Salmonella enterica subsp. enterica serovar Montevideo str. [asmbl_id: NC_000000].4650736, GC%: 52.19%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 82 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1481604..481615 attL    GAAACAAGAGGC 0.0 Click
2492717..493733 PHAGE_Salmon_SSU5: hypothetical protein; SEEM675_00572; phage(gi390013872) 1e-10 Click
3complement(495136..495339) PHAGE_Salmon_c341: hypothetical protein; SEEM675_00587; phage(gi255252701) 6e-34 Click
4complement(495436..495786) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SEEM675_00592; phage(gi399498819) 5e-62 Click
5complement(495843..496643) PHAGE_Entero_HK106: hypothetical protein; SEEM675_00597; phage(gi428783308) 7e-155 Click
6complement(496686..496970) PHAGE_Entero_ST104: ORF6; SEEM675_00602; phage(gi46358654) 2e-50 Click
7complement(496963..497883) PHAGE_Entero_HK140: hypothetical protein; SEEM675_00607; phage(gi428781971) 2e-81 Click
8complement(497942..498172) PHAGE_Klebsi_phiKO2: Gp43; SEEM675_00612; phage(gi46402129) 3e-22 Click
9complement(498175..498843) PHAGE_Salmon_ST64B: hypothetical protein sb32; SEEM675_00617; phage(gi23505476) 2e-43 Click
10complement(498840..499355) PHAGE_Salmon_ST64B: hypothetical protein sb33; SEEM675_00622; phage(gi23505477) 9e-97 Click
11complement(499352..499468) PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp30; SEEM675_00627; phage(gi221328647) 4e-16 Click
12complement(499465..500046) PHAGE_Entero_P22: EaE; SEEM675_00632; phage(gi9635501) 1e-72 Click
13complement(500043..500213) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00637; phage(gi399528797) 9e-27 Click
14complement(500224..500517) PHAGE_Salmon_ST160: Abc2; SEEM675_00642; phage(gi318065913) 4e-52 Click
15complement(500564..500848) PHAGE_Salmon_vB_SemP_Emek: Abc1; SEEM675_00647; phage(gi399498830) 3e-48 Click
16complement(500848..501555) PHAGE_Salmon_vB_SemP_Emek: Erf; SEEM675_00652; phage(gi399498831) 9e-134 Click
17complement(501552..501695) PHAGE_Salmon_vB_SosS_Oslo: Arf protein; SEEM675_00657; phage(gi399528801) 9e-21 Click
18complement(501685..501873) PHAGE_Salmon_vB_SosS_Oslo: Kil protein; SEEM675_00662; phage(gi399528802) 8e-33 Click
19complement(501854..502027) PHAGE_Entero_ST104: C3; SEEM675_00667; phage(gi46358663) 8e-25 Click
20complement(502097..502411) PHAGE_Salmon_ST160: Gp17; SEEM675_00672; phage(gi318065919) 3e-59 Click
21complement(502583..502708) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00677; phage(gi399528804) 9e-19 Click
22502754..503143 PHAGE_Lactob_LP65: tail fiber; SEEM675_00682; phage(gi56693145) 2e-16 Click
23complement(503281..503526) PHAGE_Escher_PhaxI: hypothetical protein; SEEM675_00687; phage(gi418488772) 8e-20 Click
24complement(503534..503866) PHAGE_Salmon_ST160: Gp24; SEEM675_00692; phage(gi318065922) 3e-50 Click
25complement(503893..503974) tRNA 0.0 Click
26complement(504217..504921) PHAGE_Entero_ST64T: C2; SEEM675_00697; phage(gi24371557) 2e-133 Click
27504998..505213 PHAGE_Entero_ST64T: Cro; SEEM675_00702; phage(gi24371558) 2e-35 Click
28505324..505605 PHAGE_Salmon_vB_SemP_Emek: C1 protein; SEEM675_00707; phage(gi399498838) 6e-47 Click
29505640..505786 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SEEM675_00712; phage(gi399498839) 8e-22 Click
30505779..506612 PHAGE_Entero_P22: hypothetical protein P22gp51; SEEM675_00717; phage(gi9635519) 2e-129 Click
31506609..507985 PHAGE_Entero_ST104: gp12; SEEM675_00722; phage(gi46358676) 0.0 Click
32507982..508065 PHAGE_Salmon_SPN9CC: NinA; SEEM675_00727; phage(gi389060514) 2e-09 Click
33508058..508264 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SEEM675_00732; phage(gi399498843) 1e-34 Click
34508279..508431 hypothetical protein; SEEM675_00737 0.0 Click
35508443..508709 PHAGE_Entero_Sf6: gene 48 protein; SEEM675_00742; phage(gi41057325) 1e-25 Click
36508760..508900 hypothetical protein; SEEM675_00747 0.0 Click
37508857..509303 PHAGE_Salmon_vB_SemP_Emek: NinB; SEEM675_00752; phage(gi399498846) 2e-81 Click
38509440..509616 PHAGE_Salmon_vB_SosS_Oslo: NinE protein; SEEM675_00757; phage(gi399528825) 4e-29 Click
39509619..510020 PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; SEEM675_00762; phage(gi302861190) 4e-66 Click
40510013..510189 PHAGE_Salmon_vB_SosS_Oslo: NinF protein; SEEM675_00767; phage(gi399528827) 9e-27 Click
41510401..510691 PHAGE_Entero_ST64T: Orf-136; SEEM675_00772; phage(gi24371572) 5e-53 Click
42510688..511083 PHAGE_Entero_ST64T: Rus; SEEM675_00777; phage(gi24371573) 2e-72 Click
43511080..511283 PHAGE_Salmon_vB_SosS_Oslo: NinH protein; SEEM675_00782; phage(gi399528830) 7e-35 Click
44511264..511356 hypothetical protein; SEEM675_00787 0.0 Click
45511353..511976 PHAGE_Salmon_epsilon34: Q, late gene regulator; SEEM675_00792; phage(gi221328680) 5e-117 Click
46512401..512739 PHAGE_Xantho_Xop411: p42.1; SEEM675_00797; phage(gi148727219) 4e-24 Click
47complement(512933..513112) hypothetical protein; SEEM675_00802 0.0 Click
48513437..513763 PHAGE_Entero_P22: inhibitor of gene 13' protein holin; SEEM675_00807; phage(gi9635530) 7e-56 Click
49513747..514184 PHAGE_Entero_ES18: gp76; SEEM675_00812; phage(gi62362289) 2e-74 Click
50514181..514642 PHAGE_Entero_mEp235: lysis protein Rz; SEEM675_00817; phage(gi428781868) 2e-58 Click
51514861..515382 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SEEM675_00822; phage(gi399498859) 4e-100 Click
52515847..516278 PHAGE_Entero_ES18: gp1; SEEM675_00827; phage(gi62362214) 2e-75 Click
53516262..517581 PHAGE_Salmon_vB_SosS_Oslo: terminase large subunit; SEEM675_00832; phage(gi399528760) 8e-152 Click
54517643..517909 PHAGE_Entero_ES18: gp3; SEEM675_00837; phage(gi62362216) 1e-46 Click
55518150..519499 PHAGE_Salmon_vB_SosS_Oslo: portal protein; SEEM675_00842; phage(gi399528761) 0.0 Click
56519459..520385 PHAGE_Salmon_vB_SosS_Oslo: putative head morphogenesis protein; SEEM675_00847; phage(gi399528762) 1e-171 Click
57520388..521653 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00852; phage(gi399528763) 0.0 Click
58521666..522115 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00857; phage(gi399528764) 2e-80 Click
59522133..523209 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00862; phage(gi399528765) 0.0 Click
60523219..523398 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00867; phage(gi399528766) 9e-29 Click
61523450..523851 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00872; phage(gi399528767) 8e-73 Click
62523851..524039 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00877; phage(gi399528768) 2e-31 Click
63524023..524385 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00882; phage(gi399528769) 4e-69 Click
64complement(524318..524509) hypothetical protein; SEEM675_00887 0.0 Click
65524393..524788 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00892; phage(gi399528770) 2e-71 Click
66524785..525171 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00897; phage(gi399528771) 1e-67 Click
67525187..525924 PHAGE_Salmon_vB_SosS_Oslo: major tail protein; SEEM675_00902; phage(gi399528772) 2e-137 Click
68525970..526623 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00907; phage(gi399528773) 2e-121 Click
69526845..527573 PHAGE_Salmon_vB_SosS_Oslo: KilA domain protein; SEEM675_00912; phage(gi399528774) 1e-140 Click
70complement(527615..527992) PHAGE_Salmon_vB_SosS_Oslo: putative regulator protein; Arc-like; phage DNA binding domain; SEEM675_00917(gi399528775) 9e-67 Click
71528108..528278 PHAGE_Salmon_vB_SosS_Oslo: Arc-like DNA binding domain protein; SEEM675_00922; phage(gi399528776) 2e-25 Click
72528271..529245 PHAGE_Salmon_vB_SosS_Oslo: putative antirepressor protein Ant; SEEM675_00927; phage(gi399528777) 0.0 Click
73529351..529995 hypothetical protein; SEEM675_00932 0.0 Click
74530064..533258 PHAGE_Salmon_vB_SosS_Oslo: tail length tape-measure protein; SEEM675_00937; phage(gi399528779) 0.0 Click
75533286..533507 hypothetical protein; SEEM675_00942 0.0 Click
76533564..533911 PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; SEEM675_00947; phage(gi399528780) 1e-62 Click
77533908..534195 PHAGE_Vibrio_ICP1: hypothetical protein; SEEM675_00952; phage(gi325171004) 2e-07 Click
78534237..534941 PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; SEEM675_00957; phage(gi399528783) 9e-137 Click
79534941..535660 PHAGE_Salmon_vB_SosS_Oslo: tail assembly protein; SEEM675_00962; phage(gi399528784) 1e-134 Click
80535783..536130 PHAGE_Salmon_vB_SosS_Oslo: tail assembly protein; SEEM675_00967; phage(gi399528785) 1e-58 Click
81536140..539319 PHAGE_Salmon_vB_SosS_Oslo: tail fiber protein; SEEM675_00972; phage(gi399528786) 0.0 Click
82539328..540287 PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; SEEM675_00977; phage(gi399528787) 0.0 Click
83540298..541596 PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; SEEM675_00982; phage(gi399528788) 0.0 Click
84541521..541532 attR    GAAACAAGAGGC 0.0 Click
85complement(541668..542837) PHAGE_Salmon_vB_SemP_Emek: integrase; putative; phage prophage CPS-53 integrase; SEEM675_00987(gi399498816) 0.0 Click

Region 2, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13313325..3313371 attL    ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA 0.0 Click
2complement(3313487..3313705) PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); SEEM675_21070; phage(gi169936018) 1e-39 Click
3complement(3313774..3314874) PHAGE_Entero_2: P2 gpD-like tail protein; SEEM675_21075; phage(gi169936019) 0.0 Click
4complement(3314871..3315356) PHAGE_Entero_2: P2 gpU-like tail protein; SEEM675_21080; phage(gi169936020) 4e-86 Click
5complement(3315353..3318160) PHAGE_Entero_2: P2 gpT-like tail protein; SEEM675_21085; phage(gi169936021) 0.0 Click
6complement(3318153..3318272) PHAGE_Entero_2: P2 gpE-like protein; SEEM675_21090; phage(gi169936022) 2e-16 Click
7complement(3318322..3318588) PHAGE_Entero_2: P2 gpE-like tail protein; SEEM675_21095; phage(gi169936023) 3e-42 Click
8complement(3318643..3319158) PHAGE_Entero_2: P2 gpFII-like protein; SEEM675_21100; phage(gi169936024) 4e-93 Click
9complement(3319168..3320340) PHAGE_Entero_2: P2 gpFI-like protein; SEEM675_21105; phage(gi169936025) 0.0 Click
10complement(3320443..3321000) PHAGE_Entero_2: DNA-invertase; SEEM675_21110; phage(gi169936026) 6e-100 Click
113321030..3321584 PHAGE_Entero_2: P2 gpH-like protein; SEEM675_21115; phage(gi169936027) 6e-06 Click
123321520..3322353 PHAGE_Escher_D108: tail fiber fragment; SEEM675_21120; phage(gi281199697) 1e-39 Click
133322356..3322895 PHAGE_Escher_D108: probable tail fiber assembly protein; SEEM675_21125; phage(gi281199695) 5e-64 Click
14complement(3322899..3323486) PHAGE_Entero_2: P2 gpG-like protein; SEEM675_21130; phage(gi169936029) 6e-95 Click
15complement(3323486..3323971) PHAGE_Entero_2: P2 gpH-like protein; SEEM675_21135; phage(gi169936030) 6e-52 Click
16complement(3323974..3324807) PHAGE_Entero_2: P2 gpH-like protein; SEEM675_21140; phage(gi169936030) 4e-153 Click
17complement(3324804..3325409) PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; SEEM675_21145; phage(gi169936031) 3e-117 Click
18complement(3325402..3326310) PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; SEEM675_21150; phage(gi169936032) 1e-163 Click
19complement(3326297..3326656) PHAGE_Entero_2: P2 gpW-like baseplate protein; SEEM675_21155; phage(gi169936033) 2e-61 Click
20complement(3326653..3327231) PHAGE_Entero_2: P2 gpV-like protein; SEEM675_21160; phage(gi169936034) 4e-111 Click
21complement(3327300..3327746) PHAGE_Entero_2: P2 gpS-like tail completion protein; SEEM675_21165; phage(gi169936035) 9e-77 Click
22complement(3327739..3328170) PHAGE_Entero_2: P2 gpR-like tail completion protein; SEEM675_21170; phage(gi169936036) 7e-74 Click
23complement(3328133..3328249) PHAGE_Entero_2: P2 LysC-like protein; SEEM675_21175; phage(gi169936037) 2e-15 Click
24complement(3328266..3328691) PHAGE_Entero_2: P2 LysB-like protein; SEEM675_21180; phage(gi169936038) 8e-69 Click
25complement(3328691..3329068) hypothetical protein; SEEM675_21185 0.0 Click
26complement(3329073..3329582) PHAGE_Entero_2: endolysin; SEEM675_21190; phage(gi169936041) 3e-87 Click
27complement(3329563..3329778) PHAGE_Entero_2: lysis protein; SEEM675_21195; phage(gi169936042) 2e-35 Click
28complement(3329782..3329985) PHAGE_Entero_2: P2 gpX-like tail protein; SEEM675_21200; phage(gi169936043) 1e-32 Click
29complement(3329985..3330449) PHAGE_Entero_2: P2 gpL-like protein; SEEM675_21205; phage(gi169936044) 5e-79 Click
30complement(3330545..3331195) PHAGE_Entero_2: P2 gpM-like protein; SEEM675_21210; phage(gi169936045) 1e-113 Click
31complement(3331199..3332266) PHAGE_Entero_2: P2 gpN-like major capsid protein; SEEM675_21215; phage(gi169936046) 0.0 Click
32complement(3332283..3333116) PHAGE_Entero_2: P2 gpO-like protein; SEEM675_21220; phage(gi169936047) 4e-128 Click
333333259..3335025 PHAGE_Entero_2: P2 gpP-like protein; SEEM675_21225; phage(gi169936048) 0.0 Click
343335025..3336062 PHAGE_Entero_2: P2 gpQ-like protein; SEEM675_21230; phage(gi169936049) 0.0 Click
35complement(3336104..3337870) PHAGE_Aggreg_S1249: hypothetical protein; SEEM675_21235; phage(gi273809593) 1e-80 Click
36complement(3338245..3338922) PHAGE_Entero_2: hypothetical protein STM2726.Fels2; SEEM675_21240; phage(gi169936051) 3e-124 Click
37complement(3339036..3339269) PHAGE_Entero_2: TumB protein; SEEM675_21245; phage(gi169936052) 2e-38 Click
38complement(3339280..3339468) PHAGE_Entero_2: hypothetical protein STM2728.Fels2; SEEM675_21250; phage(gi169936053) 2e-28 Click
39complement(3339622..3341997) PHAGE_Entero_2: P2 gpA-like protein; SEEM675_21255; phage(gi169936054) 0.0 Click
40complement(3342065..3342823) PHAGE_Entero_HK106: hypothetical protein; SEEM675_21260; phage(gi428783308) 1e-45 Click
41complement(3342820..3343674) PHAGE_Entero_2: DNA adenine methylase-like protein; SEEM675_21265; phage(gi169936055) 3e-154 Click
42complement(3343671..3343898) PHAGE_Entero_2: P2 gpOrf82-like protein; SEEM675_21270; phage(gi169936056) 6e-38 Click
43complement(3343898..3344131) PHAGE_Entero_2: hypothetical protein STM2732.Fels2; SEEM675_21275; phage(gi169936057) 1e-29 Click
44complement(3344199..3344540) PHAGE_Entero_2: hypothetical protein STM2733.Fels2; SEEM675_21280; phage(gi169936058) 2e-49 Click
45complement(3344504..3344704) PHAGE_Entero_2: hypothetical protein STM2735.Fels2; SEEM675_21285; phage(gi169936060) 7e-13 Click
46complement(3344712..3345221) PHAGE_Entero_2: bacteriophage regulatory protein CII; SEEM675_21290; phage(gi169936061) 8e-87 Click
473345617..3346249 PHAGE_Entero_2: P2 CI-like protein; SEEM675_21295; phage(gi169936063) 2e-68 Click
483346251..3347270 PHAGE_Entero_2: P2 Int-like protein; SEEM675_21300; phage(gi169936064) 0.0 Click
493347275..3348498 PHAGE_Salmon_RE_2010: hypothetical protein; SEEM675_21305; phage(gi418489682) 5e-78 Click
503348615..3348661 attR    ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA 0.0 Click
513348864..3350105 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; SEEM675_21310; phage(gi16130540) 0.0 Click