Met49242DRAFT_4007; phage(gi414088708) 3e-30 Click
124115335..4115532 monocyte to macrophage differentiation-associated; Met49242DRAFT_4008 0.0 Click
13complement(4115675..4116409) PHAGE_Burkho_AH2: excinuclease; Met49242DRAFT_4009; phage(gi399529072) 2e-08 Click
14complement(4116402..4117262) PHAGE_Burkho_AH2: hypothetical protein; Met49242DRAFT_4010; phage(gi399529073) 2e-89 Click
15complement(4117259..4118404) PHAGE_Burkho_AH2: cytosine methyltransferase; Met49242DRAFT_4011; phage(gi399529074) 4e-144 Click
164118510..4118679 hypothetical protein; Met49242DRAFT_4012 0.0 Click
174118683..4119096 Fels-2 prophage protein; Met49242DRAFT_4013 0.0 Click
184119093..4119299 PHAGE_Entero_PsP3: gp8; Met49242DRAFT_4014; phage(gi41057360) 1e-05 Click
194119305..4119532 hypothetical protein; Met49242DRAFT_4015 0.0 Click
204119534..4120550 PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; Met49242DRAFT_4016; phage(gi428782753) 3e-29 Click
214120547..4120846 hypothetical protein; Met49242DRAFT_4017 0.0 Click
224120843..4120983 major facilitator transporter; Met49242DRAFT_4018 0.0 Click
234120988..4121224 PHAGE_Sinorh_PBC5: hypothetical protein PBC5p55; Met49242DRAFT_4019; phage(gi18071259) 2e-20 Click
244121306..4121593 hypothetical protein; Met49242DRAFT_4020 0.0 Click
254121752..4122105 Endoribonuclease L-PSP; Met49242DRAFT_4021 0.0 Click
26complement(4122089..4122871) PHAGE_Cafete_BV_PW1: putative ubiquitin-activating enzyme E1; Met49242DRAFT_4022; phage(gi310831425) 1e-07 Click
274122969..4123538 PHAGE_Pseudo_2: predicted phage capsid scaffolding protein; Met49242DRAFT_4023; phage(gi281306688) 2e-05 Click
28complement(4123488..4124576) glycosyl transferase group 1; Met49242DRAFT_4024 0.0 Click
29complement(4124576..4125445) metallophosphoesterase; Met49242DRAFT_4025 0.0 Click
304125615..4126232 PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; Met49242DRAFT_4026; phage(gi397912660) 5e-07 Click
314127392..4127405 attR    TGTCGCGGCGGCGG 0.0 Click

Region 5, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14404527..4404850 PROPHAGE_Brucel_1330: IS5 family transposase orfA; Met49242DRAFT_4308; phage(gi23501422) 5e-05 Click
24404885..4405136 transposase IS4 family protein; Met49242DRAFT_4309 0.0 Click
3complement(4405316..4405573) PROPHAGE_Shewan_MR-1: ISSod6, transposase; Met49242DRAFT_4310; phage(gi24374783) 4e-14 Click
4complement(4405699..4406076) PROPHAGE_Shewan_MR-1: ISSod6, transposase; Met49242DRAFT_4311; phage(gi24374783) 2e-24 Click
5complement(4406462..4406761) PROPHAGE_Escher_CFT073: transposase/IS protein; Met49242DRAFT_4312; phage(gi26248359) 1e-16 Click
64406846..4406989 putative insertion sequence transposase protein; Met49242DRAFT_4313 0.0 Click
7complement(4406990..4407168) hypothetical protein; Met49242DRAFT_4314 0.0 Click
84407736..4408005 PHAGE_Azospi_Cd: hypothetical protein APCd_gp10; Met49242DRAFT_4315; phage(gi168495113) 2e-15 Click
9complement(4408074..4408562) hypothetical protein; Met49242DRAFT_4316 0.0 Click
104409490..4410920 PHAGE_Aeromo_65: hypothetical protein; Met49242DRAFT_4317; phage(gi326536444) 3e-05 Click
114411412..4412521 PROPHAGE_Shewan_MR-1: IS110 family transposase; Met49242DRAFT_4318; phage(gi24375433) 2e-13 Click
124412871..4413305 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; Met49242DRAFT_4319; phage(gi17546153) 4e-09 Click
134413302..4413658 PHAGE_Stx2_c_1717: transposase; Met49242DRAFT_4320; phage(gi209447152) 1e-17 Click
144414095..4414745 PHAGE_Stx2_c_1717: transposase; Met49242DRAFT_4321; phage(gi209447153) 3e-46 Click
15complement(4415465..4416724) PHAGE_Haemop_Aaphi23: putative terminase large subunit TerL; Met49242DRAFT_4322; phage(gi31544028) 5e-58 Click
16complement(4416912..4417388) hypothetical protein; Met49242DRAFT_4323 0.0 Click
17complement(4417401..4418114) PHAGE_Lactob_Lj771: putative adenine methyltransferase; Met49242DRAFT_4324; phage(gi163932178) 5e-17 Click
18complement(4418111..4418932) PHAGE_Psychr_pOW20_A: DNA methylase; Met49242DRAFT_4325; phage(gi472339820) 5e-39 Click
194419068..4419973 integrase catalytic subunit; Met49242DRAFT_4326 0.0 Click
20complement(4420898..4421092) putative transposase; Met49242DRAFT_4327 0.0 Click
214421536..4422048 hypothetical protein; Met49242DRAFT_4328 0.0 Click
22complement(4422022..4422705) Integrase catalytic region; Met49242DRAFT_4329 0.0 Click

Region 6, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14509215..4509248 attL    TTCATTCGATTCAACATCTTTCAGGACGGACACT 0.0 Click
2complement(4512944..4513252) PROPHAGE_Xantho_306: transposase; Met49242DRAFT_4439; phage(gi21243165) 7e-26 Click
34513405..4513610 hypothetical protein; Met49242DRAFT_4440 0.0 Click
44514050..4514853 aminoglycoside/hydroxyurea antibiotic resistance kinase; Met49242DRAFT_4441 0.0 Click
54515840..4516151 hypothetical protein; Met49242DRAFT_4442 0.0 Click
64516153..4516323 hypothetical protein; Met49242DRAFT_4443 0.0 Click
74516487..4516500 attL    TAGAGGGTGTTATG 0.0 Click
84516534..4517049 hypothetical protein; Met49242DRAFT_4444 0.0 Click
94517092..4517103 attL    ACCGGCGAAAAG 0.0 Click
10complement(4517285..4517587) PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4445; phage(gi21231089) 2e-13 Click
11complement(4517662..4518005) PROPHAGE_Brucel_1330: IS5 family transposase orfA; Met49242DRAFT_4446; phage(gi23501422) 1e-06 Click
12complement(4518006..4518176) hypothetical protein; Met49242DRAFT_4447 0.0 Click
13complement(4518166..4518465) hypothetical protein; Met49242DRAFT_4448 0.0 Click
14complement(4518462..4518740) hypothetical protein; Met49242DRAFT_4449 0.0 Click
15complement(4518737..4518955) hypothetical protein; Met49242DRAFT_4450 0.0 Click
16complement(4518948..4519073) hypothetical protein; Met49242DRAFT_4451 0.0 Click
174519205..4519459 PHAGE_Azospi_Cd: hypothetical protein APCd_gp14; Met49242DRAFT_4452; phage(gi168495117) 5e-06 Click
18complement(4519577..4519876) PHAGE_Bacill_SPBc2: putative antirepressor; Met49242DRAFT_4453; phage(gi9630225) 4e-07 Click
19complement(4520198..4520641) PHAGE_Acinet_Acj9: PseT polynucleotide 5'-kinase and 3'-phosphatase; Met49242DRAFT_4454; phage(gi311993492) 5e-14 Click
20complement(4520739..4521107) PHAGE_Entero_Enc34: prohead protease; Met49242DRAFT_4455; phage(gi422936746) 6e-06 Click
21complement(4521126..4522148) hypothetical protein; Met49242DRAFT_4456 0.0 Click
22complement(4522180..4522360) PROPHAGE_Xantho_33913: IS1477 transposase; Met49242DRAFT_4457; phage(gi21230912) 1e-09 Click
23complement(4522765..4523358) hypothetical protein; Met49242DRAFT_4458 0.0 Click
244523393..4523662 hypothetical protein; Met49242DRAFT_4459 0.0 Click
254523892..4524614 nuclease (SNase domain-containing protein); Met49242DRAFT_4460 0.0 Click
264524709..4524924 SlyX family protein; Met49242DRAFT_4461 0.0 Click
274525173..4525601 hypothetical protein; Met49242DRAFT_4462 0.0 Click
28complement(4525549..4525881) hypothetical protein; Met49242DRAFT_4463 0.0 Click
294526228..4526719 Integrase catalytic region; Met49242DRAFT_4464 0.0 Click
304526688..4527299 putative transposase; Met49242DRAFT_4465 0.0 Click
314527296..4527868 PROPHAGE_Escher_CFT073: transposase/IS protein; Met49242DRAFT_4466; phage(gi26248359) 3e-15 Click
324528026..4528037 attR    ACCGGCGAAAAG 0.0 Click
334528574..4529761 PHAGE_Spirop_R8A2B: putative transposase; Met49242DRAFT_4467; phage(gi9626114) 7e-08 Click
344541770..4541783 attR    TAGAGGGTGTTATG 0.0 Click
354544014..4544047 attR    TTCATTCGATTCAACATCTTTCAGGACGGACACT 0.0 Click

Region 7, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14549488..4549567 attL    GCAAATCCTCCGGGCGCAGCCGCCCTGCATCGTCGCGATGGAAGCCTGCGCGACGAGCCATTACTGGGGCCGAATGGGAG 0.0 Click
2complement(4563785..4564716) PROPHAGE_Escher_MG1655: protease, ATP-dependent zinc-metallo; Met49242DRAFT_4518; phage(gi16131068) 1e-77 Click
3complement(4564717..4565228) PHAGE_Macaci_1: large tegument protein; Met49242DRAFT_4519; phage(gi30984464) 2e-06 Click
4complement(4566017..4566265) hypothetical protein; Met49242DRAFT_4520 0.0 Click
5complement(4566402..4566641) PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4521; phage(gi21231089) 1e-06 Click
64566642..4566924 hypothetical protein; Met49242DRAFT_4522 0.0 Click
74566945..4568565 PHAGE_Salmon_ST64B: tail protein; Met49242DRAFT_4523; phage(gi23505460) 6e-25 Click
84568634..4568849 PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4524; phage(gi23501424) 5e-07 Click
9complement(4568824..4569750) PROPHAGE_Xantho_33913: IS1477 transposase; Met49242DRAFT_4525; phage(gi77747809) 1e-58 Click
10complement(4569744..4570100) PROPHAGE_Xantho_33913: IS1404 transposase; Met49242DRAFT_4526; phage(gi21232568) 4e-24 Click
11complement(4570473..4570585) transposase of ISMdi7, IS21 family (ORF 1); Met49242DRAFT_4527 0.0 Click
124570747..4571115 hypothetical protein; Met49242DRAFT_4528 0.0 Click
134571243..4571860 protein of unknown function DUF262; Met49242DRAFT_4529 0.0 Click
144571917..4572241 PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4530; phage(gi23501424) 9e-06 Click
154572242..4572458 PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4531; phage(gi21231089) 1e-07 Click
164578985..4579064 attR    GCAAATCCTCCGGGCGCAGCCGCCCTGCATCGTCGCGATGGAAGCCTGCGCGACGAGCCATTACTGGGGCCGAATGGGAG 0.0 Click

Region 8, total : 93 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4573329..4573721) PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4534; phage(gi23501424) 1e-09 Click
24573848..4574003 hypothetical protein; Met49242DRAFT_4535 0.0 Click
3complement(4574004..4574250) hypothetical protein; Met49242DRAFT_4536 0.0 Click
44574353..4574679 hypothetical protein; Met49242DRAFT_4537 0.0 Click
54574814..4575539 glycosyl transferase group 1; Met49242DRAFT_4538 0.0 Click
64575550..4575750 transposase; Met49242DRAFT_4539 0.0 Click
7complement(4575751..4576044) PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4540; phage(gi23501424) 1e-05 Click
84576082..4576094 attL    ACACCCTCTAGGA 0.0 Click
94576082..4576094 attL    ACACCCTCTAGGA 0.0 Click
10complement(4576205..4576597) PHAGE_Rhodoc_RGL3: antirestriction protein; Met49242DRAFT_4541; phage(gi372449791) 1e-08 Click
11complement(4576723..4577160) hypothetical protein; Met49242DRAFT_4542 0.0 Click
12complement(4577442..4577743) PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4543; phage(gi23501424) 1e-05 Click
13complement(4577762..4578070) WxcM-like domain-containing protein; Met49242DRAFT_4544 0.0 Click
144578854..4579094 PROPHAGE_Shewan_MR-1: IS110 family transposase; Met49242DRAFT_4545; phage(gi24375433) 4e-10 Click
15complement(4579095..4579373) PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4546; phage(gi23501424) 3e-09 Click
164579553..4580329 hypothetical protein; Met49242DRAFT_4547 0.0 Click
17complement(4580345..4580736) PROPHAGE_Xantho_33913: IS1477 transposase; Met49242DRAFT_4548; phage(gi77747809) 4e-24 Click
184580980..4582338 PROPHAGE_Escher_Sakai: ATP-dependent metalloprotease; Met49242DRAFT_4549; phage(gi15833311) 3e-143 Click
194582339..4582489 integrase catalytic subunit; Met49242DRAFT_4550 0.0 Click
204582489..4583220 PHAGE_Strept_M102: hypothetical protein M102_gp23; Met49242DRAFT_4551; phage(gi242345594) 7e-07 Click
21complement(4583609..4583915) PROPHAGE_Escher_CFT073: transposase/IS protein; Met49242DRAFT_4552; phage(gi26248359) 9e-18 Click
224583916..4584608 protein of unknown function DUF1403; Met49242DRAFT_4553 0.0 Click
234584605..4585333 chromosome segregation and condensation protein, ScpB; Met49242DRAFT_4554 0.0 Click
24complement(4585416..4586904) PHAGE_Salmon_ST64B: tail protein; Met49242DRAFT_4555; phage(gi23505460) 2e-26 Click
25complement(4587041..4587142) hypothetical protein; Met49242DRAFT_4556 0.0 Click
26complement(4587139..4587462) PROPHAGE_Xantho_33913: IS1404 transposase; Met49242DRAFT_4557; phage(gi21232569) 7e-08 Click
27complement(4587495..4587773) PROPHAGE_Ralsto_GMI1000: isrso12-transposase orfa protein; Met49242DRAFT_4558; phage(gi17546157) 2e-14 Click
28complement(4587792..4587983) hypothetical protein; Met49242DRAFT_4559 0.0 Click
294588091..4588104 attL    AGGGTGTTATGCAC 0.0 Click
30complement(4588097..4588349) PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4560; phage(gi21231089) 8e-07 Click
314588350..4588973 SMF family protein; Met49242DRAFT_4561 0.0 Click
32complement(4588977..4589231) hypothetical protein; Met49242DRAFT_4562 0.0 Click
33complement(4589585..4589768) hypothetical protein; Met49242DRAFT_4563 0.0 Click
34complement(4589769..4589870) transposase IS3/IS911 family protein; Met49242DRAFT_4564 0.0 Click
354589940..4589951 attL    AAGCGCGGTCTG 0.0 Click
364590323..4590754 hypothetical protein; Met49242DRAFT_4565 0.0 Click
37complement(4590770..4591165) PROPHAGE_Xantho_33913: IS1477 transposase; Met49242DRAFT_4566; phage(gi77747809) 2e-23 Click
38complement(4591166..4591580) PROPHAGE_Escher_CFT073: transposase; Met49242DRAFT_4567; phage(gi26248360) 2e-05 Click
394591676..4591707 attL    TTCAGTGGTACACTTTGCCGCCGCTGTTCATA 0.0 Click
40complement(4591841..4592206) hypothetical protein; Met49242DRAFT_4568 0.0 Click
414592365..4592516 transposase; Met49242DRAFT_4569 0.0 Click
42complement(4592517..4592645) transposase; Met49242DRAFT_4570 0.0 Click
43complement(4592767..4593069) hypothetical protein; Met49242DRAFT_4571 0.0 Click
44complement(4593424..4593792) integrase family protein; Met49242DRAFT_4572 0.0 Click
454593840..4594041 PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4573; phage(gi21231089) 3e-07 Click
464594136..4594351 PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4574; phage(gi23501424) 5e-07 Click
47complement(4594326..4595096) PROPHAGE_Xantho_33913: IS1477 transposase; Met49242DRAFT_4575; phage(gi77747809) 3e-47 Click
484595097..4595241 PROPHAGE_Shewan_MR-1: ISSod6, transposase; Met49242DRAFT_4576; phage(gi24374783) 1e-07 Click
494595259..4595272 attL    AGGGTGTTATGCAC 0.0 Click
50complement(4595421..4595672) transposase IS4 family protein; Met49242DRAFT_4577 0.0 Click
51complement(4595707..4596030) PROPHAGE_Brucel_1330: IS5 family transposase orfA; Met49242DRAFT_4578; phage(gi23501422) 5e-05 Click
52complement(4596567..4597569) PHAGE_Stx2_c_1717: transposase; Met49242DRAFT_4579; phage(gi209447153) 1e-80 Click
534597570..4597824 AAA ATPase; Met49242DRAFT_4580 0.0 Click
544597968..4598117 hypothetical protein; Met49242DRAFT_4581 0.0 Click
554598121..4598627 hypothetical protein; Met49242DRAFT_4582 0.0 Click
56complement(4598764..4599530) PROPHAGE_Shewan_MR-1: IS110 family transposase; Met49242DRAFT_4583; phage(gi24375433) 1e-35 Click
574599672..4599860 transposase IS116/IS110/IS902 family protein; Met49242DRAFT_4584 0.0 Click
584599931..4600477 PHAGE_Burkho_phiE125: ISBt3 transposase subunit protein; Met49242DRAFT_4585; phage(gi17975200) 1e-30 Click
594600512..4600526 attL    CTAGAGGGTGTTATG 0.0 Click
604600560..4600793 hypothetical protein; Met49242DRAFT_4586 0.0 Click
614600867..4601061 transposase of ISMdi7, IS21 family (ORF 1); Met49242DRAFT_4587 0.0 Click
62complement(4601062..4601337) PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4588; phage(gi23501424) 1e-05 Click
634602010..4602186 transposase of ISMdi7, IS21 family (ORF 1); Met49242DRAFT_4589 0.0 Click
644602187..4602409 PROPHAGE_Brucel_1330: IS711, transposase orfB; Met49242DRAFT_4590; phage(gi23501420) 3e-10 Click
65complement(4602754..4602975) hypothetical protein; Met49242DRAFT_4591 0.0 Click
664603034..4603272 PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4592; phage(gi23501424) 9e-05 Click
67complement(4604028..4604294) PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4593; phage(gi21231089) 1e-10 Click
684604672..4605265 hypothetical protein; Met49242DRAFT_4594 0.0 Click
69complement(4605393..4606232) ATPase; Met49242DRAFT_4595 0.0 Click
704606516..4607199 PROPHAGE_Escher_CFT073: transposase/IS protein; Met49242DRAFT_4596; phage(gi26248359) 1e-31 Click
714607200..4607403 PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4597; phage(gi21231089) 1e-07 Click
724607507..4607917 hypothetical protein; Met49242DRAFT_4598 0.0 Click
73complement(4607937..4608081) PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4599; phage(gi21231089) 3e-05 Click
744608322..4608949 PROPHAGE_Escher_CFT073: transposase; Met49242DRAFT_4600; phage(gi26248360) 1e-11 Click
754608950..4609239 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; Met49242DRAFT_4601; phage(gi17546158) 6e-12 Click
764609448..4609462 attR    CTAGAGGGTGTTATG 0.0 Click
774609452..4609465 attR    AGGGTGTTATGCAC 0.0 Click
78complement(4609458..4609769) PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4602; phage(gi21231089) 6e-10 Click
794609770..4610454 integrase catalytic region; Met49242DRAFT_4603 0.0 Click
804610451..4610585 hypothetical protein; Met49242DRAFT_4604 0.0 Click
81complement(4610586..4611028) transposase of ISMdi7, IS21 family (ORF 1); Met49242DRAFT_4605 0.0 Click
824611124..4611155 attR    TTCAGTGGTACACTTTGCCGCCGCTGTTCATA 0.0 Click
83complement(4611223..4611383) quinoprotein glucose dehydrogenase; Met49242DRAFT_4606 0.0 Click
844611384..4611607 PROPHAGE_Xantho_33913: ISxac3 transposase; Met49242DRAFT_4607; phage(gi21231086) 7e-19 Click
854611725..4612160 PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4608; phage(gi23501424) 6e-06 Click
86complement(4612161..4612417) PROPHAGE_Brucel_1330: ISBm1, transposase orfA; Met49242DRAFT_4609; phage(gi23501424) 2e-05 Click
874612645..4612656 attR    AAGCGCGGTCTG 0.0 Click
88complement(4613524..4613646) hypothetical protein; Met49242DRAFT_4610 0.0 Click
894613647..4613812 PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4611; phage(gi21231089) 5e-06 Click
904614036..4614230 PROPHAGE_Xantho_306: ISxac2 transposase; Met49242DRAFT_4612; phage(gi21244663) 3e-11 Click
91complement(4614342..4614544) PROPHAGE_Xantho_33913: IS1477 transposase; Met49242DRAFT_4613; phage(gi77747809) 2e-09 Click
92complement(4614538..4614894) PROPHAGE_Xantho_33913: IS1404 transposase; Met49242DRAFT_4614; phage(gi21232568) 3e-24 Click
93complement(4615024..4615174) hypothetical protein; Met49242DRAFT_4615 0.0 Click
94complement(4615193..4615387) hypothetical protein; Met49242DRAFT_4616 0.0 Click
95complement(4615447..4615703) PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4617; phage(gi21231089) 3e-09 Click
964615801..4616334 PROPHAGE_Shewan_MR-1: IS110 family transposase; Met49242DRAFT_4618; phage(gi24375433) 2e-10 Click
97complement(4616394..4617038) transposase of ISMdi7, IS21 family (ORF 1); Met49242DRAFT_4619 0.0 Click
98complement(4617039..4617523) hypothetical protein; Met49242DRAFT_4620 0.0 Click
994617730..4618349 hypothetical protein; Met49242DRAFT_4621 0.0 Click
1004618350..4618641 PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4622; phage(gi21231089) 1e-11 Click
1014618666..4618679 attR    AGGGTGTTATGCAC 0.0 Click
102complement(4618672..4618990) PROPHAGE_Xantho_33913: IS1480 transposase; Met49242DRAFT_4623; phage(gi21231089) 6e-10 Click
103complement(4618991..4619155) hypothetical protein; Met49242DRAFT_4624 0.0 Click
1044619193..4619205 attR    ACACCCTCTAGGA 0.0 Click
1054619427..4619628 transposase; Met49242DRAFT_4625 0.0 Click
106complement(4620262..4620653) integrase catalytic subunit; Met49242DRAFT_4626 0.0 Click
1074623656..4623668 attR    ACACCCTCTAGGA 0.0 Click