Escherichia coli O157:H7 str. 1044 , whole genome [asmbl_id: NC_000000].5487708, GC%: 50.43%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 52 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(635..1810) PHAGE_Entero_4795: putative tail component; ECoA_00001; phage(gi157166057) 0.0 Click
2complement(1886..2005) hypothetical protein; ECoA_00002 0.0 Click
3complement(2051..2629) PROPHAGE_Escher_Sakai: putative tail assembly protein; ECoA_00003; phage(gi15832199) 2e-105 Click
4complement(2626..3261) PROPHAGE_Escher_Sakai: putative tail assembly protein; ECoA_00004; phage(gi15832200) 7e-129 Click
5complement(3380..4078) PHAGE_Stx2_c_1717: phage minor tail protein L; ECoA_00005; phage(gi209447192) 5e-132 Click
6complement(4078..4407) PROPHAGE_Escher_Sakai: putative minor tail protein; ECoA_00006; phage(gi15832202) 4e-60 Click
7complement(4404..7016) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECoA_00007; phage(gi15832203) 0.0 Click
8complement(6997..7386) PROPHAGE_Escher_Sakai: putative minor tail protein; ECoA_00008; phage(gi15832204) 3e-41 Click
9complement(7437..7859) PROPHAGE_Escher_Sakai: putative minor tail protein; ECoA_00009; phage(gi15832205) 7e-74 Click
10complement(7873..8625) PHAGE_Entero_HK630: major tail protein V; ECoA_00010; phage(gi428782800) 1e-112 Click
11complement(8633..9028) PHAGE_Entero_HK630: minor tail protein U; ECoA_00011; phage(gi428782799) 6e-59 Click
12complement(9025..9558) PHAGE_Entero_HK630: minor tail protein Z; ECoA_00012; phage(gi428782798) 2e-65 Click
13complement(9573..9926) PHAGE_Entero_HK630: head-tail connector Fii; ECoA_00013; phage(gi428782797) 2e-58 Click
14complement(9938..10336) PHAGE_Entero_HK225: head assembly protein Fi; ECoA_00014; phage(gi428782384) 7e-21 Click
15complement(10378..11403) PHAGE_Entero_HK630: major head subunit E; ECoA_00015; phage(gi428782795) 0.0 Click
16complement(11459..11791) PHAGE_Entero_HK630: head decoration protein D; ECoA_00016; phage(gi428782794) 7e-58 Click
17complement(11801..13120) PHAGE_Entero_HK630: head maturation protease C; ECoA_00017; phage(gi428782792) 0.0 Click
18complement(13101..14702) PHAGE_Entero_HK630: portal protein B; ECoA_00018; phage(gi428782791) 0.0 Click
19complement(14699..14905) PHAGE_Entero_HK630: head-tail connector W; ECoA_00019; phage(gi428782790) 1e-31 Click
20complement(14902..16647) PHAGE_Entero_HK630: terminase large subunit A; ECoA_00020; phage(gi428782789) 0.0 Click
21complement(16802..17347) PHAGE_Entero_HK630: terminase small subunit nu1; ECoA_00021; phage(gi428782788) 5e-83 Click
22complement(18680..18925) PHAGE_Escher_TL_2011c: hypothetical protein; ECoA_00023; phage(gi418487098) 3e-07 Click
23complement(18961..19143) PHAGE_Escher_P13374: hypothetical protein; ECoA_00024; phage(gi410491643) 2e-12 Click
24complement(19290..21134) PHAGE_Entero_4795: hypothetical protein YjhS; ECoA_00025; phage(gi157166028) 0.0 Click
25complement(21429..21989) PHAGE_Entero_Mu: Gin; ECoA_00026; phage(gi9633542) 8e-78 Click
2622268..22414 PROPHAGE_Escher_Sakai: putative tail fiber protein; ECoA_00027; phage(gi15834245) 1e-22 Click
2722383..23015 PHAGE_Entero_Mu: tail fiber assembly protein; ECoA_00028; phage(gi19584573) 7e-18 Click
28complement(23050..23961) PHAGE_Entero_Mu: tail fiber; ECoA_00029; phage(gi9633540) 2e-39 Click
29complement(23961..24521) PHAGE_Entero_Mu: hypothetical protein Mup48; ECoA_00030; phage(gi9633539) 1e-44 Click
30complement(24512..25597) PHAGE_Entero_Mu: hypothetical protein Mup47; ECoA_00031; phage(gi9633538) 2e-100 Click
31complement(25594..26031) PHAGE_Entero_Mu: hypothetical protein Mup46; ECoA_00032; phage(gi9633537) 1e-40 Click
32complement(26024..26635) PHAGE_Entero_Mu: putative baseplate assembly protein; ECoA_00033; phage(gi9633536) 6e-54 Click
33complement(26628..27752) PHAGE_Entero_Mu: putative tail protein; ECoA_00034; phage(gi9633535) 2e-92 Click
34complement(27736..29085) PHAGE_Entero_Mu: putative DNA circulation protein; ECoA_00035; phage(gi9633534) 2e-71 Click
35complement(29072..31147) PHAGE_Entero_Mu: putative tape measure protein; ECoA_00036; phage(gi9633533) 7e-103 Click
36complement(31274..31750) PHAGE_Entero_Mu: hypothetical protein Mup41; ECoA_00037; phage(gi9633532) 3e-24 Click
37complement(31765..32130) PHAGE_Entero_Mu: hypothetical protein Mup40; ECoA_00038; phage(gi9633531) 4e-27 Click
38complement(32139..33641) PHAGE_Entero_Mu: major tail subunit; ECoA_00039; phage(gi9633530) 7e-139 Click
39complement(33638..33883) PHAGE_Entero_Mu: hypothetical protein Mup38; ECoA_00040; phage(gi9633529) 3e-09 Click
40complement(33884..34444) PHAGE_Entero_Mu: hypothetical protein Mup37; ECoA_00041; phage(gi9633528) 4e-34 Click
41complement(34441..34860) PHAGE_Entero_Mu: hypothetical protein Mup36; ECoA_00042; phage(gi9633527) 2e-28 Click
42complement(34857..35243) PHAGE_Entero_Mu: hypothetical protein Mup35; ECoA_00043; phage(gi9633526) 4e-06 Click
43complement(35287..36234) PHAGE_Entero_Mu: major head subunit; ECoA_00044; phage(gi9633525) 5e-123 Click
44complement(36234..37358) PHAGE_Entero_Mu: putative protease protein; ECoA_00045; phage(gi9633523) 4e-81 Click
45complement(37535..38008) PHAGE_Entero_Mu: putative virion morphogenesis protein; ECoA_00046; phage(gi9633522) 4e-40 Click
46complement(38127..39452) PHAGE_Entero_Mu: virion morphogenesis late F orf; ECoA_00047; phage(gi9633521) 1e-156 Click
47complement(39436..41025) PHAGE_Entero_Mu: hypothetical protein Mup29; ECoA_00048; phage(gi9633520) 2e-170 Click
48complement(41025..42689) PHAGE_Entero_Mu: putative portal protein; ECoA_00049; phage(gi9633519) 0.0 Click
49complement(42689..43270) PHAGE_Entero_Mu: hypothetical protein Mup27; ECoA_00050; phage(gi9633518) 6e-55 Click
50complement(43849..44076) PHAGE_Vibrio_VP882: conjugative transfer protein; ECoA_00053; phage(gi126010902) 2e-05 Click
51complement(44751..45251) PHAGE_Xantho_CP1: hypothetical protein; ECoA_00056; phage(gi431811023) 5e-28 Click
52complement(45323..45748) PHAGE_Entero_Mu: putative transcription regulator; ECoA_00057; phage(gi9633511) 2e-22 Click

Region 2, total : 59 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
174762..75106 PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECoA_00089; phage(gi209427768) 1e-59 Click
275157..75690 PHAGE_Entero_2008: putative endolysin; ECoA_00090; phage(gi209427769) 4e-103 Click
375961..76530 PHAGE_Entero_2008: putative antirepressor; ECoA_00091; phage(gi209427770) 7e-107 Click
476542..76676 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECoA_00092; phage(gi302861202) 2e-17 Click
576684..77151 PHAGE_Entero_2008: putative endopeptidase; ECoA_00093; phage(gi209427771) 1e-82 Click
6complement(77514..77681) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECoA_00094; phage(gi209427772) 7e-26 Click
778438..79001 PHAGE_Entero_2008: putative phage terminase; ECoA_00095; phage(gi209427774) 1e-95 Click
879007..80659 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECoA_00096; phage(gi209427775) 0.0 Click
980723..82660 PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECoA_00097; phage(gi209427776) 0.0 Click
1082705..82926 PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECoA_00098; phage(gi209427801) 6e-38 Click
1182959..85373 PHAGE_Entero_2008: putative portal protein; ECoA_00099; phage(gi209427777) 0.0 Click
1285453..85779 PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECoA_00100; phage(gi209427778) 1e-54 Click
1385789..86139 PHAGE_Entero_2008: putative head-tail adaptor; ECoA_00101; phage(gi209427779) 9e-61 Click
1486136..86582 PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECoA_00102; phage(gi209427780) 2e-80 Click
1586579..86923 PHAGE_Entero_2008: putative prophage structural protein; ECoA_00103; phage(gi209427781) 6e-60 Click
1686982..87698 PHAGE_Entero_2008: putative tail protein; ECoA_00104; phage(gi209427782) 1e-124 Click
1787704..88078 PHAGE_Entero_2008: putative tail assembly protein; ECoA_00105; phage(gi209427783) 2e-65 Click
1888180..88383 PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECoA_00106; phage(gi209427784) 3e-32 Click
1988436..91678 PHAGE_Entero_2008: putative tail protein; ECoA_00107; phage(gi209427785) 0.0 Click
2091671..92012 PHAGE_Entero_2008: putative minor tail protein; ECoA_00108; phage(gi209427786) 4e-64 Click
2192012..92710 PHAGE_Entero_2008: putative tail protein; ECoA_00109; phage(gi209427787) 1e-128 Click
2292829..93464 PHAGE_Entero_2008: putative tail component K-like protein; ECoA_00110; phage(gi209427789) 3e-121 Click
2393461..94042 PHAGE_Entero_2008: putative tail assembly protein; ECoA_00111; phage(gi209427790) 2e-101 Click
2494384..95559 PHAGE_Entero_2008: phage-related tail protein; ECoA_00112; phage(gi209427791) 0.0 Click
2595655..95819 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECoA_00114; phage(gi209427772) 1e-08 Click
2696218..96331 hypothetical protein; ECoA_00115 0.0 Click
27complement(96457..96597) hypothetical protein; ECoA_00116 0.0 Click
28complement(96680..97147) PHAGE_Entero_2008: putative endopeptidase; ECoA_00117; phage(gi209427771) 8e-67 Click
29complement(97299..97445) hypothetical protein; ECoA_00118 0.0 Click
30complement(97637..98170) PHAGE_Entero_2008: putative endolysin; ECoA_00119; phage(gi209427769) 2e-99 Click
31complement(98221..98565) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECoA_00120; phage(gi209427768) 6e-60 Click
32complement(98570..98776) PHAGE_Entero_2008: lysis protein; ECoA_00121; phage(gi209427767) 1e-32 Click
3399096..99422 PHAGE_Stx2_c_II: putative transposase; ECoA_00122; phage(gi302393161) 1e-58 Click
34100098..100256 PHAGE_Entero_P1: TciB; ECoA_00124; phage(gi46401695) 3e-06 Click
35100878..101093 PHAGE_Stx2_c_1717: holin protein S-like protein; ECoA_00125; phage(gi209447171) 7e-35 Click
36101093..101590 PHAGE_Entero_cdtI: lysin; ECoA_00126; phage(gi148609440) 1e-91 Click
37101587..102054 PHAGE_Salmon_SPN9CC: endopeptidase; ECoA_00127; phage(gi389060532) 2e-78 Click
38102042..102194 PHAGE_Entero_mEp460: hypothetical protein; ECoA_00128; phage(gi428782374) 1e-21 Click
39102869..103360 PHAGE_Entero_mEp460: terminase small subunit; ECoA_00129; phage(gi428782317) 5e-74 Click
40105671..106723 PHAGE_Entero_mEp460: portal protein; ECoA_00132; phage(gi428782320) 0.0 Click
41106818..107180 PHAGE_Entero_mEp460: portal protein; ECoA_00133; phage(gi428782320) 3e-66 Click
42107194..109152 PHAGE_Entero_mEp213: head maturation protease; ECoA_00134; phage(gi428782594) 0.0 Click
43109842..110420 PHAGE_Entero_mEp460: minor tail protein; ECoA_00137; phage(gi428782324) 2e-103 Click
44110417..110818 PHAGE_Entero_cdtI: putative tail component; ECoA_00138; phage(gi148609391) 8e-73 Click
45110829..111572 PHAGE_Entero_mEp460: major tail protein; ECoA_00139; phage(gi428782326) 4e-137 Click
46111633..112019 PHAGE_Entero_cdtI: putative tail component; ECoA_00140; phage(gi148609393) 5e-65 Click
47112040..112357 PHAGE_Entero_mEp460: tail assembly protein; ECoA_00141; phage(gi428782328) 1e-56 Click
48112329..115394 PHAGE_Entero_mEp460: tail length tape measure protein; ECoA_00142; phage(gi428782329) 0.0 Click
49115394..115723 PHAGE_Entero_mEp460: minor tail protein; ECoA_00143; phage(gi428782330) 2e-61 Click
50115733..116431 PHAGE_Entero_mEp460: minor tail protein; ECoA_00144; phage(gi428782331) 1e-135 Click
51116437..117180 PHAGE_Entero_2008: putative tail component K-like protein; ECoA_00145; phage(gi209427789) 3e-130 Click
52117213..117725 PHAGE_Entero_mEp460: tail assembly protein; ECoA_00146; phage(gi428782333) 6e-87 Click
53117786..121199 PHAGE_Entero_mEp460: host specificity protein; ECoA_00147; phage(gi428782334) 0.0 Click
54121270..121869 PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECoA_00148; phage(gi209427792) 1e-101 Click
55121929..123245 PHAGE_Entero_2008: putative tail protein; ECoA_00149; phage(gi209427793) 0.0 Click
56123247..123516 PHAGE_Stx2_c_II: putative tail fiber protein; ECoA_00150; phage(gi302393091) 1e-46 Click
57123693..124673 PHAGE_Salmon_ST64B: hypothetical protein sb26; ECoA_00151; phage(gi23505470) 3e-90 Click
58124734..125726 Phage protein; ECoA_00152 0.0 Click
59126554..127435 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECoA_00153; phage(gi148609405) 7e-156 Click

Region 3, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1217187..218707 PROPHAGE_Escher_Sakai: putative ATP-dependent protease; ECoA_00238; phage(gi15833954) 0.0 Click
2complement(218732..219070) Protein yifE; ECoA_00239 0.0 Click
3219321..220028 HTH-type transcriptional regulator hdfR; ECoA_00240 0.0 Click
4complement(220127..220199) tRNA 0.0 Click
5220165..220176 attL    GGAGACCGGTGC 0.0 Click
6complement(220211..220284) tRNA 0.0 Click
7220435..220731 PROPHAGE_Escher_CFT073: transposase; ECoA_00251; phage(gi26246249) 3e-26 Click
8220761..221018 PROPHAGE_Escher_CFT073: transposase; ECoA_00252; phage(gi26246249) 2e-33 Click
9complement(221700..222611) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECoA_00253; phage(gi148609405) 2e-146 Click
10223085..223777 PHAGE_Entero_HK630: integrase; ECoA_00254; phage(gi428782814) 2e-91 Click
11224438..225763 PHAGE_Entero_4795: NleA4795 protein; ECoA_00255; phage(gi157166068) 0.0 Click
12225973..226119 hypothetical protein; ECoA_00256 0.0 Click
13complement(226790..227059) PHAGE_Stx2_c_II: putative tail fiber protein; ECoA_00257; phage(gi302393091) 1e-41 Click
14complement(227061..228374) PHAGE_Stx2_c_1717: putative tail fiber protein; ECoA_00258; phage(gi209447198) 0.0 Click
15complement(228526..229125) PHAGE_Entero_mEp460: Lom protein; ECoA_00259; phage(gi428782335) 3e-97 Click
16complement(229193..231520) PHAGE_Entero_HK630: tail fiber J; ECoA_00260; phage(gi428782808) 0.0 Click
17complement(231490..231831) PHAGE_Entero_4795: putative tail component; ECoA_00261; phage(gi157166057) 3e-52 Click
18231958..232578 PHAGE_Stx2_c_1717: transposase; ECoA_00263; phage(gi209447153) 2e-117 Click
19complement(232612..232728) hypothetical protein; ECoA_00264 0.0 Click
20232727..232870 PHAGE_Entero_mEp237: terminase small subunit nu1; ECoA_00265; phage(gi435439266) 9e-05 Click
21232842..234770 PHAGE_Entero_HK630: terminase large subunit A; ECoA_00266; phage(gi428782789) 0.0 Click
22234754..234960 PHAGE_Entero_HK630: head-tail connector W; ECoA_00267; phage(gi428782790) 1e-11 Click
23235050..236549 PHAGE_Entero_HK630: portal protein B; ECoA_00268; phage(gi428782791) 8e-175 Click
24236539..238044 PHAGE_Entero_HK630: head maturation protease C; ECoA_00269; phage(gi428782792) 4e-108 Click
25238081..238428 PHAGE_Entero_HK630: head decoration protein D; ECoA_00270; phage(gi428782794) 6e-25 Click
26238486..238752 PHAGE_Entero_HK630: major head subunit E; ECoA_00271; phage(gi428782795) 2e-20 Click
27238812..239474 PHAGE_Entero_HK630: major tail protein V; ECoA_00272; phage(gi428782800) 5e-97 Click
28239488..239919 PHAGE_Entero_HK630: minor tail protein G; ECoA_00273; phage(gi428782801) 5e-45 Click
29239970..240359 PHAGE_Entero_HK630: tail assembly protein GT; ECoA_00274; phage(gi428782802) 4e-43 Click
30240340..242919 PHAGE_Entero_HK630: tail length tape measure protein H; ECoA_00275; phage(gi428782803) 0.0 Click
31242916..243245 PHAGE_Entero_HK630: minor tail protein M; ECoA_00276; phage(gi428782804) 4e-48 Click
32243245..243943 PHAGE_Entero_HK630: minor tail protein L; ECoA_00277; phage(gi428782805) 3e-103 Click
33243954..244697 PHAGE_Entero_4795: putative tail fiber component; ECoA_00278; phage(gi157166055) 2e-144 Click
34244694..245275 PHAGE_Stx2_c_1717: putative tail component; ECoA_00279; phage(gi209447195) 8e-106 Click
35complement(245466..245915) PHAGE_Salmon_1: hypothetical bacteriophage protein; ECoA_00280; phage(gi169257202) 2e-58 Click
36246127..248589 PHAGE_Entero_HK630: tail fiber J; ECoA_00281; phage(gi428782808) 0.0 Click
37247668..247679 attR    GGAGACCGGTGC 0.0 Click
38248652..249602 PHAGE_Entero_HK630: tail fiber J; ECoA_00282; phage(gi428782808) 8e-78 Click
39249670..250269 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECoA_00283; phage(gi209447197) 9e-113 Click
40complement(250557..251417) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip024; ECoA_00284; phage(gi20065820) 4e-29 Click
41251369..251647 PHAGE_Escher_TL_2011c: putative tail fiber protein; ECoA_00285; phage(gi418487108) 2e-47 Click
42251649..251918 PHAGE_Stx2_c_II: putative tail fiber protein; ECoA_00286; phage(gi302393091) 2e-43 Click
43complement(252043..252795) PHAGE_Emilia_86: hypothetical protein EhV364; ECoA_00287; phage(gi73852838) 1e-09 Click

Region 4, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1288867..288879 attL    ATGGTTTCCGGTA 0.0 Click
2complement(288973..290283) PHAGE_Stx2_c_II: integrase; ECoA_00323; phage(gi302393112) 0.0 Click
3complement(290336..290620) PHAGE_Stx2_c_II: excisionase; ECoA_00324; phage(gi302393113) 1e-51 Click
4complement(290706..291005) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp32; ECoA_00325; phage(gi302393114) 1e-54 Click
5complement(291077..291361) PHAGE_Stx2_c_II: hypothetical protein Stx2IIp093; ECoA_00326; phage(gi302393115) 1e-51 Click
6complement(291354..291977) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp33; ECoA_00327; phage(gi302393116) 2e-120 Click
7complement(291981..292268) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp34; ECoA_00328; phage(gi302393117) 1e-51 Click
8complement(292270..292488) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp35; ECoA_00329; phage(gi302393118) 1e-36 Click
9complement(292490..292705) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp36; ECoA_00330; phage(gi302393119) 5e-39 Click
10complement(292717..292836) hypothetical protein; ECoA_00331 0.0 Click
11complement(293047..293820) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp38; ECoA_00332; phage(gi302393121) 2e-146 Click
12complement(294137..294352) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp41; ECoA_00333; phage(gi302393124) 5e-35 Click
13complement(294429..294620) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp43; ECoA_00334; phage(gi302393126) 2e-29 Click
14complement(294772..295452) PHAGE_Stx2_c_II: exonuclease; Putative; phage phage-encoded enzyme involved in integration-recombination; ECoA_00335(gi302393128) 2e-132 Click
15complement(295449..296234) PHAGE_Stx2_c_II: recombination protein Bet; ECoA_00336; phage(gi302393129) 3e-151 Click
16complement(296240..296536) PHAGE_Stx2_c_II: host-nuclease inhibitor protein Gam; ECoA_00337; phage(gi302393130) 5e-53 Click
17complement(296611..296754) PHAGE_Stx2_c_II: Kil protein; ECoA_00338; phage(gi302393131) 2e-20 Click
18complement(296960..297328) PHAGE_Stx2_c_II: Ea10 protein; ECoA_00339; phage(gi302393133) 2e-68 Click
19complement(297511..297762) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp52; ECoA_00340; phage(gi302393135) 2e-44 Click
20complement(298822..299202) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp54; ECoA_00341; phage(gi302393137) 8e-67 Click
21complement(299566..299700) hypothetical protein; ECoA_00342 0.0 Click
22complement(299845..300171) PHAGE_Stx2_c_II: CI protein; ECoA_00343; phage(gi302393138) 2e-59 Click
23300973..301269 PHAGE_Stx2_c_II: CII protein; ECoA_00344; phage(gi302393140) 2e-50 Click
24301302..301448 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp58; ECoA_00345; phage(gi302393141) 4e-22 Click
25301441..302340 PHAGE_Stx1_converting: DNA replication protein O; ECoA_00346; phage(gi302861180) 1e-177 Click
26302330..303766 PHAGE_Stx2_c_II: DNA replication protein P; ECoA_00347; phage(gi302393143) 0.0 Click
27303766..304035 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp61; ECoA_00348; phage(gi302393144) 8e-47 Click
28304106..304384 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp62; ECoA_00349; phage(gi302393145) 1e-51 Click
29304608..304727 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip131; ECoA_00350; phage(gi20065926) 3e-17 Click
30304743..304979 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp64; ECoA_00351; phage(gi302393147) 2e-42 Click
31305077..305382 PHAGE_Stx2_c_II: NinB protein; ECoA_00352; phage(gi302393148) 3e-56 Click
32305379..305906 PHAGE_Stx2_c_II: putative DNA N-6-adenine-methyltransferase; ECoA_00353; phage(gi302393149) 9e-102 Click
33306360..307094 PHAGE_Stx2_c_II: putative antirepressor-like protein; ECoA_00354; phage(gi302393152) 7e-142 Click
34307169..307891 PHAGE_Stx2_c_II: Roi protein; ECoA_00355; phage(gi302393153) 5e-132 Click
35307891..308496 PHAGE_Stx2_c_II: NinG protein; ECoA_00356; phage(gi302393154) 1e-118 Click
36complement(308800..308943) hypothetical protein; ECoA_00357 0.0 Click
37309363..309515 PHAGE_Stx2_c_86: DNA modification methylase; ECoA_00358; phage(gi116222073) 1e-19 Click
38309556..309628 tRNA 0.0 Click
39309641..309714 tRNA 0.0 Click
40309731..309804 tRNA 0.0 Click
41309898..310857 PHAGE_Stx2_c_II: Shiga toxin 2 subunit A; ECoA_00359; phage(gi302393157) 0.0 Click
42310869..311138 PHAGE_Stx2_c_II: Shiga toxin 2 subunit B; ECoA_00360; phage(gi302393158) 1e-46 Click
43complement(313336..314223) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ECoA_00361; phage(gi302393160) 6e-173 Click
44complement(314223..314549) PHAGE_Stx2_c_II: putative transposase; ECoA_00362; phage(gi302393161) 1e-58 Click
45314607..314876 PHAGE_Escher_TL_2011c: hypothetical protein; ECoA_00363; phage(gi418487095) 8e-46 Click
46314873..314998 PHAGE_Escher_TL_2011c: hypothetical protein; ECoA_00364; phage(gi418487096) 7e-19 Click
47315011..315190 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; ECoA_00365; phage(gi302393162) 2e-28 Click
48315231..315503 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp80; ECoA_00366; phage(gi302393163) 1e-43 Click
49315580..315795 PHAGE_Stx2_c_II: holin; ECoA_00367; phage(gi302393164) 2e-35 Click
50complement(316400..318973) PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; ECoA_00373; phage(gi15800640) 7e-76 Click
51326777..326789 attR    ATGGTTTCCGGTA 0.0 Click

Region 5, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(428434..430158) PHAGE_Melano_entomopoxvirus: ORF MSV061 putative LINE reverse transcriptase, similar to Caenorhabditis elegans GB:U00063; ECoA_00496; phage(gi9631308) 9e-08 Click
2complement(431023..431349) PHAGE_Stx2_c_II: putative transposase; ECoA_00498; phage(gi302393161) 1e-58 Click
3complement(432388..432834) PHAGE_Stx2_c_1717: transposase; ECoA_00500; phage(gi209447179) 6e-82 Click
4complement(433009..433287) PHAGE_Entero_2008: putative tail protein; ECoA_00502; phage(gi209427793) 2e-48 Click
5complement(434387..434986) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECoA_00503; phage(gi209427792) 6e-112 Click
6complement(435057..438554) PHAGE_Entero_2008: phage-related tail protein; ECoA_00504; phage(gi209427791) 0.0 Click
7438766..439215 PHAGE_Salmon_1: hypothetical bacteriophage protein; ECoA_00505; phage(gi169257202) 2e-59 Click
8complement(439406..439987) PHAGE_Entero_2008: putative tail assembly protein; ECoA_00506; phage(gi209427790) 4e-101 Click
9complement(439984..440727) PHAGE_Entero_2008: putative tail component K-like protein; ECoA_00507; phage(gi209427789) 2e-140 Click
10complement(440738..441436) PHAGE_Entero_2008: putative tail protein; ECoA_00508; phage(gi209427787) 1e-126 Click
11complement(441436..441777) PHAGE_Entero_2008: putative minor tail protein; ECoA_00509; phage(gi209427786) 1e-63 Click
12complement(441770..444850) PHAGE_Entero_2008: putative tail protein; ECoA_00510; phage(gi209427785) 0.0 Click
13complement(444902..445105) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECoA_00511; phage(gi209427784) 3e-32 Click
14complement(445207..445581) PHAGE_Entero_2008: putative tail assembly protein; ECoA_00512; phage(gi209427783) 6e-65 Click
15complement(445587..446303) PHAGE_Entero_2008: putative tail protein; ECoA_00513; phage(gi209427782) 2e-122 Click
16complement(446372..446716) PHAGE_Entero_2008: putative prophage structural protein; ECoA_00514; phage(gi209427781) 3e-59 Click
17complement(446713..447159) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECoA_00515; phage(gi209427780) 6e-79 Click
18complement(447156..447506) PHAGE_Entero_2008: putative head-tail adaptor; ECoA_00516; phage(gi209427779) 2e-61 Click
19complement(447516..447842) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECoA_00517; phage(gi209427778) 9e-56 Click
20complement(447839..449062) PHAGE_Entero_2008: putative portal protein; ECoA_00518; phage(gi209427777) 0.0 Click
21complement(449059..450363) PHAGE_Entero_2008: putative portal protein; ECoA_00519; phage(gi209427777) 0.0 Click
22complement(450369..450590) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECoA_00520; phage(gi209427801) 6e-36 Click
23complement(450635..451630) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECoA_00521; phage(gi209427776) 0.0 Click
24451782..451853 tRNA 0.0 Click
25451863..451935 tRNA 0.0 Click
26452053..452487 PHAGE_Cafete_BV_PW1: putative eIF-2gamma; ECoA_00523; phage(gi310831469) 1e-15 Click
27452506..453237 Translation elongation factor Tu; ECoA_00524 0.0 Click
28453467..453850 Preprotein translocase subunit SecE; ECoA_00525 0.0 Click
29453852..454397 PHAGE_Synech_S_CRM01: NusG antitermination factor; ECoA_00526; phage(gi333798264) 2e-11 Click

Region 6, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1771953..772711 PHAGE_Plankt_PaV_LD: ABC transporter; ECoA_00848; phage(gi371496158) 2e-31 Click
2complement(773313..773528) PHAGE_Entero_4795: putative tail component; ECoA_00853; phage(gi157166057) 4e-19 Click
3complement(773531..774118) PHAGE_Entero_4795: putative tail component; ECoA_00854; phage(gi157166057) 4e-65 Click
4774428..774967 PHAGE_Entero_4795: hypothetical protein YjhS; ECoA_00856; phage(gi157166028) 3e-25 Click
5775117..775332 PHAGE_Entero_4795: putative S protein; ECoA_00857; phage(gi157166031) 7e-35 Click
6775337..775681 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ECoA_00858; phage(gi157166032) 3e-60 Click
7775732..775962 PHAGE_Entero_2008: putative endolysin; ECoA_00859; phage(gi209427769) 4e-35 Click
8776257..776418 PHAGE_Stx2_c_1717: truncated transposase; ECoA_00860; phage(gi209447151) 3e-23 Click
9777611..777739 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECoA_00862; phage(gi157166059) 9e-19 Click
10complement(777740..778339) PHAGE_Entero_4795: outer membrane protein Lom precursor; ECoA_00863; phage(gi157166058) 2e-98 Click
11complement(778407..781883) PHAGE_Entero_4795: putative tail component; ECoA_00864; phage(gi157166057) 0.0 Click
12complement(782071..782421) PHAGE_Entero_4795: putative tail fiber component; ECoA_00865; phage(gi157166054) 1e-45 Click

Region 7, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1542660..1543649) PHAGE_Campyl_CP21: radical SAM domain-containing protein; ECoA_01566; phage(gi422935302) 4e-06 Click
21544046..1544954 Hypothetical protein UPF0052; ECoA_01567 0.0 Click
3complement(1545145..1547166) PHAGE_Acidia_9: putative helicase; ECoA_01568; phage(gi171473669) 3e-06 Click
41547538..1547681 PHAGE_Stx1_converting: putative antirepressor protein Ant; ECoA_01571; phage(gi302861201) 4e-20 Click
51547693..1547827 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECoA_01572; phage(gi302861202) 2e-17 Click
61547835..1548299 PHAGE_Stx1_converting: endopeptidase Rz; ECoA_01573; phage(gi302861203) 6e-83 Click
7complement(1548331..1548624) PHAGE_Stx1_converting: Bor protein precursor; ECoA_01574; phage(gi302861205) 2e-50 Click
81548864..1548977 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ECoA_01575; phage(gi20065959) 6e-17 Click
91549033..1549839 PHAGE_Stx1_converting: terminase, small subunit; ECoA_01576; phage(gi302861122) 3e-151 Click
10complement(1549859..1550017) hypothetical protein; ECoA_01577 0.0 Click
111550012..1551526 PHAGE_Stx1_converting: terminase, large subunit; ECoA_01578; phage(gi302861123) 0.0 Click
121551526..1553670 PHAGE_Stx1_converting: portal protein; ECoA_01579; phage(gi302861124) 0.0 Click
131553828..1554835 PHAGE_Stx1_converting: hypothetical protein Stx1_gp04; ECoA_01580; phage(gi302861125) 0.0 Click
141554859..1556073 PHAGE_Stx2_c_86: putative virion structural protein; ECoA_01581; phage(gi116222008) 0.0 Click
151556129..1556518 PHAGE_Stx1_converting: hypothetical protein Stx1_gp06; ECoA_01582; phage(gi302861127) 2e-66 Click
161556568..1557029 PHAGE_Stx1_converting: hypothetical protein Stx1_gp07; ECoA_01583; phage(gi302861128) 2e-82 Click
171557013..1557576 PHAGE_Stx1_converting: hypothetical protein Stx1_gp08; ECoA_01584; phage(gi302861129) 2e-104 Click
181557576..1558226 PHAGE_Stx1_converting: hypothetical protein Stx1_gp09; ECoA_01585; phage(gi302861130) 8e-123 Click
191558223..1558357 PHAGE_Stx1_converting: putative tail fiber protein; ECoA_01586; phage(gi302861131) 7e-06 Click
201558380..1560161 PHAGE_Stx1_converting: putative tail fiber protein; ECoA_01587; phage(gi302861131) 0.0 Click
211560163..1560432 PHAGE_Stx1_converting: putative tail fiber protein; ECoA_01588; phage(gi302861132) 4e-47 Click
221560572..1560760 PHAGE_Stx1_converting: hypothetical protein Stx1_gp12; ECoA_01589; phage(gi302861133) 5e-31 Click
231560827..1560940 hypothetical protein; ECoA_01590 0.0 Click
241561055..1562680 PHAGE_Stx1_converting: hypothetical protein Stx1_gp13; ECoA_01591; phage(gi302861134) 0.0 Click
251562677..1563945 PHAGE_Stx1_converting: hypothetical protein Stx1_gp14; ECoA_01592; phage(gi302861135) 0.0 Click
261564095..1564238 PHAGE_Stx1_converting: hypothetical protein Stx1_gp15; ECoA_01593; phage(gi302861136) 5e-24 Click
271564244..1564861 PHAGE_Stx1_converting: hypothetical protein Stx1_gp16; ECoA_01594; phage(gi302861137) 4e-122 Click
281564952..1565686 PHAGE_Stx1_converting: outer membrane protein Lom precursor; ECoA_01595; phage(gi302861138) 4e-140 Click
291565919..1566059 PHAGE_Escher_P13374: prophage host toxic membrane protein; ECoA_01596; phage(gi410491667) 1e-21 Click
301566140..1566517 PHAGE_Stx1_converting: hypothetical protein Stx1_gp18; ECoA_01597; phage(gi302861139) 1e-69 Click
311566611..1567267 PHAGE_Stx1_converting: hypothetical protein Stx1_gp19; ECoA_01598; phage(gi302861140) 5e-122 Click
321567270..1567716 PHAGE_Stx1_converting: hypothetical protein Stx1_gp20; ECoA_01599; phage(gi302861141) 2e-80 Click
331567726..1567977 PHAGE_Escher_TL_2011c: hypothetical protein; ECoA_01600; phage(gi418487118) 2e-40 Click
341567988..1569253 PHAGE_Stx1_converting: hypothetical protein Stx1_gp22; ECoA_01601; phage(gi302861143) 0.0 Click
351569323..1577704 PHAGE_Stx1_converting: hypothetical protein Stx1_gp23; ECoA_01602; phage(gi302861144) 0.0 Click
361577987..1578175 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip069; ECoA_01603; phage(gi20065864) 6e-31 Click
37complement(1578255..1578599) PHAGE_Stx1_converting: hypothetical protein Stx1p076; ECoA_01604; phage(gi302861145) 6e-59 Click
38complement(1579165..1579560) PHAGE_Stx1_converting: hypothetical protein Stx1_gp25; ECoA_01605; phage(gi302861147) 7e-72 Click
39complement(1579560..1580219) PHAGE_Stx2_c_II: hypothetical protein Stx2IIp080; ECoA_01606; phage(gi302393107) 2e-128 Click
40complement(1580726..1580947) PHAGE_Stx1_converting: hypothetical protein Stx1_gp29; ECoA_01609; phage(gi302861150) 8e-38 Click
41complement(1580995..1581624) PHAGE_Stx1_converting: putative anti-repressor protein AntB; ECoA_01610; phage(gi302861151) 6e-117 Click
42complement(1582773..1584101) PHAGE_Lactob_KC5a: putative minor tail protein; ECoA_01611; phage(gi90592623) 8e-06 Click

Region 8, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11974675..1974714 attL    AAAAACCGGAGCCGGACTCCGGTTTTTGTGAAGCTGTCGG 0.0 Click
2complement(1978864..1979994) PHAGE_Entero_mEp235: integrase; ECoA_02044; phage(gi428781836) 4e-56 Click
3complement(1980285..1982756) PHAGE_Entero_mEp460: putative exonuclease; ECoA_02045; phage(gi428782342) 3e-58 Click
4complement(1982849..1983040) hypothetical protein; ECoA_02046 0.0 Click
5complement(1983037..1983225) Division inhibition protein dicB; ECoA_02047 0.0 Click
61983242..1983364 hypothetical protein; ECoA_02048 0.0 Click
71983699..1983932 hypothetical protein; ECoA_02049 0.0 Click
8complement(1983910..1984317) PHAGE_Escher_TL_2011c: hypothetical protein; ECoA_02050; phage(gi418487085) 5e-12 Click
9complement(1984340..1984558) conserved protein, Qin prophage; ECoA_02051 0.0 Click
10complement(1984631..1984930) hypothetical protein; ECoA_02052 0.0 Click
11complement(1985194..1985601) PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; ECoA_02053; phage(gi401817574) 1e-32 Click
121985678..1985905 PHAGE_Pectob_ZF40: putative cro anti-repressor; ECoA_02054; phage(gi422936651) 3e-09 Click
131985949..1986440 hypothetical protein; ECoA_02055 0.0 Click
141986412..1987452 PHAGE_Escher_TL_2011b: hypothetical protein; ECoA_02056; phage(gi418487646) 3e-43 Click
151987718..1987906 PHAGE_Escher_HK639: replication protein 14; ECoA_02057; phage(gi356870655) 4e-11 Click
161988093..1988674 hypothetical protein; ECoA_02058 0.0 Click
171988710..1988835 hypothetical protein; ECoA_02059 0.0 Click
181988957..1989115 PixH protein; ECoA_02060 0.0 Click
191989546..1990292 accessory colonization factor AcfC; ECoA_02061 0.0 Click
201991004..1991261 hypothetical protein; ECoA_02062 0.0 Click
21complement(1991278..1991409) hypothetical protein; ECoA_02063 0.0 Click
221991734..1992657 PHAGE_Entero_mEp460: hypothetical protein; ECoA_02064; phage(gi428782365) 7e-98 Click
231992670..1993029 PHAGE_Escher_HK75: RusA-like protein; ECoA_02065; phage(gi356870726) 6e-36 Click
241993038..1993568 Phage antitermination protein; ECoA_02066 0.0 Click
251993687..1994007 PHAGE_Entero_mEp460: hypothetical protein; ECoA_02067; phage(gi428782368) 5e-08 Click
261994158..1995216 PHAGE_Entero_mEp460: DNA methylase; ECoA_02068; phage(gi428782369) 3e-174 Click
271995257..1995329 tRNA 0.0 Click
281995413..1995486 tRNA 0.0 Click
291996013..1997866 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECoA_02069; phage(gi209427766) 0.0 Click
301998016..1998231 PHAGE_Stx2_c_1717: holin protein S-like protein; ECoA_02070; phage(gi209447171) 7e-35 Click
311998236..1998580 PHAGE_Entero_mEp460: hypothetical protein; ECoA_02071; phage(gi428782371) 2e-19 Click
322007659..2007698 attR    AAAAACCGGAGCCGGACTCCGGTTTTTGTGAAGCTGTCGG 0.0 Click

Region 9, total : 112 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11996703..1996714 attL    TGGATGCAGGGA 0.0 Click
22001978..2002181 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ECoA_02079; phage(gi410491512) 1e-13 Click
3complement(2002217..2003677) PHAGE_Microm_MpV1: hypothetical protein; ECoA_02080; phage(gi313768442) 4e-41 Click
4complement(2003766..2005049) PHAGE_Burkho_phi1026b: gp59; ECoA_02081; phage(gi38707949) 2e-33 Click
52005217..2005423 PHAGE_Entero_2008: putative DNA damage-inducible protein; ECoA_02082; phage(gi209427797) 5e-28 Click
6complement(2005585..2006079) PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECoA_02083; phage(gi209427796) 6e-89 Click
7complement(2006308..2006709) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECoA_02084; phage(gi209427795) 6e-71 Click
8complement(2007699..2007968) PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECoA_02085; phage(gi209427794) 5e-45 Click
9complement(2007970..2008248) PHAGE_Escher_TL_2011c: putative tail fiber protein; ECoA_02086; phage(gi418487108) 2e-51 Click
102008568..2009287 PHAGE_Entero_HK630: tail length tape measure protein H; ECoA_02088; phage(gi428782803) 7e-84 Click
112010649..2010798 hypothetical protein; ECoA_02090 0.0 Click
12complement(2010865..2011056) hypothetical protein; ECoA_02091 0.0 Click
13complement(2011053..2011241) putative cell division inhibition protein; ECoA_02092 0.0 Click
142011213..2011353 hypothetical protein; ECoA_02093 0.0 Click
152011815..2012000 hypothetical protein; ECoA_02094 0.0 Click
16complement(2012187..2012576) PHAGE_Escher_TL_2011c: hypothetical protein; ECoA_02095; phage(gi418487085) 3e-07 Click
17complement(2012588..2012716) hypothetical protein; ECoA_02096 0.0 Click
18complement(2012718..2012873) PHAGE_Salico_CGphi29: hypothetical protein; ECoA_02097; phage(gi472340166) 2e-09 Click
19complement(2013438..2013629) hypothetical protein; ECoA_02098 0.0 Click
20complement(2013657..2014034) PHAGE_Salmon_SPN3UB: putative CI; ECoA_02099; phage(gi423262424) 5e-13 Click
212014311..2014439 PHAGE_Salmon_SPN3UB: putative Cro; ECoA_02100; phage(gi423262425) 7e-07 Click
222014423..2014848 PHAGE_Escher_HK639: cII; ECoA_02101; phage(gi356870652) 8e-06 Click
232014814..2015371 hypothetical protein; ECoA_02102 0.0 Click
242015478..2016680 PHAGE_Entero_phiP27: hypothetical protein P27p17; ECoA_02103; phage(gi18249881) 3e-29 Click
252016687..2017433 PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECoA_02104; phage(gi169257280) 1e-75 Click
262017455..2018225 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECoA_02105; phage(gi116222030) 1e-05 Click
272018241..2018654 LygF; ECoA_02106 0.0 Click
28complement(2019006..2019779) IroE; ECoA_02107 0.0 Click
29complement(2020581..2020715) hypothetical bacteriophage protein; ECoA_02108 0.0 Click
30complement(2020725..2020904) hypothetical protein; ECoA_02109 0.0 Click
312020987..2022036 PHAGE_Entero_mEp460: hypothetical protein; ECoA_02110; phage(gi428782365) 8e-112 Click
322022049..2022420 PHAGE_Escher_HK75: RusA-like protein; ECoA_02111; phage(gi356870726) 1e-36 Click
332022410..2022781 PHAGE_Entero_2008: antitermination protein Q; ECoA_02112; phage(gi209427762) 4e-54 Click
342022933..2023751 putative metal-dependent membrane protease; ECoA_02113 0.0 Click
352024038..2024277 PHAGE_Entero_phiP27: hypothetical protein P27p23; ECoA_02114; phage(gi18249887) 2e-20 Click
36complement(2024341..2024481) hypothetical protein; ECoA_02115 0.0 Click
37complement(2024456..2024569) hypothetical protein; ECoA_02116 0.0 Click
382024696..2025085 Putative transcriptional regulator; ECoA_02117 0.0 Click
392025114..2025186 tRNA 0.0 Click
402025287..2025360 tRNA 0.0 Click
412025853..2027703 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECoA_02118; phage(gi209427766) 0.0 Click
422027879..2028205 PHAGE_Stx2_c_II: putative transposase; ECoA_02119; phage(gi302393161) 1e-58 Click
432028205..2028855 PHAGE_Stx2_c_1717: transposase; ECoA_02120; phage(gi209447179) 1e-62 Click
44complement(2029617..2029757) hypothetical protein; ECoA_02121 0.0 Click
45complement(2029840..2030307) PHAGE_Entero_2008: putative endopeptidase; ECoA_02122; phage(gi209427771) 1e-71 Click
46complement(2030309..2030422) hypothetical protein; ECoA_02123 0.0 Click
47complement(2030643..2031176) PHAGE_Entero_2008: putative endolysin; ECoA_02124; phage(gi209427769) 2e-99 Click
482031294..2031608 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; ECoA_02125; phage(gi116221998) 4e-18 Click
49complement(2031864..2032070) PHAGE_Entero_2008: lysis protein; ECoA_02126; phage(gi209427767) 3e-31 Click
502032078..2032239 hypothetical protein; ECoA_02127 0.0 Click
51complement(2033534..2033653) hypothetical protein; ECoA_02131 0.0 Click
52complement(2033699..2034277) PHAGE_Entero_2008: putative tail assembly protein; ECoA_02132; phage(gi209427790) 9e-99 Click
53complement(2034274..2034909) PHAGE_Entero_2008: putative tail component K-like protein; ECoA_02133; phage(gi209427789) 5e-122 Click
54complement(2035028..2035726) PHAGE_Entero_2008: putative tail protein; ECoA_02134; phage(gi209427787) 7e-129 Click
55complement(2035726..2036055) PROPHAGE_Escher_Sakai: putative minor tail protein; ECoA_02135; phage(gi15832202) 4e-60 Click
56complement(2036052..2038697) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECoA_02136; phage(gi15832203) 0.0 Click
57complement(2038741..2039049) PROPHAGE_Escher_Sakai: putative minor tail protein; ECoA_02137; phage(gi15832204) 2e-57 Click
58complement(2039076..2039498) PROPHAGE_Escher_Sakai: putative minor tail protein; ECoA_02138; phage(gi15832205) 2e-76 Click
59complement(2039512..2040264) PHAGE_Entero_HK630: major tail protein V; ECoA_02139; phage(gi428782800) 1e-112 Click
60complement(2040272..2040670) PROPHAGE_Escher_Sakai: putative minor tail protein U; ECoA_02140; phage(gi15832207) 1e-72 Click
61complement(2040683..2041306) PROPHAGE_Escher_Sakai: putative minor tail protein; ECoA_02141; phage(gi15832208) 6e-112 Click
62complement(2041309..2041557) PHAGE_Entero_mEp213: hypothetical protein; ECoA_02142; phage(gi428782596) 6e-20 Click
63complement(2041583..2041909) PHAGE_Entero_mEp213: hypothetical protein; ECoA_02143; phage(gi428782595) 1e-32 Click
64complement(2041997..2043037) PHAGE_Entero_mEp213: head maturation protease; ECoA_02144; phage(gi428782594) 3e-166 Click
652043159..2043485 PROPHAGE_Escher_Sakai: putative transposase; ECoA_02145; phage(gi15832212) 3e-58 Click
662043485..2044372 PROPHAGE_Escher_Sakai: putative transposase; ECoA_02146; phage(gi15834498) 6e-173 Click
67complement(2044375..2045265) PHAGE_Entero_mEp213: head maturation protease; ECoA_02147; phage(gi428782594) 5e-116 Click
68complement(2045279..2046781) PROPHAGE_Escher_Sakai: putative portal protein; ECoA_02148; phage(gi15832215) 0.0 Click
692049643..2049891 hypothetical protein; ECoA_02152 0.0 Click
70complement(2050041..2050508) PHAGE_Entero_2008: putative endopeptidase; ECoA_02153; phage(gi209427771) 1e-82 Click
71complement(2050516..2050650) PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; ECoA_02154; phage(gi302861202) 2e-17 Click
72complement(2050662..2051231) PHAGE_Entero_2008: putative antirepressor; ECoA_02155; phage(gi209427770) 7e-107 Click
73complement(2051502..2052035) PHAGE_Stx2_c_II: endolysin; ECoA_02156; phage(gi302393165) 1e-103 Click
74complement(2052040..2052255) PHAGE_Stx2_c_II: holin; ECoA_02157; phage(gi302393164) 2e-35 Click
75complement(2052333..2052578) PHAGE_Escher_P13374: hypothetical protein; ECoA_02158; phage(gi410491644) 6e-39 Click
76complement(2052619..2052798) PHAGE_Escher_P13374: hypothetical protein; ECoA_02159; phage(gi410491643) 2e-28 Click
77complement(2052936..2054882) PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECoA_02160; phage(gi302861197) 0.0 Click
78complement(2055393..2055662) PHAGE_Entero_2008: Shiga toxin 1 subunit B; ECoA_02161; phage(gi209427764) 4e-46 Click
79complement(2055672..2056619) PHAGE_Entero_2008: Shiga toxin 1 subunit A; ECoA_02162; phage(gi209427763) 1e-176 Click
80complement(2057126..2057560) PHAGE_Stx1_converting: antitermination protein Q; ECoA_02163; phage(gi302861194) 2e-83 Click
81complement(2057744..2058349) PHAGE_Stx1_converting: NinG protein; ECoA_02164; phage(gi302861192) 1e-118 Click
82complement(2058342..2058518) PHAGE_Entero_mEp234: NinF protein; ECoA_02165; phage(gi428782303) 1e-29 Click
83complement(2058511..2058912) PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; ECoA_02166; phage(gi302861190) 3e-76 Click
84complement(2059088..2059615) PHAGE_Entero_2008: putative DNA N-6-adenine-methyltransferase; ECoA_02167; phage(gi209427758) 1e-101 Click
85complement(2059612..2059917) PHAGE_Entero_2008: putative recombination protein; ECoA_02168; phage(gi209427757) 7e-56 Click
86complement(2060015..2060377) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip131; ECoA_02169; phage(gi20065926) 2e-67 Click
87complement(2060610..2060888) PHAGE_Entero_2008: hypothetical protein YYZ_gp30; ECoA_02170; phage(gi209427755) 2e-51 Click
88complement(2060959..2061249) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; ECoA_02171; phage(gi20065923) 2e-49 Click
89complement(2061246..2061947) PHAGE_Entero_4795: putative replication protein P; ECoA_02172; phage(gi157166012) 1e-131 Click
90complement(2061944..2062882) PHAGE_Entero_4795: putative replication protein O; ECoA_02173; phage(gi157166011) 0.0 Click
91complement(2062915..2063211) PHAGE_Entero_mEpX1: CII protein; ECoA_02174; phage(gi428781917) 7e-48 Click
922063662..2064300 PHAGE_Entero_mEpX1: prophage repressor; ECoA_02175; phage(gi428781915) 4e-121 Click
932064423..2064704 PHAGE_Entero_HK544: hypothetical protein; ECoA_02176; phage(gi428783256) 1e-47 Click
942064831..2065262 PHAGE_Entero_HK544: hypothetical protein; ECoA_02177; phage(gi428783255) 4e-74 Click
952065775..2066047 PHAGE_Entero_HK629: transcription antitermination protein N; ECoA_02178; phage(gi428782056) 7e-45 Click
96complement(2066064..2066645) PHAGE_Entero_HK140: superinfection exclusion protein; ECoA_02179; phage(gi428781984) 4e-109 Click
972066906..2067274 PHAGE_Stx2_c_I: Ea10 protein; ECoA_02180; phage(gi20065907) 5e-68 Click
982067480..2067623 PHAGE_Stx2_c_86: putative host killing protein Kil; ECoA_02181; phage(gi116222047) 8e-20 Click
992067699..2067995 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ECoA_02182; phage(gi116222045) 4e-51 Click
1002068001..2068786 PHAGE_Stx2_c_I: Bet protein; ECoA_02183; phage(gi20065900) 2e-151 Click
1012068939..2069460 PHAGE_Entero_2008: putative exonuclease; Putative; phage phage-encoded enzyme involved in integration-recombination; ECoA_02184(gi209427739) 7e-100 Click
1022069693..2069806 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip099; ECoA_02185; phage(gi20065894) 4e-14 Click
1032069883..2070098 PHAGE_Entero_2008: hypothetical protein YYZ_gp11; ECoA_02186; phage(gi209427737) 5e-35 Click
1042070197..2070418 PHAGE_Entero_2008: hypothetical protein YYZ_gp10; ECoA_02187; phage(gi209427736) 2e-37 Click
1052070415..2071362 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECoA_02188; phage(gi209427735) 0.0 Click
1062071364..2071540 PHAGE_Entero_2008: hypothetical protein YYZ_gp08; ECoA_02189; phage(gi209427734) 9e-29 Click
1072071874..2072230 PHAGE_Entero_2008: hypothetical protein YYZ_gp06; ECoA_02190; phage(gi209427732) 4e-65 Click
1082072227..2072589 PHAGE_Entero_2008: hypothetical protein YYZ_gp05; ECoA_02191; phage(gi209427731) 7e-74 Click
1092072776..2072919 PHAGE_Entero_2008: hypothetical protein YYZ_gp04; ECoA_02192; phage(gi209427730) 7e-21 Click
1102072923..2073057 PHAGE_Entero_2008: hypothetical protein YYZ_gp03; ECoA_02193; phage(gi209427729) 3e-23 Click
1112073187..2073198 attR    TGGATGCAGGGA 0.0 Click
1122073190..2073330 PHAGE_Entero_2008: putative excisionase; ECoA_02194; phage(gi209427728) 8e-23 Click
1132073364..2074650 PHAGE_Entero_2008: putative integrase; ECoA_02195; phage(gi209427727) 0.0 Click
1142074725..2075372 HTH-type transcriptional regulator mlrA; ECoA_02196 0.0 Click
115complement(2075520..2076251) Osmoprotectant ABC transporter inner membrane protein YehW; ECoA_02197 0.0 Click
116complement(2076256..2077182) PHAGE_Plankt_PaV_LD: ABC transporter; ECoA_02198; phage(gi371496158) 4e-25 Click

Region 10, total : 6 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12323866..2323881 attL    TTCGATTCCTGCAGGG 0.0 Click
2complement(2323893..2324051) PHAGE_Entero_HK633: hypothetical protein; ECoA_02432; phage(gi428782546) 7e-16 Click
32324014..2325207 PROPHAGE_Escher_Sakai: putative prophage Sf6-like integrase; ECoA_02433; phage(gi15832485) 0.0 Click
4complement(2325382..2326518) PHAGE_Entero_IME10: gp20; ECoA_02434; phage(gi422934289) 2e-67 Click
5complement(2326528..2327154) PHAGE_Entero_IME10: DNA transfer protein; ECoA_02435; phage(gi422934288) 2e-74 Click
6complement(2327195..2327662) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; ECoA_02436; phage(gi89885999) 2e-64 Click
7complement(2327662..2328192) PHAGE_Entero_Sf6: gene 9 protein; ECoA_02437; phage(gi41057287) 9e-92 Click
82332418..2332433 attR    TTCGATTCCTGCAGGG 0.0 Click

Region 11, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12491595..2491606 attL    CGGATTTAAGAC 0.0 Click
22494009..2494020 attL    AACAAAGTTCAT 0.0 Click
3complement(2501534..2502766) PROPHAGE_Escher_CFT073: putative prophage integrase; ECoA_02618; phage(gi26250313) 6e-143 Click
42503283..2503636 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECoA_02619; phage(gi24111655) 1e-42 Click
5complement(2503678..2504421) Transcriptional regulator, AraC family; ECoA_02620 0.0 Click
62505245..2506018 PHAGE_Pseudo_OBP: putative homing nuclease; ECoA_02621; phage(gi371671534) 2e-38 Click
7complement(2506076..2506630) PHAGE_Entero_2: DNA-invertase; ECoA_02622; phage(gi169936026) 8e-89 Click
82506660..2507070 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECoA_02623; phage(gi431810938) 3e-14 Click
92507091..2507534 PHAGE_Entero_mEp213: tail fiber assembly protein; ECoA_02624; phage(gi428782612) 2e-25 Click
10complement(2507506..2508099) PHAGE_Entero_HK106: tail fiber assembly protein; ECoA_02625; phage(gi428783304) 4e-64 Click
11complement(2508099..2508593) PHAGE_Entero_mEp213: tail fiber; ECoA_02626; phage(gi428782611) 4e-82 Click
12complement(2509518..2509862) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ECoA_02628; phage(gi157166032) 2e-57 Click
13complement(2509867..2510082) PHAGE_Stx2_c_1717: holin protein S-like protein; ECoA_02629; phage(gi209447171) 1e-33 Click
14complement(2510232..2512085) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECoA_02630; phage(gi209427766) 0.0 Click
15complement(2512496..2512663) PHAGE_Entero_P1: TciB; ECoA_02631; phage(gi46401695) 1e-08 Click
16complement(2512660..2513091) PHAGE_Pseudo_AF: putative tellurite resistance protein; ECoA_02632; phage(gi431810338) 3e-30 Click
17complement(2513264..2513337) tRNA 0.0 Click
18complement(2513441..2513513) tRNA 0.0 Click
19complement(2513653..2514207) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECoA_02633; phage(gi399528832) 7e-07 Click
20complement(2514204..2514494) PHAGE_Erwini_phiEt88: hypothetical protein; ECoA_02634; phage(gi327198620) 2e-34 Click
21complement(2514494..2515093) PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; ECoA_02635; phage(gi169257286) 6e-55 Click
222515593..2516984 hypothetical protein; ECoA_02636 0.0 Click
232516984..2517973 Phage protein; ECoA_02637 0.0 Click
24complement(2517941..2519092) PHAGE_Ostreo_2: putative cytosine-specific methyltransferase; ECoA_02638; phage(gi314055145) 7e-27 Click
25complement(2519524..2519769) PHAGE_Salmon_ST64B: hypothetical protein sb32; ECoA_02639; phage(gi23505476) 1e-08 Click
26complement(2519848..2520009) PHAGE_Salmon_c341: Truncated P22 EaA protein; ECoA_02640; phage(gi255252704) 1e-15 Click
27complement(2520020..2520283) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; ECoA_02641; phage(gi399498823) 3e-23 Click
28complement(2520535..2520747) Phage protein; ECoA_02642 0.0 Click
29complement(2520853..2521275) LygF; ECoA_02643 0.0 Click
30complement(2521291..2522052) hypothetical protein; ECoA_02644 0.0 Click
31complement(2522075..2522821) PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECoA_02645; phage(gi169257280) 3e-76 Click
32complement(2522828..2523616) PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; ECoA_02646; phage(gi169257279) 2e-22 Click
332524447..2524866 PHAGE_Entero_HK022: regulatory protein cI; ECoA_02649; phage(gi19343388) 4e-21 Click
342525154..2525288 Phage protein; ECoA_02650 0.0 Click
352525299..2525454 PHAGE_Salico_CGphi29: hypothetical protein; ECoA_02651; phage(gi472340166) 7e-10 Click
36complement(2525451..2525879) Superinfection exclusion protein B; ECoA_02652 0.0 Click
372526349..2526360 attR    AACAAAGTTCAT 0.0 Click
382526381..2526602 PHAGE_Escher_P13374: host killing protein; ECoA_02653; phage(gi410491620) 9e-06 Click
392526596..2526772 PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; ECoA_02654; phage(gi169257274) 5e-06 Click
402526799..2527122 Phage protein; ECoA_02655 0.0 Click
412527224..2529824 PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; ECoA_02656; phage(gi169257272) 3e-75 Click
422529817..2530626 PHAGE_Entero_epsilon15: RecT; ECoA_02657; phage(gi30387413) 1e-80 Click
43complement(2530698..2530820) hypothetical protein; ECoA_02658 0.0 Click
442530869..2531057 Phage protein; ECoA_02659 0.0 Click
452531157..2531372 ydaQ protein; ECoA_02660 0.0 Click
462531461..2532609 PHAGE_Salmon_1: putative bacteriophage integrase; ECoA_02661; phage(gi169257156) 1e-82 Click
472532661..2533596 PHAGE_Parame_FR483: hypothetical protein FR483_N404R; ECoA_02662; phage(gi155370502) 3e-08 Click
48complement(2533725..2535098) PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; ECoA_02663; phage(gi310831360) 1e-46 Click
492538880..2538891 attR    CGGATTTAAGAC 0.0 Click

Region 12, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2657872..2658453) PHAGE_Entero_lambda: Putative fiber assembly protein; ECoA_02795; phage(gi9626269) 1e-101 Click
2complement(2658453..2660003) PHAGE_Entero_lambda: Tail fiber; ECoA_02796; phage(gi9626268) 2e-87 Click
3complement(2659964..2660098) hypothetical protein; ECoA_02797 0.0 Click
42660134..2660871 PHAGE_Entero_lambda: hypothetical protein lambdap90; ECoA_02798; phage(gi9626267) 1e-52 Click
52661304..2661432 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECoA_02799; phage(gi157166059) 9e-19 Click
6complement(2661433..2662032) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECoA_02800; phage(gi148609401) 3e-112 Click
7complement(2662099..2665497) PHAGE_Entero_lambda: tail:host specificity protein; ECoA_02801; phage(gi9626264) 0.0 Click
8complement(2665558..2666130) PHAGE_Entero_lambda: tail component; ECoA_02802; phage(gi9626263) 1e-100 Click
9complement(2666127..2666870) PHAGE_Entero_mEp460: tail fiber component; ECoA_02803; phage(gi428782332) 2e-149 Click
10complement(2666876..2667574) PHAGE_Entero_lambda: tail component; ECoA_02804; phage(gi9626261) 5e-134 Click
11complement(2667574..2667903) PHAGE_Entero_lambda: tail component; ECoA_02805; phage(gi9626260) 1e-56 Click
12complement(2667900..2670449) PHAGE_Entero_lambda: tail component; ECoA_02806; phage(gi9626259) 0.0 Click
13complement(2670442..2670876) PHAGE_Entero_lambda: tail component; ECoA_02807; phage(gi9626258) 2e-81 Click
14complement(2670858..2671280) PHAGE_Entero_lambda: tail component; ECoA_02808; phage(gi9626257) 2e-73 Click
15complement(2671296..2672036) PHAGE_Entero_lambda: tail component; ECoA_02809; phage(gi9626256) 3e-133 Click
16complement(2672044..2672439) PHAGE_Entero_lambda: tail component; ECoA_02810; phage(gi9626255) 2e-72 Click
17complement(2672436..2673014) PHAGE_Entero_lambda: tail component; ECoA_02811; phage(gi9626254) 6e-101 Click
18complement(2673026..2673379) PHAGE_Entero_lambda: head-tail joining protein; ECoA_02812; phage(gi9626253) 8e-62 Click
19complement(2673391..2673789) PHAGE_Entero_lambda: DNA packaging protein; ECoA_02813; phage(gi9626252) 3e-67 Click
20complement(2673945..2674211) Cell division topological specificity factor MinE; ECoA_02815 0.0 Click
21complement(2674215..2675027) PHAGE_Natria_PhiCh1: putative plasmid partitioning protein Soj; ECoA_02816; phage(gi22091150) 3e-06 Click
22complement(2675051..2675746) Septum site-determining protein MinC; ECoA_02817 0.0 Click
232676266..2676634 PHAGE_Salmon_1: hypothetical protein STM0906.1n.Fels1; ECoA_02818; phage(gi169257180) 3e-25 Click
24complement(2676737..2677138) PHAGE_Gifsy_1: hypothetical protein STM2610.Gifsy1; ECoA_02819; phage(gi169257237) 4e-57 Click

Region 13, total : 47 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2799059..2799262) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECoA_02961; phage(gi209427784) 6e-33 Click
2complement(2799364..2799738) PHAGE_Entero_2008: putative tail assembly protein; ECoA_02962; phage(gi209427783) 4e-67 Click
3complement(2799753..2800469) PHAGE_Entero_2008: putative tail protein; ECoA_02963; phage(gi209427782) 1e-131 Click
4complement(2800535..2800879) PHAGE_Entero_2008: putative prophage structural protein; ECoA_02964; phage(gi209427781) 6e-60 Click
5complement(2800876..2801322) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECoA_02965; phage(gi209427780) 6e-79 Click
6complement(2801319..2801669) PHAGE_Entero_2008: putative head-tail adaptor; ECoA_02966; phage(gi209427779) 8e-62 Click
7complement(2801679..2802005) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECoA_02967; phage(gi209427778) 3e-55 Click
8complement(2802008..2804527) PHAGE_Entero_2008: putative portal protein; ECoA_02968; phage(gi209427777) 0.0 Click
9complement(2804533..2804754) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECoA_02969; phage(gi209427801) 2e-36 Click
10complement(2804799..2805296) PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECoA_02970; phage(gi209427776) 2e-89 Click
11complement(2805659..2806000) PHAGE_Entero_2008: putative minor tail protein; ECoA_02972; phage(gi209427786) 4e-64 Click
12complement(2805993..2809235) PHAGE_Entero_2008: putative tail protein; ECoA_02973; phage(gi209427785) 0.0 Click
13complement(2809288..2809491) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECoA_02974; phage(gi209427784) 3e-32 Click
14complement(2809593..2809967) PHAGE_Entero_2008: putative tail assembly protein; ECoA_02975; phage(gi209427783) 2e-65 Click
15complement(2809973..2810689) PHAGE_Entero_2008: putative tail protein; ECoA_02976; phage(gi209427782) 3e-120 Click
16complement(2810748..2811092) PHAGE_Entero_2008: putative prophage structural protein; ECoA_02977; phage(gi209427781) 6e-60 Click
17complement(2811089..2811322) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECoA_02978; phage(gi209427780) 2e-40 Click
182811370..2811969 Inner membrane protein YjgN; ECoA_02980 0.0 Click
192811953..2812399 PHAGE_Stx2_c_1717: transposase; ECoA_02981; phage(gi209447179) 6e-82 Click
20complement(2812481..2814331) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECoA_02982; phage(gi209427766) 0.0 Click
21complement(2814380..2814544) hypothetical protein; ECoA_02983 0.0 Click
22complement(2814645..2814812) PHAGE_Entero_P1: TciB; ECoA_02984; phage(gi46401695) 3e-08 Click
23complement(2814809..2815237) PHAGE_Pseudo_AF: putative tellurite resistance protein; ECoA_02985; phage(gi431810338) 2e-26 Click
24complement(2815414..2815487) tRNA 0.0 Click
25complement(2815504..2815577) tRNA 0.0 Click
26complement(2815588..2815660) tRNA 0.0 Click
27complement(2815871..2816560) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECoA_02986; phage(gi169257244) 1e-80 Click
28complement(2816557..2816916) PHAGE_Escher_HK75: RusA-like protein; ECoA_02987; phage(gi356870726) 1e-38 Click
29complement(2816929..2817978) PHAGE_Entero_mEp460: hypothetical protein; ECoA_02988; phage(gi428782365) 4e-110 Click
302818061..2818240 hypothetical protein; ECoA_02989 0.0 Click
312818250..2818384 hypothetical bacteriophage protein; ECoA_02990 0.0 Click
32complement(2818827..2818976) hypothetical protein; ECoA_02991 0.0 Click
33complement(2819047..2819631) PHAGE_Entero_cdtI: Valyl-tRNA synthetase; ECoA_02992; phage(gi148609417) 2e-14 Click
34complement(2819688..2820083) LygF; ECoA_02993 0.0 Click
35complement(2820099..2820614) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECoA_02994; phage(gi116222030) 7e-06 Click
36complement(2820689..2820868) hypothetical protein; ECoA_02995 0.0 Click
37complement(2820894..2821634) PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECoA_02996; phage(gi169257280) 8e-77 Click
38complement(2821641..2822528) PHAGE_Entero_phiP27: hypothetical protein P27p17; ECoA_02997; phage(gi18249881) 3e-26 Click
39complement(2822626..2823051) PHAGE_Entero_mEp237: CII protein; ECoA_02998; phage(gi435439306) 3e-05 Click
402823601..2823819 hypothetical protein; ECoA_02999 0.0 Click
412823804..2824031 stability determinant; ECoA_03000 0.0 Click
422824607..2824963 hypothetical protein; ECoA_03001 0.0 Click
432825035..2825253 hypothetical protein; ECoA_03002 0.0 Click
44complement(2825257..2825421) conserved domain protein; ECoA_03003 0.0 Click
45complement(2825623..2825793) hypothetical protein; ECoA_03004 0.0 Click
462825822..2826010 Division inhibition protein dicB; ECoA_03005 0.0 Click
472826007..2826198 hypothetical protein; ECoA_03006 0.0 Click
482826291..2828762 PHAGE_Entero_mEp460: putative exonuclease; ECoA_03007; phage(gi428782342) 4e-58 Click
492828850..2829086 PHAGE_Entero_2008: putative excisionase; ECoA_03008; phage(gi209427728) 4e-16 Click
502829121..2829276 PHAGE_Entero_2008: putative integrase; ECoA_03009; phage(gi209427727) 1e-08 Click
512829606..2829812 PHAGE_Entero_2008: putative integrase; ECoA_03010; phage(gi209427727) 1e-18 Click

Region 14, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13167886..3167948 attL    CTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA 0.0 Click
2complement(3168055..3169056) PHAGE_Haemop_HP2: integrase; ECoA_03362; phage(gi17981816) 3e-105 Click
3complement(3169062..3169409) hypothetical protein; ECoA_03363 0.0 Click
4complement(3169439..3170089) putative membrane protein; ECoA_03364 0.0 Click
5complement(3170105..3170365) PHAGE_Burkho_phiE255: gp46; ECoA_03365; phage(gi134288790) 9e-10 Click
63170808..3171011 PHAGE_Vibrio_kappa: putative regulator; ECoA_03366; phage(gi165970239) 6e-10 Click
73171033..3171383 hypothetical protein; ECoA_03367 0.0 Click
83171394..3171672 hypothetical protein; ECoA_03368 0.0 Click
93171684..3171926 hypothetical protein; ECoA_03369 0.0 Click
103171923..3172036 hypothetical protein; ECoA_03370 0.0 Click
113172129..3172545 hypothetical protein; ECoA_03371 0.0 Click
123173654..3173884 putative derepression protein; ECoA_03375 0.0 Click
133173957..3174322 hypothetical protein; ECoA_03376 0.0 Click
143174329..3177151 PHAGE_Entero_PsP3: gp36; ECoA_03377; phage(gi41057388) 1e-86 Click
153177228..3178187 plasmid segregation protein ParM; ECoA_03378 0.0 Click
16complement(3178526..3179215) PROPHAGE_Escher_EDL933: transposase for IS629; ECoA_03379; phage(gi15801145) 3e-129 Click
17complement(3179215..3179490) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECoA_03380; phage(gi157166066) 5e-48 Click
183179712..3180128 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; ECoA_03381; phage(gi16129505) 5e-66 Click
19complement(3180172..3180648) Serine acetyltransferase; ECoA_03382 0.0 Click
20complement(3180901..3181389) PHAGE_Entero_PsP3: gp25; ECoA_03383; phage(gi41057377) 2e-32 Click
21complement(3181402..3182103) Phage protein; ECoA_03384 0.0 Click
22complement(3182115..3184205) PHAGE_Entero_PsP3: gp24; ECoA_03385; phage(gi41057376) 7e-90 Click
23complement(3184192..3184320) PHAGE_Entero_PsP3: gp23.5; ECoA_03386; phage(gi41057394) 3e-06 Click
24complement(3184356..3184721) PROPHAGE_Salmon_Ty2: putative phage tail protein; ECoA_03387; phage(gi29143760) 2e-06 Click
25complement(3184776..3185288) PHAGE_Entero_PsP3: gp22; ECoA_03388; phage(gi41057374) 3e-32 Click
26complement(3185288..3186472) PHAGE_Erwini_ENT90: tail sheath protein; ECoA_03389; phage(gi431810939) 7e-101 Click
273186452..3186583 hypothetical protein; ECoA_03390 0.0 Click
283186630..3186953 PHAGE_Entero_PsP3: gp26; ECoA_03391; phage(gi41057378) 1e-14 Click
29complement(3186904..3188094) PROPHAGE_Escher_MG1655: IS30 transposase; ECoA_03392; phage(gi16132105) 0.0 Click
303189006..3189068 attR    CTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA 0.0 Click

Region 15, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13988733..3988744 attL    GGGCTTTTCAGA 0.0 Click
23992930..3993751 PHAGE_Cronob_vB_CsaM_GAP32: putative Sir2-like protein; ECoA_04195; phage(gi414087036) 4e-19 Click
3complement(3993907..3994953) ABC transporter, periplasmic spermidine putrescine-binding protein PotD; ECoA_04196 0.0 Click
4complement(3994950..3995744) spermidine/putrescine ABC transporter membrane protein; ECoA_04197 0.0 Click
5complement(3995911..3996930) PHAGE_Entero_mEp235: integrase; ECoA_04198; phage(gi428781836) 2e-49 Click
6complement(3996998..3997267) Putative excisionase; ECoA_04199 0.0 Click
7complement(3997329..3997673) PHAGE_Entero_mEp460: putative exonuclease; ECoA_04200; phage(gi428782342) 6e-34 Click
83997851..3998366 PHAGE_Entero_HK630: HkaP protein; ECoA_04201; phage(gi428782827) 2e-12 Click
9complement(3998481..3998711) PHAGE_Salico_CGphi29: hypothetical protein; ECoA_04202; phage(gi472340166) 4e-10 Click
10complement(3998949..3999425) Rac prophage repressor; ECoA_04203 0.0 Click
113999857..4000282 PHAGE_Pectob_ZF40: putative cII repressor; ECoA_04204; phage(gi422936652) 2e-05 Click
124000351..4001388 PHAGE_Escher_TL_2011b: hypothetical protein; ECoA_04205; phage(gi418487646) 4e-48 Click
134001420..4001842 PHAGE_Escher_HK639: replication protein 14; ECoA_04206; phage(gi356870655) 8e-32 Click
144001876..4002592 hypothetical protein; ECoA_04207 0.0 Click
154002652..4002906 hypothetical protein; ECoA_04208 0.0 Click
164003661..4003783 PHAGE_Salmon_E1: hypothetical protein VIP0051; ECoA_04211; phage(gi170676326) 1e-05 Click
174003770..4004207 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; ECoA_04212; phage(gi89152464) 1e-11 Click
184004209..4004400 PHAGE_Entero_mEp460: hypothetical protein; ECoA_04213; phage(gi428782344) 5e-27 Click
194004403..4004990 PHAGE_Entero_mEp460: hypothetical protein; ECoA_04214; phage(gi428782343) 7e-40 Click
204005061..4005210 hypothetical protein; ECoA_04215 0.0 Click
21complement(4005653..4005787) hypothetical bacteriophage protein; ECoA_04216 0.0 Click
22complement(4005797..4005976) hypothetical protein; ECoA_04217 0.0 Click
234006059..4007108 PHAGE_Entero_mEp460: hypothetical protein; ECoA_04218; phage(gi428782365) 2e-109 Click
244007121..4007495 PHAGE_Escher_HK75: RusA-like protein; ECoA_04219; phage(gi356870726) 2e-34 Click
254007492..4008313 PHAGE_Entero_HK225: late gene regulator Q; ECoA_04220; phage(gi428782441) 7e-91 Click
264008767..4008913 PHAGE_Pseudo_AF: putative tellurite resistance protein; ECoA_04221; phage(gi431810338) 4e-07 Click
274008910..4009077 PHAGE_Entero_P1: TciB; ECoA_04222; phage(gi46401695) 1e-08 Click
284009215..4009343 hypothetical protein; ECoA_04223 0.0 Click
294009392..4011329 PHAGE_Entero_4795: hypothetical protein YjhS; ECoA_04224; phage(gi157166028) 0.0 Click
304011477..4011659 PHAGE_Escher_P13374: hypothetical protein; ECoA_04225; phage(gi410491643) 3e-18 Click
314011697..4011966 PHAGE_Escher_P13374: hypothetical protein; ECoA_04226; phage(gi410491644) 1e-26 Click
324012042..4012257 PHAGE_Stx2_c_1717: holin protein S-like protein; ECoA_04227; phage(gi209447171) 2e-34 Click
334012262..4012606 PHAGE_Entero_mEp460: hypothetical protein; ECoA_04228; phage(gi428782371) 3e-20 Click
34complement(4012938..4013099) PHAGE_Stx2_c_1717: truncated transposase; ECoA_04230; phage(gi209447151) 3e-23 Click
354019501..4019512 attR    GGGCTTTTCAGA 0.0 Click

Region 16, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4031428..4035288) PHAGE_Aotine_1: membrane protein A23; ECoA_04247; phage(gi360041016) 1e-07 Click
2complement(4035449..4035598) hypothetical protein; ECoA_04248 0.0 Click
3complement(4035725..4035797) tRNA 0.0 Click
4complement(4035898..4036695) Putative inner membrane protein; ECoA_04249 0.0 Click
54036789..4036875 tRNA 0.0 Click
64036895..4036906 attL    ACATCATTAAGT 0.0 Click
7complement(4036931..4037953) PHAGE_Salmon_ST64B: Integrase protein; ECoA_04250; phage(gi23505472) 2e-102 Click
8complement(4037953..4038156) hypothetical protein; ECoA_04251 0.0 Click
9complement(4038215..4040686) PHAGE_Entero_mEp460: putative exonuclease; ECoA_04252; phage(gi428782342) 4e-54 Click
10complement(4040782..4040970) hypothetical protein; ECoA_04253 0.0 Click
11complement(4040967..4041155) Division inhibition protein dicB; ECoA_04254 0.0 Click
124041184..4041303 hypothetical protein; ECoA_04255 0.0 Click
13complement(4041636..4041788) PHAGE_Salico_CGphi29: hypothetical protein; ECoA_04256; phage(gi472340166) 1e-08 Click
14complement(4042063..4042404) PHAGE_Entero_mEp390: prophage repressor; ECoA_04257; phage(gi428782701) 9e-13 Click
154043029..4043454 PHAGE_Pectob_ZF40: putative cII repressor; ECoA_04258; phage(gi422936652) 4e-06 Click
164043523..4044560 PHAGE_Escher_TL_2011b: hypothetical protein; ECoA_04259; phage(gi418487646) 1e-46 Click
174044592..4045014 PHAGE_Escher_HK639: replication protein 14; ECoA_04260; phage(gi356870655) 5e-31 Click
184045049..4045747 hypothetical protein; ECoA_04261 0.0 Click
194046966..4047529 PHAGE_Entero_mEp460: hypothetical protein; ECoA_04266; phage(gi428782343) 5e-41 Click
204047594..4047743 hypothetical protein; ECoA_04267 0.0 Click
21complement(4048184..4048369) hypothetical bacteriophage protein; ECoA_04268 0.0 Click
224048590..4049639 PHAGE_Entero_mEp460: hypothetical protein; ECoA_04269; phage(gi428782365) 4e-111 Click
234049652..4050011 PHAGE_Escher_HK75: RusA-like protein; ECoA_04270; phage(gi356870726) 1e-37 Click
244050008..4050697 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECoA_04271; phage(gi169257244) 9e-80 Click
254050728..4050850 putative Q antiterminator of prophage; ECoA_04272 0.0 Click
264050908..4050980 tRNA 0.0 Click
274050991..4051064 tRNA 0.0 Click
284051081..4051154 tRNA 0.0 Click
294051337..4051765 PHAGE_Pseudo_AF: putative tellurite resistance protein; ECoA_04273; phage(gi431810338) 3e-26 Click
304051762..4051929 PHAGE_Entero_P1: TciB; ECoA_04274; phage(gi46401695) 1e-08 Click
314052067..4052195 hypothetical protein; ECoA_04275 0.0 Click
324052244..4054094 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECoA_04276; phage(gi209427766) 0.0 Click
33complement(4054389..4054535) hypothetical protein; ECoA_04277 0.0 Click
344054543..4054749 PHAGE_Stx2_c_1717: holin protein S-like protein; ECoA_04278; phage(gi209447171) 6e-33 Click
354054754..4055098 PHAGE_Entero_mEp460: hypothetical protein; ECoA_04279; phage(gi428782371) 2e-19 Click
364055149..4055682 PHAGE_Entero_2008: putative endolysin; ECoA_04280; phage(gi209427769) 4e-104 Click
374057399..4057410 attR    ACATCATTAAGT 0.0 Click

Region 17, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4146200..4146889) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECoA_04381; phage(gi169257244) 3e-81 Click
24147364..4148323 Putative outer membrane protein; ECoA_04382 0.0 Click
3complement(4148535..4148816) PHAGE_Entero_Sf6: gene 58 protein; ECoA_04383; phage(gi41057331) 7e-51 Click
4complement(4149703..4149870) PHAGE_Entero_P1: TciB; ECoA_04385; phage(gi46401695) 1e-06 Click
5complement(4149956..4150714) Phage protein; ECoA_04386 0.0 Click
6complement(4150765..4150881) hypothetical protein; ECoA_04387 0.0 Click
7complement(4150952..4151575) PHAGE_Entero_mEpX1: late gene regulator Q; ECoA_04388; phage(gi428781929) 7e-116 Click
8complement(4151572..4152237) PHAGE_Stx2_c_1717: NinI protein; ECoA_04389; phage(gi209447164) 3e-130 Click
94152383..4152919 PHAGE_Entero_2008: putative tail protein; ECoA_04391; phage(gi209427785) 4e-97 Click
104152912..4153253 PHAGE_Entero_2008: putative minor tail protein; ECoA_04392; phage(gi209427786) 3e-63 Click
114153253..4153951 PHAGE_Entero_2008: putative tail protein; ECoA_04393; phage(gi209427787) 4e-131 Click
124154302..4154442 hypothetical protein; ECoA_04394 0.0 Click
134154745..4155623 PHAGE_Salmon_vB_SemP_Emek: antirepressor; ECoA_04395; phage(gi399498814) 2e-94 Click
144155677..4156414 PHAGE_Entero_2008: putative tail component K-like protein; ECoA_04396; phage(gi209427789) 3e-151 Click
154156411..4156596 PHAGE_Entero_2008: putative tail assembly protein; ECoA_04397; phage(gi209427790) 4e-11 Click
164156718..4159066 PHAGE_Staphy_vB_SauM_Romulus: pentapeptide repeat-containing protein; ECoA_04398; phage(gi472437873) 8e-07 Click

Region 18, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14172259..4172279 attL    CGGTGTAGTTAATGGTGTAGT 0.0 Click
24172306..4173535 PHAGE_Salmon_vB_SosS_Oslo: integrase; ECoA_04412; phage(gi399528791) 3e-59 Click
34174146..4174889 hypothetical protein; ECoA_04413 0.0 Click
44174966..4175112 hypothetical protein; ECoA_04414 0.0 Click
54175719..4176018 hypothetical protein; ECoA_04418 0.0 Click
64176015..4178147 PHAGE_Thermo_THSA_485A: protein of unknown function DUF927; ECoA_04419; phage(gi397912648) 5e-21 Click
7complement(4178283..4178420) hypothetical protein; ECoA_04420 0.0 Click
84178518..4178769 hypothetical protein; ECoA_04421 0.0 Click
94178766..4179176 PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ECoA_04422; phage(gi115304283) 1e-09 Click
104179265..4179459 putative transcription regulator; ECoA_04423 0.0 Click
114179584..4179808 hypothetical protein; ECoA_04424 0.0 Click
124180101..4181258 PHAGE_Salmon_ST64B: Major capsid protein precursor; ECoA_04425; phage(gi23505451) 2e-52 Click
134181298..4181870 PHAGE_Entero_1: prohead protease; ECoA_04426; phage(gi225626394) 5e-30 Click
144181872..4183083 PHAGE_Salmon_ST64B: Portal Protein; ECoA_04427; phage(gi23505449) 2e-43 Click
154183080..4183418 PHAGE_Entero_HK97: putative head-tail adaptor; ECoA_04428; phage(gi9634168) 3e-25 Click
164183415..4183711 PHAGE_Salmon_ST64B: hypothetical protein sb8; ECoA_04429; phage(gi23505453) 2e-05 Click
174183939..4184151 HNH endonuclease family protein; ECoA_04430 0.0 Click
184184144..4184317 hypothetical protein; ECoA_04431 0.0 Click
194184441..4184797 PHAGE_Salmon_ST64B: terminase small subunit; ECoA_04432; phage(gi23505446) 5e-12 Click
204184964..4186442 PHAGE_Burkho_KS9: terminase gp2; ECoA_04433; phage(gi255033734) 1e-81 Click
214186456..4186737 hypothetical bacteriophage protein; ECoA_04434 0.0 Click
224187487..4187507 attR    CGGTGTAGTTAATGGTGTAGT 0.0 Click

Region 19, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14179253..4179264 attL    TGGGGTGAAGTC 0.0 Click
2complement(4193105..4193566) PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; ECoA_04443; phage(gi34419395) 6e-05 Click
3complement(4193576..4194109) hypothetical protein; ECoA_04444 0.0 Click
44194401..4195651 isocitrate dehydrogenase; ECoA_04445 0.0 Click
5complement(4195765..4196907) PHAGE_Entero_mEp235: integrase; ECoA_04446; phage(gi428781836) 5e-61 Click
64197237..4198061 PHAGE_Entero_lambda: DNA replication protein; ECoA_04447; phage(gi9626295) 2e-99 Click
74198058..4198759 PHAGE_Entero_lambda: DNA replication protein; ECoA_04448; phage(gi9626296) 4e-129 Click
84198756..4199058 PHAGE_Entero_lambda: ren exclusion protein; ECoA_04449; phage(gi9626297) 2e-43 Click
94199126..4199458 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECoA_04450; phage(gi311992758) 1e-10 Click
104199638..4199650 attL    AAAATTAAACAAA 0.0 Click
114199703..4201229 PHAGE_Bacill_WBeta: putative site-specific recombinase; ECoA_04451; phage(gi85701406) 5e-09 Click
124201731..4202186 PHAGE_Cronob_phiES15: hypothetical protein; ECoA_04452; phage(gi401817579) 9e-59 Click
134202186..4202356 PHAGE_Escher_HK639: NinE; ECoA_04453; phage(gi356870663) 1e-14 Click
144202349..4202639 PHAGE_Entero_mEp237: hypothetical protein; ECoA_04454; phage(gi435439317) 3e-48 Click
154202636..4202998 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECoA_04455; phage(gi435439318) 1e-61 Click
164204131..4204448 PHAGE_Salmon_ST160: Gp13; ECoA_04458; phage(gi318065943) 5e-40 Click
174204435..4204911 PHAGE_Escher_HK75: lysozyme; ECoA_04459; phage(gi356870730) 6e-85 Click
184204908..4205369 PHAGE_Entero_lambda: cell lysis protein; ECoA_04460; phage(gi9626310) 3e-80 Click
19complement(4205401..4205694) PHAGE_Entero_lambda: Bor protein precursor; ECoA_04461; phage(gi19263395) 6e-50 Click
204205742..4205754 attR    AAAATTAAACAAA 0.0 Click
21complement(4205986..4206396) PHAGE_Entero_lambda: putative envelope protein; ECoA_04462; phage(gi19263396) 2e-74 Click
224206682..4206888 PHAGE_Entero_lambda: hypothetical protein lambdap79; ECoA_04463; phage(gi19263397) 1e-32 Click
23complement(4207053..4207187) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECoA_04464; phage(gi209427772) 5e-09 Click
244207863..4207874 attR    TGGGGTGAAGTC 0.0 Click

Region 20, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4601991..4602746) PHAGE_Ostreo_2: mRNA capping enzyme; ECoA_04883; phage(gi314055174) 9e-05 Click
2complement(4602733..4603887) PHAGE_Emilia_86: putative serine palmitoyltransferase; ECoA_04884; phage(gi73852520) 4e-28 Click
3complement(4603884..4604924) Biotin synthase; ECoA_04885 0.0 Click
44605068..4606300 PHAGE_Mycoba_Myrna: gp183; ECoA_04886; phage(gi203454746) 2e-06 Click
54606359..4606835 UPF0098 protein ybhB; ECoA_04887 0.0 Click
6complement(4607382..4608005) PHAGE_Entero_Sf6: gene 54 protein; ECoA_04889; phage(gi41057342) 2e-114 Click
74608398..4609045 PHAGE_Stx2_c_I: Bet protein; ECoA_04890; phage(gi20065900) 1e-125 Click
84609042..4609722 PHAGE_Stx1_converting: exonuclease; Putative; phage phage-encoded enzyme involved in integration-recombination; ECoA_04891(gi302861167) 2e-131 Click
94609719..4609901 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip101; ECoA_04892; phage(gi20065896) 2e-28 Click
104609874..4610065 PHAGE_Stx1_converting: hypothetical protein Stx1_gp43; ECoA_04893; phage(gi302861165) 5e-27 Click
114610142..4610357 PHAGE_Stx1_converting: hypothetical protein Stx1_gp42; ECoA_04894; phage(gi302861164) 3e-34 Click
124610456..4610677 PHAGE_Stx1_converting: hypothetical protein Stx1_gp40; ECoA_04895; phage(gi302861162) 4e-37 Click
13complement(4610888..4611037) Putative membrane protein; ECoA_04896 0.0 Click
14complement(4611309..4611431) hypothetical protein; ECoA_04897 0.0 Click
15complement(4611718..4611888) hypothetical protein; ECoA_04898 0.0 Click
164613288..4613361 tRNA 0.0 Click
174613645..4614211 PHAGE_Parame_FR483: hypothetical protein FR483_N177L; ECoA_04900; phage(gi155370275) 4e-09 Click
184614208..4614636 Putative membrane protein; ECoA_04901 0.0 Click
194614709..4616265 Glutamate--cysteine ligase; ECoA_04902 0.0 Click
204616415..4616930 S-ribosylhomocysteinase; ECoA_04903 0.0 Click
21complement(4616994..4618532) Multidrug resistance protein B; ECoA_04904 0.0 Click
22complement(4618549..4619529) Multidrug resistance protein A; ECoA_04905 0.0 Click
234619533..4619820 hypothetical protein; ECoA_04906 0.0 Click
24complement(4619848..4620378) Transcription repressor; ECoA_04907 0.0 Click
25complement(4620469..4620804) hypothetical protein; ECoA_04908 0.0 Click
26complement(4620794..4621486) hypothetical protein; ECoA_04909 0.0 Click
27complement(4621655..4622839) MFS permease protein; ECoA_04910 0.0 Click
28complement(4622826..4622978) hypothetical protein; ECoA_04911 0.0 Click
29complement(4623031..4624023) L-proline glycine betaine binding ABC transporter protein ProX; ECoA_04912 0.0 Click
30complement(4624080..4625144) PHAGE_Lactob_KC5a: putative minor tail protein; ECoA_04913; phage(gi90592623) 6e-06 Click
31complement(4625137..4626339) PHAGE_Plankt_PaV_LD: ABC transporter; ECoA_04914; phage(gi371496158) 6e-24 Click
32complement(4626695..4627654) PHAGE_Mycoba_Myrna: gp256; ECoA_04915; phage(gi203454817) 4e-128 Click
33complement(4627664..4629808) PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; ECoA_04916; phage(gi158079505) 0.0 Click
34complement(4629781..4630191) PHAGE_Bacill_SP10: ribonucleotide reductase stimulatory protein; ECoA_04917; phage(gi418489617) 7e-14 Click
35complement(4630188..4630433) PHAGE_Mycoba_Porky: gp37; ECoA_04918; phage(gi194303333) 3e-10 Click
36complement(4630642..4631073) 4-carboxymuconolactone decarboxylase domain/alkylhydroperoxidase AhpD family core domain protein; ECoA_04919 0.0 Click
374631161..4632495 PHAGE_Strept_TG1: putative regulator, GntR family; ECoA_04920; phage(gi410491962) 2e-05 Click

Region 21, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4819495..4820382) PROPHAGE_Escher_Sakai: putative transposase; ECoA_05093; phage(gi15834498) 6e-173 Click
2complement(4820382..4820708) PROPHAGE_Escher_Sakai: putative transposase; ECoA_05094; phage(gi15832212) 3e-58 Click
34820892..4821353 Hypothetical lipoprotein yehR; ECoA_05095 0.0 Click
4complement(4821395..4821865) hypothetical protein; ECoA_05096 0.0 Click
5complement(4821912..4822631) Hypothetical response regulatory protein yehT; ECoA_05097 0.0 Click
6complement(4822628..4824313) PHAGE_Entero_2008: putative 2-component sensor protein YehU; ECoA_05098; phage(gi209427798) 0.0 Click
74824402..4824530 hypothetical protein; ECoA_05099 0.0 Click
84824572..4824712 hypothetical protein; ECoA_05100 0.0 Click
94824828..4825076 PHAGE_Entero_2008: putative DNA damage-inducible protein; ECoA_05101; phage(gi209427797) 3e-40 Click
10complement(4825444..4825713) PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECoA_05102; phage(gi209427794) 4e-44 Click
11complement(4825715..4825993) PHAGE_Entero_2008: putative tail protein; ECoA_05103; phage(gi209427793) 2e-48 Click

Region 22, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14965469..4965633 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECoA_05243; phage(gi209427772) 5e-08 Click
2complement(4966077..4966244) hypothetical protein; ECoA_05244 0.0 Click
3complement(4966270..4966410) hypothetical protein; ECoA_05245 0.0 Click
4complement(4966493..4966951) PHAGE_Stx2_c_I: endopeptidase; ECoA_05246; phage(gi20065955) 3e-64 Click
5complement(4966963..4967097) PHAGE_Escher_P13374: hypothetical protein; ECoA_05247; phage(gi410491648) 2e-14 Click
6complement(4967109..4967678) PHAGE_Entero_2008: putative antirepressor; ECoA_05248; phage(gi209427770) 7e-107 Click
7complement(4967949..4968482) PHAGE_Entero_2008: putative endolysin; ECoA_05249; phage(gi209427769) 4e-104 Click
8complement(4968533..4968877) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECoA_05250; phage(gi209427768) 9e-61 Click
9complement(4968882..4969019) PHAGE_Entero_2008: lysis protein; ECoA_05251; phage(gi209427767) 9e-19 Click
104969092..4969256 hypothetical protein; ECoA_05252 0.0 Click
11complement(4969560..4971410) PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECoA_05253; phage(gi209427766) 0.0 Click
12complement(4971459..4971623) hypothetical protein; ECoA_05254 0.0 Click
13complement(4971724..4971891) PHAGE_Entero_P1: TciB; ECoA_05255; phage(gi46401695) 1e-08 Click
14complement(4971888..4972319) PHAGE_Pseudo_AF: putative tellurite resistance protein; ECoA_05256; phage(gi431810338) 1e-28 Click
15complement(4972492..4972565) tRNA 0.0 Click
16complement(4972669..4972741) tRNA 0.0 Click
17complement(4972770..4973357) Putative transcriptional regulator; ECoA_05257 0.0 Click
184973374..4973514 hypothetical protein; ECoA_05258 0.0 Click
19complement(4973619..4973939) PHAGE_Entero_phiP27: hypothetical protein P27p23; ECoA_05259; phage(gi18249887) 7e-29 Click
20complement(4974041..4974595) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECoA_05260; phage(gi399528832) 1e-06 Click
21complement(4974658..4974963) PHAGE_Escher_HK75: RusA-like protein; ECoA_05261; phage(gi356870726) 2e-32 Click
22complement(4974976..4976025) PHAGE_Entero_mEp460: hypothetical protein; ECoA_05262; phage(gi428782365) 2e-112 Click
23complement(4976027..4976299) PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ECoA_05263; phage(gi169257287) 5e-14 Click
24complement(4976421..4976765) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; ECoA_05264; phage(gi20065865) 8e-59 Click

Region 23, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15075289..5075300 attL    GGTTTTCTTGTT 0.0 Click
25088967..5090091 PHAGE_Strept_Sfi11: putative minor tail protein; ECoA_05379; phage(gi9635024) 3e-05 Click
35090112..5091050 PHAGE_Lactob_1: putative tail fibre protein; ECoA_05380; phage(gi226377752) 1e-07 Click
45091057..5091464 Orf27; ECoA_05381 0.0 Click
55091500..5091721 EscF; ECoA_05382 0.0 Click
65091727..5092005 T3SS component; ECoA_05383 0.0 Click
7complement(5092224..5092376) hypothetical protein; ECoA_05384 0.0 Click
85092399..5092836 PHAGE_Woolly_virus: hypothetical Gag polyprotein; ECoA_05385; phage(gi148285626) 2e-05 Click
95093142..5093261 hypothetical protein; ECoA_05386 0.0 Click
10complement(5093701..5095239) PHAGE_Stx2_c_1717: transposase; ECoA_05387; phage(gi209447153) 0.0 Click
11complement(5095289..5095636) PHAGE_Stx2_c_1717: transposase; ECoA_05388; phage(gi209447152) 2e-62 Click
12complement(5095633..5095794) PHAGE_Stx2_c_1717: truncated transposase; ECoA_05389; phage(gi209447151) 3e-23 Click
13complement(5096404..5096517) hypothetical protein; ECoA_05390 0.0 Click
14complement(5096790..5097131) hypothetical protein; ECoA_05391 0.0 Click
15complement(5097216..5097413) hypothetical protein; ECoA_05392 0.0 Click
16complement(5097425..5097916) hypothetical protein; ECoA_05393 0.0 Click
17complement(5097913..5098287) YeeV toxin protein; ECoA_05394 0.0 Click
18complement(5098377..5098520) hypothetical protein; ECoA_05395 0.0 Click
19complement(5098538..5099191) PHAGE_Entero_Sf6: putative transposase OrfB; ECoA_05396; phage(gi41057343) 3e-79 Click
205099252..5099380 conserved domain protein; ECoA_05397 0.0 Click
21complement(5099404..5099718) PROPHAGE_Xantho_33913: ISxac3 transposase; ECoA_05398; phage(gi21231087) 6e-06 Click
225099704..5099715 attR    GGTTTTCTTGTT 0.0 Click
23complement(5099853..5101106) PROPHAGE_Escher_Sakai: putative integrase; ECoA_05399; phage(gi15833788) 0.0 Click