Salmonella enterica subsp. enterica serovar Montevideo str. 4441 H [asmbl_id: NC_000000].175716, GC%: 52.00%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
159502..59518 attL    ACCCCTTGTTTTATTTG 0.0 Click
2complement(65962..67203) PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; SEEM41H_19018; phage(gi16130540) 0.0 Click
3complement(67570..68595) PHAGE_Salmon_RE_2010_NC_019488: integrase; SEEM41H_19023; phage(gi418489683) 0.0 Click
4complement(68599..69231) PHAGE_Salmon_RE_2010_NC_019488: repressor; SEEM41H_19028; phage(gi418489684) 2e-24 Click
569348..69587 PHAGE_Salmon_RE_2010_NC_019488: excisionase; SEEM41H_19033; phage(gi418489685) 2e-22 Click
669623..70132 PHAGE_Salmon_RE_2010_NC_019488: regulatory protein; SEEM41H_19038; phage(gi418489686) 3e-84 Click
770140..70373 PHAGE_Salmon_RE_2010_NC_019488: cell division blocking protein; SEEM41H_19043; phage(gi418489687) 1e-13 Click
8complement(70321..70779) hypothetical protein; SEEM41H_19048 0.0 Click
970999..71340 PHAGE_Salmon_RE_2010_NC_019488: hypothetical protein; SEEM41H_19053; phage(gi418489688) 4e-51 Click
1071408..71641 PHAGE_Salmon_RE_2010_NC_019488: hypothetical protein; SEEM41H_19058; phage(gi418489689) 4e-27 Click
1171641..71868 PHAGE_Salmon_RE_2010_NC_019488: zinc-finger containing protein; SEEM41H_19063; phage(gi418489690) 7e-35 Click
1271865..72794 PHAGE_Salmon_RE_2010_NC_019488: DNA adenine methyltransferase; SEEM41H_19068; phage(gi418489691) 4e-119 Click
1372905..73546 PHAGE_Entero_HK106_NC_019768: hypothetical protein; SEEM41H_19073; phage(gi428783308) 4e-38 Click
1473543..75900 PHAGE_Salmon_RE_2010_NC_019488: replication protein; SEEM41H_19078; phage(gi418489692) 0.0 Click
1576056..76244 PHAGE_Salmon_RE_2010_NC_019488: hypothetical protein; SEEM41H_19083; phage(gi418489693) 1e-24 Click
1676256..76489 PHAGE_Salmon_RE_2010_NC_019488: SOS induction modulator; SEEM41H_19088; phage(gi418489694) 3e-34 Click
1776585..76803 hypothetical protein; SEEM41H_19093 0.0 Click
1876813..77877 hypothetical protein; SEEM41H_19098 0.0 Click
1977874..78938 hypothetical protein; SEEM41H_19103 0.0 Click
2078958..79653 hypothetical protein; SEEM41H_19108 0.0 Click
21complement(79701..80738) PHAGE_Salmon_RE_2010_NC_019488: capsid packaging protein; SEEM41H_19113; phage(gi418489696) 1e-171 Click
22complement(80738..82504) PHAGE_Salmon_RE_2010_NC_019488: terminase ATPase subunit; SEEM41H_19118; phage(gi418489697) 0.0 Click
2382647..83480 PHAGE_Salmon_RE_2010_NC_019488: capsid scaffolding protein; SEEM41H_19123; phage(gi418489698) 1e-147 Click
2483497..84564 PHAGE_Salmon_RE_2010_NC_019488: major capsid protein; SEEM41H_19128; phage(gi418489699) 0.0 Click
2584568..85218 PHAGE_Salmon_RE_2010_NC_019488: terminase endonuclease subunit; SEEM41H_19133; phage(gi418489700) 5e-117 Click
2685312..85776 PHAGE_Salmon_RE_2010_NC_019488: head completion-stabilization protein; SEEM41H_19138; phage(gi418489701) 1e-81 Click
2785776..85979 PHAGE_Salmon_RE_2010_NC_019488: tail component protein; SEEM41H_19143; phage(gi418489702) 3e-35 Click
2885983..86198 PHAGE_Salmon_RE_2010_NC_019488: lysis protein S; SEEM41H_19148; phage(gi418489703) 3e-35 Click
2986179..86688 PHAGE_Salmon_RE_2010_NC_019488: lysozyme; SEEM41H_19153; phage(gi418489704) 2e-94 Click
3086693..87070 hypothetical protein; SEEM41H_19158 0.0 Click
3187070..87495 PHAGE_Salmon_RE_2010_NC_019488: lysozyme subunit B; SEEM41H_19163; phage(gi418489705) 2e-63 Click
3287512..87628 PHAGE_Entero_Fels_2_NC_010463: P2 LysC-like protein; SEEM41H_19168; phage(gi169936037) 3e-15 Click
3387591..88022 PHAGE_Salmon_RE_2010_NC_019488: tail protein; SEEM41H_19173; phage(gi418489706) 1e-73 Click
3488015..88461 PHAGE_Salmon_RE_2010_NC_019488: tail completion protein; SEEM41H_19178; phage(gi418489707) 3e-67 Click
35complement(88463..89314) PHAGE_Salmon_RE_2010_NC_019488: hypothetical protein; SEEM41H_19183; phage(gi418489708) 2e-94 Click
3689392..89970 PHAGE_Salmon_RE_2010_NC_019488: baseplate assembly protein V; SEEM41H_19188; phage(gi418489709) 3e-104 Click
3789967..90326 PHAGE_Salmon_RE_2010_NC_019488: baseplate wedge subunit; SEEM41H_19193; phage(gi418489710) 1e-53 Click
3890313..91221 PHAGE_Salmon_RE_2010_NC_019488: baseplate assembly protein J; SEEM41H_19198; phage(gi418489711) 5e-162 Click
3991214..91819 PHAGE_Salmon_RE_2010_NC_019488: tail protein I; SEEM41H_19203; phage(gi418489712) 4e-114 Click
4091816..93621 PHAGE_Salmon_RE_2010_NC_019488: tail fiber protein; SEEM41H_19208; phage(gi418489713) 0.0 Click
4193621..94196 PHAGE_Salmon_RE_2010_NC_019488: tail fiber assembly protein; SEEM41H_19213; phage(gi418489714) 9e-109 Click
42complement(94789..95022) PHAGE_Salmon_RE_2010_NC_019488: tail fiber protein; SEEM41H_19218; phage(gi418489717) 2e-20 Click
4395071..95295 PHAGE_Salmon_RE_2010_NC_019488: DNA invertase; SEEM41H_19223; phage(gi418489718) 3e-35 Click
4495398..96570 PHAGE_Salmon_RE_2010_NC_019488: major tail sheath protein; SEEM41H_19228; phage(gi418489720) 0.0 Click
4596580..97095 PHAGE_Salmon_RE_2010_NC_019488: major tail tube protein; SEEM41H_19233; phage(gi418489721) 4e-94 Click
4697150..97452 PHAGE_Salmon_RE_2010_NC_019488: tail protein E; SEEM41H_19238; phage(gi418489722) 7e-48 Click
4797467..97586 PHAGE_Salmon_RE_2010_NC_019488: tail protein E'; SEEM41H_19243; phage(gi418489723) 4e-16 Click
4897579..100386 PHAGE_Salmon_RE_2010_NC_019488: tail tape measure protein; SEEM41H_19248; phage(gi418489724) 0.0 Click
49100383..100868 PHAGE_Salmon_RE_2010_NC_019488: tail protein; SEEM41H_19253; phage(gi418489725) 6e-83 Click
50100865..101965 PHAGE_Salmon_RE_2010_NC_019488: gene D protein; SEEM41H_19258; phage(gi418489726) 0.0 Click
51102034..102252 PHAGE_Salmon_RE_2010_NC_019488: OGR regulator of late gene transcription; SEEM41H_19263; phage(gi418489727) 7e-40 Click
52102355..102371 attR    ACCCCTTGTTTTATTTG 0.0 Click

Region 2, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1131728..131763 attL    GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC 0.0 Click
2complement(131887..132105) PHAGE_Entero_PsP3_NC_005340: Pag; SEEM41H_19363; phage(gi41057379) 4e-40 Click
3complement(132181..133350) PHAGE_Entero_PsP3_NC_005340: gp26; SEEM41H_19368; phage(gi41057378) 0.0 Click
4complement(133347..133832) PHAGE_Entero_PsP3_NC_005340: gp25; SEEM41H_19373; phage(gi41057377) 1e-87 Click
5complement(133847..136291) PHAGE_Entero_PsP3_NC_005340: gp24; SEEM41H_19378; phage(gi41057376) 0.0 Click
6complement(136284..136403) PHAGE_Entero_PsP3_NC_005340: gp23.5; SEEM41H_19383; phage(gi41057394) 2e-17 Click
7complement(136436..136771) PHAGE_Entero_PsP3_NC_005340: gp23; SEEM41H_19388; phage(gi41057375) 5e-54 Click
8complement(136834..137352) PHAGE_Entero_PsP3_NC_005340: gp22; SEEM41H_19393; phage(gi41057374) 3e-95 Click
9complement(137368..138546) PHAGE_Entero_PsP3_NC_005340: gp21; SEEM41H_19398; phage(gi41057373) 0.0 Click
10complement(138681..139229) PHAGE_Entero_PsP3_NC_005340: gp20; SEEM41H_19403; phage(gi41057372) 3e-101 Click
11complement(139242..141218) PHAGE_Entero_PsP3_NC_005340: gp19; SEEM41H_19408; phage(gi41057371) 0.0 Click
12complement(141229..141759) PHAGE_Entero_PsP3_NC_005340: gp18; SEEM41H_19413; phage(gi41057370) 2e-101 Click
13complement(141752..142660) PHAGE_Entero_PsP3_NC_005340: gp17; SEEM41H_19418; phage(gi41057369) 3e-163 Click
14complement(142667..143014) PHAGE_Entero_PsP3_NC_005340: gp16; SEEM41H_19423; phage(gi41057368) 2e-57 Click
15complement(143011..143652) PHAGE_Entero_PsP3_NC_005340: gp15; SEEM41H_19428; phage(gi41057367) 2e-116 Click
16complement(143721..144170) PHAGE_Entero_PsP3_NC_005340: gp14; SEEM41H_19433; phage(gi41057366) 6e-75 Click
17complement(144163..144630) PHAGE_Entero_PsP3_NC_005340: gp13; SEEM41H_19438; phage(gi41057365) 1e-86 Click
18complement(144593..144751) PHAGE_Entero_PsP3_NC_005340: gp12; SEEM41H_19443; phage(gi41057364) 2e-23 Click
19complement(144738..145151) PHAGE_Entero_PsP3_NC_005340: gp11; SEEM41H_19448; phage(gi41057363) 7e-67 Click
20complement(145148..145645) PHAGE_Entero_PsP3_NC_005340: gp10; SEEM41H_19453; phage(gi41057362) 9e-92 Click
21complement(145632..145928) PHAGE_Entero_PsP3_NC_005340: gp9; SEEM41H_19458; phage(gi41057361) 1e-49 Click
22complement(145932..146120) PHAGE_Entero_PsP3_NC_005340: gp8; SEEM41H_19463; phage(gi41057360) 4e-30 Click
23complement(146135..146641) PHAGE_Entero_PsP3_NC_005340: gp7; SEEM41H_19468; phage(gi41057359) 3e-93 Click
24complement(146735..147484) PHAGE_Entero_PsP3_NC_005340: gp6; SEEM41H_19473; phage(gi41057358) 1e-135 Click
25complement(147488..148555) PHAGE_Entero_PsP3_NC_005340: gp5; SEEM41H_19478; phage(gi41057357) 0.0 Click
26complement(148632..149486) PHAGE_Entero_PsP3_NC_005340: gp4; SEEM41H_19483; phage(gi41057356) 6e-159 Click
27149652..151424 PHAGE_Entero_PsP3_NC_005340: gp3; SEEM41H_19488; phage(gi41057355) 0.0 Click
28151421..152167 PHAGE_Entero_PsP3_NC_005340: gp2; SEEM41H_19493; phage(gi41057354) 3e-140 Click
29152164..153186 PHAGE_Entero_PsP3_NC_005340: gp1; SEEM41H_19498; phage(gi41057353) 0.0 Click
30153417..153587 hypothetical protein; SEEM41H_19503 0.0 Click
31complement(153590..153691) hypothetical protein; SEEM41H_19508 0.0 Click
32complement(153708..153902) PHAGE_Salmon_SP_004_NC_021774: hypothetical protein; SEEM41H_19513; phage(gi526003653) 8e-22 Click
33complement(154441..154674) PHAGE_Entero_PsP3_NC_005340: TumB; SEEM41H_19518; phage(gi41057390) 1e-37 Click
34complement(154678..154860) PHAGE_Entero_PsP3_NC_005340: TumA; SEEM41H_19523; phage(gi41057389) 5e-29 Click
35complement(154978..157200) PHAGE_Entero_PsP3_NC_005340: gp36; SEEM41H_19528; phage(gi41057388) 0.0 Click
36complement(157197..158027) PHAGE_Entero_HK106_NC_019768: hypothetical protein; SEEM41H_19533; phage(gi428783308) 6e-50 Click
37complement(158031..158309) PHAGE_Salmon_SP_004_NC_021774: hypothetical protein; SEEM41H_19538; phage(gi526003649) 5e-24 Click
38complement(158310..158531) PHAGE_Entero_PsP3_NC_005340: gp34; SEEM41H_19543; phage(gi41057386) 3e-35 Click
39complement(158531..158758) PHAGE_Entero_PsP3_NC_005340: gp33; SEEM41H_19548; phage(gi41057385) 3e-23 Click
40complement(158828..158992) hypothetical protein; SEEM41H_19553 0.0 Click
41complement(159015..159242) PHAGE_Entero_PsP3_NC_005340: gp32; SEEM41H_19558; phage(gi41057384) 5e-21 Click
42complement(159250..159759) PHAGE_Entero_PsP3_NC_005340: gp31; SEEM41H_19563; phage(gi41057383) 7e-93 Click
43complement(159810..160163) PHAGE_Entero_PsP3_NC_005340: gp30; SEEM41H_19568; phage(gi41057382) 2e-61 Click
44160277..161122 PHAGE_Entero_PsP3_NC_005340: CI; SEEM41H_19573; phage(gi41057393) 3e-114 Click
45161131..161469 PHAGE_Entero_PsP3_NC_005340: gp28; SEEM41H_19578; phage(gi41057381) 1e-43 Click
46161494..162543 PHAGE_Entero_PsP3_NC_005340: gp27; SEEM41H_19583; phage(gi41057380) 0.0 Click
47162625..162660 attR    GAGCGTCTTAACTAAGAACGCGCTTTCGCAACATCC 0.0 Click
48complement(162796..164016) PHAGE_Bacill_G_NC_023719: gp350; SEEM41H_19588; phage(gi593777806) 2e-12 Click
49complement(164009..164527) putative periplasmic protein; SEEM41H_19593 0.0 Click
50164968..166038 PHAGE_Pandor_salinus_NC_022098: phospho-2-dehydro-3-deoxyheptonate aldolase; SEEM41H_19598; phage(gi531037017) 1e-82 Click