Escherichia sp. TW09308 , whole genome shotgun sequence. [asmbl_id: NC_000000].4809826, GC%: 50.28%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1155..340 PHAGE_Entero_Sf6: gene 64 protein; PP_00001; phage(gi41057337) 7e-27 Click
2934..1107 hypothetical; PP_00002 0.0 Click
31184..1564 PHAGE_Entero_Sf6: hypothetical protein Sf6p66; PP_00003; phage(gi41057339) 2e-68 Click
41668..1910 PHAGE_Entero_Sf6: hypothetical protein Sf6p67; PP_00004; phage(gi41057340) 8e-39 Click
51990..2415 PHAGE_Entero_Sf6: gene 1 protein; PP_00005; phage(gi41057279) 1e-68 Click
62412..3827 PHAGE_Entero_Sf6: gene 2 protein; PP_00006; phage(gi41057280) 0.0 Click
73829..6027 PHAGE_Entero_Sf6: gene 3 protein; PP_00007; phage(gi41057281) 0.0 Click
86118..7011 PHAGE_Entero_Sf6: gene 4 protein; PP_00008; phage(gi41057282) 1e-28 Click
97030..8283 PHAGE_Entero_P22: coat protein; PP_00009; phage(gi9635538) 3e-35 Click
108337..8513 hypothetical protein ECS88_2513 [Escherichia coli S88] gi|218559275|ref|YP_002392188.1|; PP_00010 4e-26 Click
118563..8955 PHAGE_Entero_Sf6: gene 7 protein; PP_00011; phage(gi41057285) 5e-21 Click
128965..10383 PHAGE_Entero_Sf6: gene 8 protein; PP_00012; phage(gi41057286) 0.0 Click
1310383..11084 PHAGE_Salmon_epsilon34: Tail accessory protein; PP_00013; phage(gi221328627) 3e-107 Click
1411084..11539 PHAGE_Entero_Sf6: head assembly protein; PP_00014; phage(gi41057288) 4e-86 Click
1511542..12234 PHAGE_Entero_Sf6: gene 11 protein; PP_00015; phage(gi41057289) 2e-125 Click
1612244..13650 PHAGE_Entero_Sf6: gene 12 protein; PP_00016; phage(gi41057290) 9e-125 Click
1713650..15494 PHAGE_Entero_P22: injection protein; PP_00017; phage(gi51236731) 0.0 Click
18complement(15509..15994) lipoprotein [Escherichia coli O26:H11 str. 11368] gi|260856395|ref|YP_003230286.1|; PP_00018 4e-85 Click
19complement(16065..16250) PHAGE_Salmon_epsilon34: transcriptional repressor Mnt; PP_00019; phage(gi221328634) 6e-12 Click
2016464..18509 PHAGE_Entero_Sf6: gene 14 protein; PP_00020; phage(gi41057292) 2e-34 Click
21complement(18546..19859) inner membrane protein [Escherichia coli str. K-12 substr. W3110] gi|388478401|ref|YP_490593.1|; PP_00021 2e-84 Click
22complement(19861..20760) PHAGE_Entero_SfV: bactoprenol glucosyltransferase; PP_00022; phage(gi19549012) 1e-159 Click
2321459..21590 PHAGE_Entero_N15: UmuD; PP_00023; phage(gi9630490) 2e-10 Click

Region 2, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1202878..204005 PHAGE_Emilia_86: hypothetical protein EhV088; PP_00219; phage(gi73852558) 3e-06 Click
2203992..205089 Linoleoyl-CoA desaturase [Escherichia fergusonii ATCC 35469] gi|218549074|ref|YP_002382865.1|; PP_00220 0.0 Click
3complement(205106..205190) tRNA 0.0 Click
4complement(205212..205296) tRNA 0.0 Click
5complement(205353..205487) hypothetical; PP_00221 0.0 Click
6complement(205456..206298) PHAGE_Prochl_P_SSM7: PRGA-formyltransferase; PP_00222; phage(gi326784531) 1e-17 Click
7complement(206348..206746) PHAGE_Sphing_PAU: gp60; PP_00223; phage(gi435844563) 4e-05 Click
8206880..208559 PHAGE_Salmon_ST64B: Major capsid protein precursor; PP_00224; phage(gi23505451) 0.0 Click
9208609..208809 PHAGE_Salmon_ST64B: hypothetical protein sb7; PP_00225; phage(gi23505452) 2e-24 Click
10208812..209135 PHAGE_Salmon_ST64B: hypothetical protein sb8; PP_00226; phage(gi23505453) 1e-51 Click
11209132..209542 PHAGE_Salmon_ST64B: hypothetical protein sb9; PP_00227; phage(gi23505454) 3e-41 Click
12209517..210023 PHAGE_Salmon_ST64B: hypothetical protein sb10; PP_00228; phage(gi23505455) 4e-69 Click
13210020..210580 PHAGE_Salmon_ST64B: hypothetical protein sb11; PP_00229; phage(gi23505456) 3e-76 Click
14210589..210759 PHAGE_Salmon_ST64B: hypothetical protein sb12; PP_00230; phage(gi23505457) 5e-22 Click
15210743..211465 PHAGE_Salmon_ST64B: Tail Sheath protein; PP_00231; phage(gi23505458) 4e-75 Click
16211471..212238 PHAGE_Salmon_ST64B: Tail Sheath protein; PP_00232; phage(gi23505458) 1e-128 Click
17212238..212594 PHAGE_Salmon_ST64B: Tail tube protein; PP_00233; phage(gi23505459) 3e-52 Click
18212594..212863 PHAGE_Salmon_ST64B: hypothetical protein sb15; PP_00234; phage(gi23505501) 4e-14 Click
19212830..213018 hypothetical protein ECOK1_2982 [Escherichia coli IHE3034] gi|386600606|ref|YP_006102112.1|; PP_00235 2e-29 Click
20213005..214840 PHAGE_Salmon_ST64B: tail protein; PP_00236; phage(gi23505460) 3e-30 Click
21214901..215959 PHAGE_Salmon_ST64B: tail/DNA circulation protein; PP_00237; phage(gi23505461) 1e-96 Click

Region 3, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(824826..826199) PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; PP_00867; phage(gi197322490) 2e-08 Click
2complement(826196..826828) PHAGE_Feldma_virus: putative sensor histidine kinase; PP_00868; phage(gi197322366) 6e-06 Click
3827283..827543 repressor CpxP [Shigella sonnei Ss046] gi|161986403|ref|YP_312833.2|; PP_00869 5e-39 Click
4827567..827613 attL    GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC 0.0 Click
5complement(827729..828709) PHAGE_Yersin_413C: Int; PP_00870; phage(gi30065733) 0.0 Click
6complement(828779..829072) PHAGE_Yersin_413C: gpC; PP_00871; phage(gi30065734) 3e-26 Click
7829225..829497 PHAGE_Yersin_413C: Cox; PP_00872; phage(gi30065735) 4e-39 Click
8829500..829670 PHAGE_Yersin_413C: hypothetical protein L-413Cp32; PP_00873; phage(gi30065736) 4e-26 Click
9829667..830167 PHAGE_Yersin_413C: gpB; PP_00874; phage(gi30065737) 2e-92 Click
10830231..830455 PHAGE_Yersin_413C: hypothetical protein L-413Cp34; PP_00875; phage(gi30065738) 1e-33 Click
11830455..830721 PHAGE_Yersin_413C: hypothetical protein L-413Cp35; PP_00876; phage(gi30065739) 3e-36 Click
12830758..830982 PHAGE_Yersin_413C: hypothetical protein L-413Cp36; PP_00877; phage(gi30065740) 3e-34 Click
13830979..831254 PHAGE_Yersin_413C: hypothetical protein L-413Cp37; PP_00878; phage(gi30065741) 1e-46 Click
14831244..833529 PHAGE_Yersin_413C: gpA; PP_00879; phage(gi30065742) 0.0 Click
15833526..833981 PHAGE_Yersin_413C: hypothetical protein L-413Cp39; PP_00880; phage(gi30065743) 1e-76 Click
16833981..834187 PHAGE_Entero_PsP3: gp37; PP_00881; phage(gi41057391) 3e-23 Click
17834411..835142 PHAGE_Vibrio_VHML: ORF47; PP_00882; phage(gi27311214) 5e-55 Click
18835941..836144 hypothetical protein C380_10550 [Acidovorax sp. KKS102] gi|407938808|ref|YP_006854449.1|; PP_00883 2e-15 Click
19836339..836500 hypothetical protein ECNA114_4025 [Escherichia coli NA114] gi|386621563|ref|YP_006141143.1|; PP_00884 2e-20 Click
20complement(836539..837573) PHAGE_Yersin_413C: gpQ; PP_00885; phage(gi30065705) 0.0 Click
21complement(837573..838898) PHAGE_Yersin_413C: gpP; PP_00886; phage(gi30065706) 0.0 Click
22complement(838850..839344) PHAGE_Yersin_413C: gpP; PP_00887; phage(gi30065706) 6e-70 Click
23839518..840372 PHAGE_Yersin_413C: gpO; PP_00888; phage(gi30065707) 3e-160 Click
24840431..841504 PHAGE_Yersin_413C: gpN; PP_00889; phage(gi30065708) 0.0 Click
25841508..842251 PHAGE_Yersin_413C: gpM; PP_00890; phage(gi30065709) 3e-134 Click
26842387..842860 PHAGE_Yersin_413C: gpL; PP_00891; phage(gi30065710) 2e-85 Click
27842860..843063 PHAGE_Yersin_413C: gpX; PP_00892; phage(gi30065711) 4e-32 Click
28843067..843348 PHAGE_Yersin_413C: gpY; PP_00893; phage(gi30065712) 3e-46 Click
29843348..843845 PHAGE_Yersin_413C: gpK; PP_00894; phage(gi30065713) 1e-93 Click
30843860..844285 PHAGE_Yersin_413C: LysA; PP_00895; phage(gi30065714) 2e-67 Click
31844273..844698 PHAGE_Yersin_413C: LysB; PP_00896; phage(gi30065715) 1e-70 Click
32844685..844843 PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_00897; phage(gi431810968) 6e-10 Click
33844806..845273 PHAGE_Yersin_413C: gpR; PP_00898; phage(gi30065716) 2e-84 Click
34845266..845718 PHAGE_Yersin_413C: gpS; PP_00899; phage(gi30065717) 1e-80 Click
35845785..846420 PHAGE_Yersin_413C: gpV; PP_00900; phage(gi30065718) 2e-116 Click
36846417..846764 PHAGE_Yersin_413C: gpW; PP_00901; phage(gi30065719) 5e-60 Click
37846769..847677 PHAGE_Yersin_413C: gpJ; PP_00902; phage(gi30065720) 9e-167 Click
38847670..848200 PHAGE_Yersin_413C: gpI; PP_00903; phage(gi30065721) 6e-99 Click
39848211..850301 PHAGE_Yersin_413C: gpH; PP_00904; phage(gi30065722) 4e-97 Click
40850305..850832 PHAGE_Yersin_413C: gpG; PP_00905; phage(gi30065723) 1e-92 Click
41850966..852156 PHAGE_Yersin_413C: gpFI; PP_00906; phage(gi30065725) 0.0 Click
42852169..852687 PHAGE_Yersin_413C: FII; PP_00907; phage(gi30065726) 2e-94 Click
43852744..853019 PHAGE_Yersin_413C: gpE; PP_00908; phage(gi30065727) 1e-43 Click
44853164..855611 PHAGE_Yersin_413C: gpT; PP_00909; phage(gi30065729) 0.0 Click
45855626..856105 PHAGE_Yersin_413C: gpU; PP_00910; phage(gi30065730) 4e-85 Click
46856105..857268 PHAGE_Yersin_413C: gpD; PP_00911; phage(gi30065731) 0.0 Click
47857314..857568 PHAGE_Yersin_413C: Ogr; PP_00912; phage(gi30065732) 2e-45 Click
48857667..857789 hypothetical; PP_00913 0.0 Click
49857679..857725 attR    GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC 0.0 Click
50857804..858706 ferrous iron efflux protein F [Escherichia fergusonii ATCC 35469] gi|218551102|ref|YP_002384893.1|; PP_00914 2e-164 Click
51858887..859849 PHAGE_Ostreo_OlV5: 6-phosphofructokinase; PP_00915; phage(gi472341206) 2e-16 Click

Region 4, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1970866..970877 attL    CGTAGGCCTGAT 0.0 Click
2973243..973728 PHAGE_Entero_P4: integrase; PP_01028; phage(gi9627511) 1e-76 Click
3973761..974501 PHAGE_Entero_P4: integrase; PP_01029; phage(gi9627511) 3e-122 Click
4complement(974577..975551) PHAGE_Cronob_vB_CsaM_GAP32: putative N-4 cytosine-specific methyltransferase; PP_01030; phage(gi414087070) 2e-18 Click
5976146..976403 subunit R of type I restriction-modification system [Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150] gi|56416261|ref|YP_153336.1|; PP_01031 3e-41 Click
6complement(976400..976519) hypothetical; PP_01032 0.0 Click
7976523..981805 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_01033; phage(gi414087138) 2e-45 Click
8981933..982055 hypothetical; PP_01034 0.0 Click
9982232..983503 serine transporter family protein [Escherichia coli O55:H7 str. CB9615] gi|291284912|ref|YP_003501730.1|; PP_01035 0.0 Click
10complement(983677..984690) PHAGE_Plankt_PaV_LD: ABC transporter; PP_01036; phage(gi371496158) 4e-22 Click
11complement(984687..985670) PHAGE_Plankt_PaV_LD: ABC transporter; PP_01037; phage(gi371496158) 1e-17 Click
12987852..987863 attR    CGTAGGCCTGAT 0.0 Click

Region 5, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11831874..1833379 PROPHAGE_Escher_Sakai: putative protease; PP_01831; phage(gi15833670) 0.0 Click
21833376..1833567 hypothetical protein SFV_3550 [Shigella flexneri 5 str. 8401] gi|110807369|ref|YP_690889.1|; PP_01832 1e-26 Click
31833564..1835243 inner membrane protein [Escherichia coli W] gi|386610899|ref|YP_006126385.1|; PP_01833 0.0 Click
41835809..1836006 hypothetical protein ECW_m0943 [Escherichia coli W] gi|386608205|ref|YP_006123691.1|; PP_01834 2e-26 Click
5complement(1835975..1836580) PHAGE_Entero_HK106: tail fiber assembly protein; PP_01835; phage(gi428783304) 8e-95 Click
6complement(1836580..1837158) PHAGE_Entero_HK106: side tail fiber protein; PP_01836; phage(gi428783303) 4e-46 Click
71837186..1837752 PHAGE_Entero_2: DNA-invertase; PP_01837; phage(gi169936026) 9e-88 Click
8complement(1837710..1837850) hypothetical; PP_01838 0.0 Click
91837895..1838272 PHAGE_Entero_2: P2 gpFI-like protein; PP_01839; phage(gi169936025) 5e-52 Click
101838232..1839068 PHAGE_Entero_2: P2 gpFI-like protein; PP_01840; phage(gi169936025) 8e-146 Click
111839078..1839593 PHAGE_Entero_2: P2 gpFII-like protein; PP_01841; phage(gi169936024) 4e-91 Click
121839648..1839950 PHAGE_Entero_2: P2 gpE-like tail protein; PP_01842; phage(gi169936023) 5e-44 Click
131839965..1840084 PHAGE_Entero_2: P2 gpE-like protein; PP_01843; phage(gi169936022) 4e-15 Click
141840077..1843154 PHAGE_Entero_2: P2 gpT-like tail protein; PP_01844; phage(gi169936021) 0.0 Click
151843151..1843636 PHAGE_Entero_2: P2 gpU-like tail protein; PP_01845; phage(gi169936020) 2e-75 Click
161843633..1844733 PHAGE_Entero_2: P2 gpD-like tail protein; PP_01846; phage(gi169936019) 0.0 Click
171844824..1845042 PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); PP_01847; phage(gi169936018) 2e-22 Click

Region 6, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12043541..2043552 attL    ATTCTCTTCAAC 0.0 Click
2complement(2043909..2044673) PHAGE_Entero_4795: putative integrase; PP_02033; phage(gi157165986) 4e-68 Click
3complement(2045146..2045361) hypothetical protein SSON53_10525 [Shigella sonnei 53G] gi|383178640|ref|YP_005456645.1|; PP_02034 3e-36 Click
4complement(2045893..2046702) PHAGE_Entero_epsilon15: RecT; PP_02035; phage(gi30387413) 1e-81 Click
5complement(2046695..2049316) PHAGE_Salmon_SPN3UB: RecE; PP_02036; phage(gi423262421) 1e-71 Click
6complement(2049418..2049693) hypothetical protein ECBD_2266 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773649|ref|YP_003036480.1|; PP_02037 4e-45 Click
7complement(2049768..2049944) PHAGE_Salmon_SPN3UB: hypothetical protein; PP_02038; phage(gi423262423) 8e-06 Click
8complement(2049938..2050159) PHAGE_Escher_P13374: host killing protein; PP_02039; phage(gi410491620) 9e-06 Click
92050661..2051089 hypothetical protein ECBD_2263 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773646|ref|YP_003036477.1|; PP_02040 5e-77 Click
10complement(2051086..2051241) PHAGE_Salico_CGphi29: hypothetical protein; PP_02041; phage(gi472340166) 7e-10 Click
11complement(2051252..2051386) hypothetical protein Z2402 [Escherichia coli O157:H7 str. EDL933] gi|15801810|ref|NP_287828.1|; PP_02042 1e-18 Click
12complement(2051677..2052096) PHAGE_Entero_HK022: regulatory protein cI; PP_02043; phage(gi19343388) 3e-21 Click
132052176..2052430 PHAGE_Escher_HK75: regulatory protein cro; PP_02044; phage(gi356870715) 3e-19 Click
142052427..2052849 PHAGE_Entero_mEp237: CII protein; PP_02045; phage(gi435439306) 2e-08 Click
152052862..2053719 PHAGE_Salmon_SPN3UB: PrpO; PP_02046; phage(gi423262427) 9e-23 Click
162053726..2054472 PHAGE_Salmon_SPN3UB: DNA replication protein DnaC; PP_02047; phage(gi423262428) 5e-74 Click
172054495..2055256 hypothetical protein ECO26_1929 [Escherichia coli O26:H11 str. 11368] gi|260855058|ref|YP_003228949.1|; PP_02048 7e-135 Click
182055272..2055688 exclusion protein [Escherichia coli O26:H11 str. 11368] gi|260855059|ref|YP_003228950.1|; PP_02049 5e-68 Click
192056095..2059727 PHAGE_Megavi_lba: putative hydrolase; PP_02050; phage(gi448825666) 1e-06 Click
202072920..2072931 attR    ATTCTCTTCAAC 0.0 Click

Region 7, total : 45 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13438981..3439895 PHAGE_Burkho_phi1026b: gp58; PP_03383; phage(gi38707948) 4e-16 Click
2complement(3439892..3440461) 2,5-diketo-D-gluconate reductase [Escherichia coli SE15] gi|387828270|ref|YP_003348207.1|; PP_03384 2e-97 Click
3complement(3440470..3440694) 2,5-diketo-D-gluconate reductase B [Escherichia fergusonii ATCC 35469] gi|218547657|ref|YP_002381448.1|; PP_03385 3e-30 Click
43441071..3441202 hypothetical; PP_03386 0.0 Click
53441714..3442289 Hypothetical protein W5S_0372 [Pectobacterium sp. SCC3193] gi|470152869|ref|YP_006281371.1|; PP_03387 1e-67 Click
63442562..3443698 PROPHAGE_Escher_MG1655: predicted transposase; PP_03388; phage(gi16131356) 0.0 Click
73443820..3444083 hypothetical protein EFER_1981 [Escherichia fergusonii ATCC 35469] gi|218549319|ref|YP_002383110.1|; PP_03389 2e-09 Click
8complement(3444101..3444274) hypothetical; PP_03390 0.0 Click
93444971..3445426 PHAGE_Cronob_phiES15: hypothetical protein; PP_03391; phage(gi401817579) 1e-60 Click
103445589..3445879 PHAGE_Entero_mEp237: hypothetical protein; PP_03392; phage(gi435439317) 1e-48 Click
113445876..3446238 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_03393; phage(gi435439318) 7e-61 Click
123446235..3446375 PHAGE_Entero_mEp237: hypothetical protein; PP_03394; phage(gi435439319) 1e-10 Click
13complement(3446395..3446517) hypothetical; PP_03395 0.0 Click
14complement(3446514..3446630) hypothetical; PP_03396 0.0 Click
153446629..3446838 PHAGE_Escher_TL_2011c: putative late gene regulator Q; PP_03397; phage(gi418487066) 6e-22 Click
16complement(3446994..3447518) PHAGE_Acanth_mimivirus: putative lipocalin; PP_03398; phage(gi311978291) 2e-13 Click
173447711..3448670 hypothetical protein EFER_2704 [Escherichia fergusonii ATCC 35469] gi|218550019|ref|YP_002383810.1|; PP_03399 0.0 Click
183449022..3449753 araC-type regulatory protein from bacteriophage origin [Escherichia fergusonii ATCC 35469] gi|218550018|ref|YP_002383809.1|; PP_03400 3e-134 Click
193449951..3450157 PHAGE_Stx2_c_II: holin; PP_03401; phage(gi302393164) 3e-28 Click
203450157..3450654 PHAGE_Entero_cdtI: lysin; PP_03402; phage(gi148609440) 2e-90 Click
213450651..3451109 PHAGE_Entero_mEp235: lysis protein Rz; PP_03403; phage(gi428781868) 1e-75 Click
223451311..3451808 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp49; PP_03404; phage(gi209447174) 4e-93 Click
233451862..3452080 PHAGE_Entero_mEp234: hypothetical protein; PP_03405; phage(gi428782313) 4e-32 Click
24complement(3453127..3453246) hypothetical; PP_03406 0.0 Click
253453759..3454304 PHAGE_Entero_HK629: terminase small subunit nu1; PP_03407; phage(gi428782012) 2e-97 Click
263454279..3456204 PHAGE_Entero_HK629: terminase large subunit A; PP_03408; phage(gi428782013) 0.0 Click
273456201..3456407 PHAGE_Entero_HK629: head-tail connector; PP_03409; phage(gi428782014) 4e-32 Click
283456404..3458005 PHAGE_Entero_HK629: portal protein; PP_03410; phage(gi428782015) 0.0 Click
293457986..3459305 PHAGE_Entero_HK629: head maturation protease; PP_03411; phage(gi428782016) 0.0 Click
303459315..3459647 PHAGE_Entero_HK629: head decoration protein; PP_03412; phage(gi428782018) 2e-57 Click
313459676..3460728 PHAGE_Entero_HK629: major head subunit; PP_03413; phage(gi428782019) 0.0 Click
323460770..3461165 PHAGE_Entero_HK629: DNA packaging protein Fi; PP_03414; phage(gi428782020) 2e-58 Click
333461177..3461530 PHAGE_Entero_HK629: head-tail connector Fii; PP_03415; phage(gi428782021) 1e-62 Click
343461542..3462120 PHAGE_Entero_HK629: minor tail protein; PP_03416; phage(gi428782022) 2e-101 Click
353462117..3462512 PHAGE_Entero_HK629: minor tail protein; PP_03417; phage(gi428782023) 3e-72 Click
363462520..3463125 PHAGE_Entero_HK629: major tail protein; PP_03418; phage(gi428782024) 1e-105 Click
373463138..3463260 PHAGE_Entero_HK629: major tail protein; PP_03419; phage(gi428782024) 4e-15 Click
383463276..3463698 PHAGE_Entero_HK629: minor tail protein; PP_03420; phage(gi428782025) 2e-75 Click
393463680..3464114 PHAGE_Entero_HK629: tail assembly protein; PP_03421; phage(gi428782026) 4e-81 Click
403464107..3466668 PHAGE_Entero_HK629: tail length tape measure protein; PP_03422; phage(gi428782027) 0.0 Click
413466665..3466994 PHAGE_Entero_HK629: minor tail protein; PP_03423; phage(gi428782028) 5e-57 Click
423466994..3467692 PHAGE_Entero_HK629: minor tail protein; PP_03424; phage(gi428782029) 2e-133 Click
433467842..3468012 PHAGE_Entero_HK629: tail component protein; PP_03425; phage(gi428782030) 2e-24 Click
44complement(3468002..3470416) putative ABC transporter permease [Escherichia coli O7:K1 str. CE10] gi|386622876|ref|YP_006142604.1|; PP_03426 0.0 Click
45complement(3470413..3471099) PHAGE_Plankt_PaV_LD: ABC transporter; PP_03427; phage(gi371496158) 2e-35 Click

Region 8, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3483177..3487889) PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_03443; phage(gi414087138) 2e-24 Click
2complement(3487886..3490660) PHAGE_Pectob_My1: YadA domain-containing protein; PP_03444; phage(gi410491156) 2e-23 Click
33491043..3491252 hypothetical protein EFER_0579 [Escherichia fergusonii ATCC 35469] gi|218547974|ref|YP_002381765.1|; PP_03445 5e-35 Click
4complement(3491224..3491430) hypothetical protein APECO78_04690 [Escherichia coli APEC O78] gi|443616263|ref|YP_007380119.1|; PP_03446 3e-31 Click
5complement(3491665..3491958) PHAGE_Entero_SfV: repressor; PP_03447; phage(gi19549021) 8e-54 Click
63492430..3492630 PHAGE_Entero_cdtI: Repressor; PP_03448; phage(gi148609424) 4e-33 Click
73492674..3493225 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp43; PP_03449; phage(gi148609425) 2e-93 Click
83493570..3494511 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_03450; phage(gi18249881) 1e-41 Click
93494514..3495002 PHAGE_Entero_mEp460: hypothetical protein; PP_03451; phage(gi428782360) 2e-88 Click
103495002..3495328 PHAGE_Entero_cdtI: RecA-mediated autopeptidases; PP_03452; phage(gi148609430) 1e-54 Click
113495325..3495714 PHAGE_Entero_mEp460: holliday junction resolvase; PP_03453; phage(gi428782363) 1e-70 Click
123495734..3495976 PHAGE_Entero_mEp460: KilA-N domain protein; PP_03454; phage(gi428782364) 7e-40 Click
133495948..3496289 PHAGE_Entero_P4: hypothetical protein P4p08; PP_03455; phage(gi9627514) 7e-58 Click
143496425..3496745 PHAGE_Entero_P4: hypothetical protein P4p07; PP_03456; phage(gi9627513) 6e-57 Click
153496760..3499093 PHAGE_Entero_P4: DNA primase; PP_03457; phage(gi9627512) 0.0 Click
163499145..3499270 PHAGE_Entero_P4: hypothetical protein P4p05; PP_03458; phage(gi19263411) 2e-08 Click
17complement(3499458..3500387) PHAGE_Stx2_c_1717: penicillin-binding protein 6b; PP_03459; phage(gi209447203) 8e-12 Click

Region 9, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3658290..3659432) PHAGE_Entero_mEp235: integrase; PP_03610; phage(gi428781836) 1e-61 Click
2complement(3659798..3659914) hypothetical protein NRG857_05500 [Escherichia coli O83:H1 str. NRG 857C] gi|387616440|ref|YP_006119462.1|; PP_03611 7e-12 Click
3complement(3660015..3660347) PHAGE_Entero_ST104: ORF6; PP_03612; phage(gi46358654) 2e-49 Click
4complement(3660347..3660568) PHAGE_Stx2_c_86: putative C4-type zinc finger protein; PP_03613; phage(gi116222040) 3e-34 Click
5complement(3660667..3660882) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_03614; phage(gi20065893) 9e-34 Click
63660932..3660943 attL    CTGCCAGAAAAA 0.0 Click
7complement(3660959..3661072) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF10; PP_03615; phage(gi157165995) 1e-13 Click
8complement(3661302..3661982) PHAGE_Entero_4795: putative exonuclease; PP_03616; phage(gi157165997) 2e-131 Click
9complement(3661979..3662764) PHAGE_Stx2_c_I: Bet protein; PP_03617; phage(gi20065900) 2e-151 Click
10complement(3662770..3663066) PHAGE_Entero_4795: putative host-nuclease inhibitor protein Gam; PP_03618; phage(gi157165999) 9e-53 Click
11complement(3663141..3663347) PHAGE_Entero_HK225: Kil protein; PP_03619; phage(gi428782413) 6e-30 Click
12complement(3663831..3664712) hypothetical protein Sama_2780 [Shewanella amazonensis SB2B] gi|119775912|ref|YP_928652.1|; PP_03620 5e-32 Click
13complement(3664699..3665463) hypothetical protein BJ6T_43240 [Bradyrhizobium japonicum USDA 6] gi|384218019|ref|YP_005609185.1|; PP_03621 8e-17 Click
14complement(3665584..3666069) PHAGE_Salmon_ST160: C2; PP_03622; phage(gi318065925) 1e-74 Click
153666646..3667185 PHAGE_Entero_mEp237: CII protein; PP_03623; phage(gi435439306) 8e-64 Click
163667182..3668201 PHAGE_Entero_4795: putative replication protein O; PP_03624; phage(gi157166011) 1e-111 Click
173668198..3668899 PHAGE_Entero_4795: putative replication protein P; PP_03625; phage(gi157166012) 1e-128 Click
183668896..3669198 PHAGE_Entero_4795: putative Ren protein; PP_03626; phage(gi157166013) 6e-44 Click
193669266..3669598 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; PP_03627; phage(gi311992758) 9e-11 Click
203669673..3669795 hypothetical protein NRG857_05587 [Escherichia coli O83:H1 str. NRG 857C] gi|387616458|ref|YP_006119480.1|; PP_03628 3e-10 Click
213669853..3671379 PHAGE_Bacill_WBeta: putative site-specific recombinase; PP_03629; phage(gi85701406) 5e-09 Click
223684522..3684533 attR    CTGCCAGAAAAA 0.0 Click

Region 10, total : 51 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3922956..3923651) PHAGE_Escher_D108: DNA modification protein Mom; PP_03875; phage(gi281199700) 1e-132 Click
2complement(3923911..3924486) PHAGE_Entero_phiP27: hypothetical protein P27p57; PP_03876; phage(gi18249921) 1e-77 Click
3complement(3924501..3927623) PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; PP_03877; phage(gi169257214) 2e-54 Click
4complement(3927610..3928050) PROPHAGE_Escher_Sakai: putative tail fiber assembly protein; PP_03878; phage(gi15834244) 5e-17 Click
5complement(3928050..3928937) PHAGE_Escher_D108: tail fiber protein; PP_03879; phage(gi281199694) 1e-17 Click
6complement(3928941..3929525) PHAGE_Escher_D108: hypothetical protein; PP_03880; phage(gi281199693) 4e-19 Click
7complement(3929510..3930586) PHAGE_Escher_D108: hypothetical protein; PP_03881; phage(gi281199692) 2e-53 Click
8complement(3930576..3931001) PHAGE_Escher_D108: hypothetical protein; PP_03882; phage(gi281199691) 3e-20 Click
9complement(3931025..3931561) PHAGE_Escher_D108: baseplate assembly protein; PP_03883; phage(gi281199690) 1e-27 Click
10complement(3931552..3932622) PHAGE_Escher_D108: baseplate assembly protein; PP_03884; phage(gi281199689) 2e-56 Click
11complement(3932622..3932819) putative Mu-like prophage DNA circulation protein [Escherichia blattae DSM 4481] gi|387890264|ref|YP_006320562.1|; PP_03885 1e-10 Click
12complement(3932816..3933889) PHAGE_Escher_D108: DNA circularization protein; PP_03886; phage(gi281199688) 6e-16 Click
13complement(3933895..3935751) PHAGE_Burkho_phiE255: gp18; PP_03887; phage(gi134288800) 4e-09 Click
14complement(3935838..3936233) PHAGE_Escher_D108: hypothetical protein; PP_03888; phage(gi281199685) 1e-14 Click
15complement(3936235..3936591) PHAGE_Escher_D108: tail tube protein; PP_03889; phage(gi281199684) 3e-09 Click
16complement(3936601..3938076) PHAGE_Escher_D108: tail sheath protein; PP_03890; phage(gi281199683) 3e-100 Click
17complement(3938076..3938261) hypothetical protein EBL_c29860 [Escherichia blattae DSM 4481] gi|387890269|ref|YP_006320567.1|; PP_03891 4e-11 Click
18complement(3938242..3938853) hypothetical protein EBL_c29870 [Escherichia blattae DSM 4481] gi|387890270|ref|YP_006320568.1|; PP_03892 5e-61 Click
19complement(3938850..3939392) PHAGE_Plankt_PaV_LD: G protein; PP_03893; phage(gi371496194) 7e-05 Click
20complement(3939392..3939829) PHAGE_Escher_D108: hypothetical protein; PP_03894; phage(gi281199680) 5e-09 Click
21complement(3939829..3940140) hypothetical; PP_03895 0.0 Click
22complement(3940222..3941124) PHAGE_Rhodov_RS1: major head protein; PP_03896; phage(gi472342916) 3e-60 Click
23complement(3941124..3942086) PHAGE_Rhodov_RS1: I protein; PP_03897; phage(gi472342914) 5e-20 Click
243942123..3942254 hypothetical; PP_03898 0.0 Click
25complement(3942300..3943064) PHAGE_Escher_D108: virion morphogenesis; PP_03899; phage(gi281199673) 2e-35 Click
26complement(3943057..3944373) PHAGE_Haemop_SuMu: portal protein gp29; PP_03900; phage(gi418489080) 2e-46 Click
27complement(3944337..3944627) phage-like protein [Escherichia blattae DSM 4481] gi|387890277|ref|YP_006320575.1|; PP_03901 3e-16 Click
28complement(3944624..3946159) PHAGE_Escher_D108: hypothetical protein; PP_03902; phage(gi281199671) 3e-124 Click
29complement(3946156..3946737) PHAGE_Escher_D108: hypothetical protein; PP_03903; phage(gi281199670) 3e-37 Click
30complement(3946874..3947104) hypothetical; PP_03904 0.0 Click
31complement(3947176..3947469) PHAGE_Escher_D108: hypothetical protein; PP_03905; phage(gi281199669) 1e-27 Click
32complement(3947469..3947774) PHAGE_Escher_D108: hypothetical protein; PP_03906; phage(gi281199668) 4e-06 Click
33complement(3947759..3947986) PHAGE_Salmon_RE_2010: zinc-finger containing protein; PP_03907; phage(gi418489690) 2e-05 Click
34complement(3947983..3948591) hypothetical protein EBL_c30010 [Escherichia blattae DSM 4481] gi|387890284|ref|YP_006320582.1|; PP_03908 9e-72 Click
35complement(3948579..3948989) hypothetical protein EBL_c30020 [Escherichia blattae DSM 4481] gi|387890285|ref|YP_006320583.1|; PP_03909 4e-05 Click
36complement(3948964..3949215) PHAGE_Escher_D108: hypothetical protein; PP_03910; phage(gi281199661) 2e-25 Click
37complement(3949217..3949813) PHAGE_Pantoe_LIMEzero: hypothetical protein; PP_03911; phage(gi338827197) 1e-20 Click
38complement(3949899..3950348) PHAGE_Escher_D108: GemB; PP_03912; phage(gi281199660) 2e-43 Click
39complement(3950345..3950896) PHAGE_Escher_D108: hypothetical protein; PP_03913; phage(gi281199659) 6e-86 Click
403950927..3951331 hypothetical protein SSON53_15580 [Shigella sonnei 53G] gi|383179619|ref|YP_005457624.1|; PP_03914 4e-36 Click
41complement(3951302..3951604) hypothetical; PP_03915 0.0 Click
42complement(3951582..3951779) hypothetical protein ETAF_1722 [Edwardsiella tarda FL6-60] gi|387867853|ref|YP_005699322.1|; PP_03916 1e-12 Click
43complement(3951772..3952311) PHAGE_Escher_D108: hypothetical protein; PP_03917; phage(gi281199655) 1e-84 Click
44complement(3952409..3952933) PHAGE_Escher_D108: Gam; PP_03918; phage(gi281199654) 2e-87 Click
45complement(3952954..3953241) PHAGE_Escher_D108: hypothetical protein; PP_03919; phage(gi281199653) 1e-42 Click
46complement(3953254..3953673) PHAGE_Escher_D108: hypothetical protein; PP_03920; phage(gi281199652) 4e-65 Click
47complement(3953694..3953963) PHAGE_Escher_D108: hypothetical protein; PP_03921; phage(gi281199651) 9e-45 Click
48complement(3954208..3954435) PHAGE_Escher_D108: Kil; PP_03922; phage(gi281199649) 6e-33 Click
49complement(3954448..3955401) PHAGE_Escher_D108: DNA transposition protein B; PP_03923; phage(gi281199648) 6e-58 Click
50complement(3955477..3957564) PROPHAGE_Escher_Sakai: phage transposase; PP_03924; phage(gi15834199) 0.0 Click
51complement(3957567..3957803) PHAGE_Escher_D108: Ner; PP_03925; phage(gi281199646) 7e-13 Click

Region 11, total : 121 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3922956..3923651) PHAGE_Escher_D108: DNA modification protein Mom; PP_03875; phage(gi281199700) 1e-132 Click
2complement(3923911..3924486) PHAGE_Entero_phiP27: hypothetical protein P27p57; PP_03876; phage(gi18249921) 1e-77 Click
3complement(3924501..3927623) PHAGE_Gifsy_1: bacteriophage side tail fiber protein; Lambda gpSft (gpN) homolog; PP_03877; phage(gi169257214) 2e-54 Click
4complement(3927610..3928050) PHAGE_Entero_2: P2 gpG-like protein; PP_03878; phage(gi169936029) 7e-18 Click
5complement(3928050..3928937) PHAGE_Entero_2: P2 gpH-like protein; PP_03879; phage(gi169936027) 1e-10 Click
6complement(3928941..3929525) PHAGE_Entero_SfV: tail protein; PP_03880; phage(gi19548988) 2e-06 Click
7complement(3929510..3930586) PHAGE_Entero_SfV: tail protein; PP_03881; phage(gi19549009) 6e-25 Click
8complement(3930576..3931001) PHAGE_Burkho_KS10: MuV-like tail protein; PP_03882; phage(gi198449306) 3e-11 Click
9complement(3931025..3931561) PHAGE_Entero_Mu: putative baseplate assembly protein; PP_03883; phage(gi9633536) 7e-28 Click
10complement(3931552..3932622) PHAGE_Entero_Mu: putative tail protein; PP_03884; phage(gi9633535) 3e-57 Click
11complement(3932622..3932819) putative Mu-like prophage DNA circulation protein [Escherichia blattae DSM 4481] gi|387890264|ref|YP_006320562.1|; PP_03885 1e-10 Click
12complement(3932816..3933889) PHAGE_Salmon_ST64B: tail/DNA circulation protein; PP_03886; phage(gi23505461) 1e-21 Click
13complement(3933895..3935751) PHAGE_Burkho_phiE255: gp18; PP_03887; phage(gi134288800) 4e-09 Click
14complement(3935838..3936233) PHAGE_Entero_Mu: hypothetical protein Mup41; PP_03888; phage(gi9633532) 6e-15 Click
15complement(3936235..3936591) PHAGE_Escher_D108: tail tube protein; PP_03889; phage(gi281199684) 3e-09 Click
16complement(3936601..3938076) PHAGE_Entero_Mu: major tail subunit; PP_03890; phage(gi9633530) 7e-101 Click
17complement(3938076..3938261) hypothetical protein EBL_c29860 [Escherichia blattae DSM 4481] gi|387890269|ref|YP_006320567.1|; PP_03891 4e-11 Click
18complement(3938242..3938853) hypothetical protein EBL_c29870 [Escherichia blattae DSM 4481] gi|387890270|ref|YP_006320568.1|; PP_03892 5e-61 Click
19complement(3938850..3939392) PHAGE_Plankt_PaV_LD: G protein; PP_03893; phage(gi371496194) 7e-05 Click
20complement(3939392..3939829) PHAGE_Escher_D108: hypothetical protein; PP_03894; phage(gi281199680) 5e-09 Click
21complement(3939829..3940140) hypothetical; PP_03895 0.0 Click
22complement(3940222..3941124) PHAGE_Rhodov_RS1: major head protein; PP_03896; phage(gi472342916) 3e-60 Click
23complement(3941124..3942086) PHAGE_Rhodov_RS1: I protein; PP_03897; phage(gi472342914) 5e-20 Click
243942123..3942254 hypothetical; PP_03898 0.0 Click
25complement(3942300..3943064) PHAGE_Entero_Mu: virion morphogenesis late F orf; PP_03899; phage(gi9633521) 1e-35 Click
26complement(3943057..3944373) PHAGE_Haemop_SuMu: portal protein gp29; PP_03900; phage(gi418489080) 2e-46 Click
27complement(3944337..3944627) phage-like protein [Escherichia blattae DSM 4481] gi|387890277|ref|YP_006320575.1|; PP_03901 3e-16 Click
28complement(3944624..3946159) PHAGE_Entero_Mu: putative portal protein; PP_03902; phage(gi9633519) 1e-124 Click
29complement(3946156..3946737) PHAGE_Escher_D108: hypothetical protein; PP_03903; phage(gi281199670) 3e-37 Click
30complement(3946874..3947104) hypothetical; PP_03904 0.0 Click
31complement(3947176..3947469) PHAGE_Escher_D108: hypothetical protein; PP_03905; phage(gi281199669) 1e-27 Click
32complement(3947469..3947774) PHAGE_Escher_D108: hypothetical protein; PP_03906; phage(gi281199668) 4e-06 Click
33complement(3947759..3947986) PHAGE_Entero_2: P2 gpOrf82-like protein; PP_03907; phage(gi169936056) 3e-05 Click
34complement(3947983..3948591) hypothetical protein EBL_c30010 [Escherichia blattae DSM 4481] gi|387890284|ref|YP_006320582.1|; PP_03908 9e-72 Click
35complement(3948579..3948989) hypothetical protein EBL_c30020 [Escherichia blattae DSM 4481] gi|387890285|ref|YP_006320583.1|; PP_03909 4e-05 Click
36complement(3948964..3949215) PHAGE_Escher_D108: hypothetical protein; PP_03910; phage(gi281199661) 2e-25 Click
37complement(3949217..3949813) PHAGE_Pantoe_LIMEzero: hypothetical protein; PP_03911; phage(gi338827197) 1e-20 Click
383949870..3949881 attL    AAAAAAGCCGGA 0.0 Click
39complement(3949899..3950348) PHAGE_Entero_Mu: Mor; PP_03912; phage(gi9633507) 2e-43 Click
40complement(3950345..3950896) PHAGE_Escher_D108: hypothetical protein; PP_03913; phage(gi281199659) 6e-86 Click
413950927..3951331 hypothetical protein SSON53_15580 [Shigella sonnei 53G] gi|383179619|ref|YP_005457624.1|; PP_03914 4e-36 Click
42complement(3951302..3951604) hypothetical; PP_03915 0.0 Click
43complement(3951582..3951779) hypothetical protein ETAF_1722 [Edwardsiella tarda FL6-60] gi|387867853|ref|YP_005699322.1|; PP_03916 1e-12 Click
44complement(3951772..3952311) PHAGE_Entero_Mu: hypothetical protein Mup11; PP_03917; phage(gi9633501) 5e-88 Click
45complement(3952409..3952933) PHAGE_Pseudo_MP42: host nuclease inhibitor protein; PP_03918; phage(gi399528592) 1e-56 Click
463952949..3952960 attL    GTTAATTAATAT 0.0 Click
47complement(3952954..3953241) PHAGE_Escher_D108: hypothetical protein; PP_03919; phage(gi281199653) 1e-42 Click
48complement(3953254..3953673) PHAGE_Escher_D108: hypothetical protein; PP_03920; phage(gi281199652) 4e-65 Click
49complement(3953694..3953963) PHAGE_Escher_D108: hypothetical protein; PP_03921; phage(gi281199651) 9e-45 Click
50complement(3954208..3954435) PHAGE_Escher_D108: Kil; PP_03922; phage(gi281199649) 6e-33 Click
51complement(3954448..3955401) PHAGE_Haemop_SuMu: phage transposase; PP_03923; phage(gi418489040) 1e-14 Click
52complement(3955477..3957564) PROPHAGE_Escher_Sakai: phage transposase; PP_03924; phage(gi15834199) 0.0 Click
53complement(3957567..3957803) PHAGE_Haemop_SuMu: Mu-like prophage FluMu DNA-binding protein Ner; PP_03925; phage(gi418489037) 6e-14 Click
54complement(3958773..3959291) hypothetical protein i02_0893 [Escherichia coli str. 'clone D i2'] gi|386628384|ref|YP_006148104.1|; PP_03926 9e-89 Click
55complement(3959291..3960499) major facilitator superfamily MFS_1 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253774153|ref|YP_003036984.1|; PP_03927 0.0 Click
563960584..3961186 putative transcriptional regulator [Escherichia coli SE15] gi|387828824|ref|YP_003348761.1|; PP_03928 1e-91 Click
57complement(3961360..3962343) hypothetical protein [Yersinia enterocolitica subsp. palearctica Y11] gi|386308751|ref|YP_006004807.1|; PP_03929 5e-95 Click
58complement(3962451..3963470) PHAGE_Entero_2: P2 Int-like protein; PP_03930; phage(gi169936064) 6e-101 Click
59complement(3963634..3963750) hypothetical protein t3401 [Salmonella enterica subsp. enterica serovar Typhi str. Ty2] gi|29143722|ref|NP_807064.1|; PP_03931 2e-13 Click
60complement(3963866..3964195) PHAGE_Erwini_ENT90: CI repressor protein; PP_03932; phage(gi431810951) 1e-13 Click
613964561..3964782 PHAGE_Pasteu_F108: Cox; PP_03933; phage(gi109302900) 2e-05 Click
623964815..3965324 PHAGE_Entero_2: bacteriophage regulatory protein CII; PP_03934; phage(gi169936061) 1e-83 Click
633965332..3965532 PHAGE_Entero_2: hypothetical protein STM2735.Fels2; PP_03935; phage(gi169936060) 8e-14 Click
643965496..3965837 PHAGE_Entero_2: hypothetical protein STM2733.Fels2; PP_03936; phage(gi169936058) 8e-52 Click
653965905..3966138 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; PP_03937; phage(gi169936057) 7e-27 Click
663966138..3966365 PHAGE_Entero_2: P2 gpOrf82-like protein; PP_03938; phage(gi169936056) 5e-35 Click
673966362..3967219 PHAGE_Entero_2: DNA adenine methylase-like protein; PP_03939; phage(gi169936055) 8e-120 Click
683967216..3969630 PHAGE_Entero_2: P2 gpA-like protein; PP_03940; phage(gi169936054) 0.0 Click
693969824..3969973 PHAGE_Entero_2: hypothetical protein STM2728.Fels2; PP_03941; phage(gi169936053) 3e-20 Click
703969984..3970205 PHAGE_Entero_2: TumB protein; PP_03942; phage(gi169936052) 4e-25 Click
71complement(3970394..3971452) hypothetical protein [Burkholderia sp. CCGE1003] gi|307730155|ref|YP_003907379.1|; PP_03943 3e-84 Click
723971489..3971500 attR    GTTAATTAATAT 0.0 Click
733972036..3973865 PHAGE_Burkho_KS5: gp44; PP_03944; phage(gi327198042) 1e-13 Click
74complement(3973907..3974932) PHAGE_Entero_2: P2 gpQ-like protein; PP_03945; phage(gi169936049) 2e-170 Click
75complement(3974932..3976698) PHAGE_Entero_2: P2 gpP-like protein; PP_03946; phage(gi169936048) 0.0 Click
763976841..3977674 PHAGE_Entero_2: P2 gpO-like protein; PP_03947; phage(gi169936047) 8e-132 Click
773977691..3978749 PHAGE_Entero_2: P2 gpN-like major capsid protein; PP_03948; phage(gi169936046) 8e-179 Click
783978753..3979403 PHAGE_Entero_2: P2 gpM-like protein; PP_03949; phage(gi169936045) 2e-111 Click
793979499..3979963 PHAGE_Entero_2: P2 gpL-like protein; PP_03950; phage(gi169936044) 5e-79 Click
803979963..3980166 PHAGE_Entero_2: P2 gpX-like tail protein; PP_03951; phage(gi169936043) 1e-32 Click
813980170..3980385 PHAGE_Entero_2: lysis protein; PP_03952; phage(gi169936042) 6e-28 Click
823980366..3980878 PHAGE_Entero_2: endolysin; PP_03953; phage(gi169936041) 3e-81 Click
833980880..3981257 hypothetical protein CE10_1736 [Escherichia coli O7:K1 str. CE10] gi|386624090|ref|YP_006143818.1|; PP_03954 5e-62 Click
843981254..3981682 PHAGE_Entero_2: P2 LysB-like protein; PP_03955; phage(gi169936038) 4e-56 Click
853981642..3981815 PHAGE_Entero_2: P2 LysC-like protein; PP_03956; phage(gi169936037) 8e-20 Click
863981778..3982209 PHAGE_Entero_2: P2 gpR-like tail completion protein; PP_03957; phage(gi169936036) 8e-72 Click
873982202..3982648 PHAGE_Entero_2: P2 gpS-like tail completion protein; PP_03958; phage(gi169936035) 1e-72 Click
883982717..3983295 PHAGE_Entero_2: P2 gpV-like protein; PP_03959; phage(gi169936034) 2e-93 Click
893983292..3983651 PHAGE_Entero_2: P2 gpW-like baseplate protein; PP_03960; phage(gi169936033) 1e-51 Click
903983638..3984546 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; PP_03961; phage(gi169936032) 7e-148 Click
913984539..3985144 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; PP_03962; phage(gi169936031) 2e-110 Click
923985141..3986322 PHAGE_Entero_2: P2 gpH-like protein; PP_03963; phage(gi169936030) 3e-117 Click
93complement(3986481..3986804) PHAGE_Entero_mEp213: holin protein; PP_03964; phage(gi428782657) 1e-55 Click
94complement(3987228..3987344) hypothetical; PP_03965 0.0 Click
95complement(3987402..3987920) PHAGE_Entero_Sf6: gene 59 protein; PP_03966; phage(gi41057332) 4e-97 Click
96complement(3987911..3988582) PHAGE_Entero_HK544: NinI protein; PP_03967; phage(gi428783272) 3e-127 Click
973988602..3988757 hypothetical; PP_03968 0.0 Click
98complement(3988909..3989037) hypothetical; PP_03969 0.0 Click
99complement(3989536..3989895) PHAGE_Entero_mEp234: NinX protein; PP_03970; phage(gi428782302) 3e-42 Click
100complement(3990071..3990598) PHAGE_Entero_mEp213: DNA N-6-adenine-methyltransferase (Dam); PP_03971; phage(gi428782650) 2e-101 Click
101complement(3990595..3990900) PHAGE_Stx2_c_1717: NinB protein; PP_03972; phage(gi209447158) 2e-53 Click
102complement(3991049..3991213) PHAGE_Escher_HK75: hypothetical protein; PP_03973; phage(gi356870720) 2e-23 Click
103complement(3991328..3992704) PHAGE_Entero_HK97: Gp55; PP_03974; phage(gi9634201) 0.0 Click
104complement(3992701..3993522) PHAGE_Entero_mEp213: DNA replication protein O; PP_03975; phage(gi428782645) 4e-155 Click
105complement(3993703..3993999) PHAGE_Entero_mEp235: CII protein; PP_03976; phage(gi428781852) 9e-48 Click
1063994045..3994167 hypothetical; PP_03977 0.0 Click
1073994672..3995031 PHAGE_Entero_mEp235: prophage repressor; PP_03978; phage(gi428781850) 9e-66 Click
1083995347..3995619 PHAGE_Entero_HK629: transcription antitermination protein N; PP_03979; phage(gi428782056) 1e-43 Click
109complement(3995636..3996190) PHAGE_Entero_HK140: superinfection exclusion protein; PP_03980; phage(gi428781984) 4e-101 Click
1103996425..3997048 PHAGE_Entero_mEp235: hypothetical protein; PP_03981; phage(gi428781847) 6e-110 Click
1113997222..3998190 PHAGE_Entero_IME10: Orf53; PP_03982; phage(gi422934294) 3e-170 Click
1123998331..3998483 PHAGE_Escher_HK75: kil protein; PP_03983; phage(gi356870711) 4e-22 Click
1133998480..3998638 PHAGE_Entero_Sf6: gene 30 protein; PP_03984; phage(gi41057308) 1e-24 Click
1143998740..3999345 PHAGE_Entero_mEp234: essential recombination function protein; PP_03985; phage(gi428782283) 2e-112 Click
1153999345..3999728 PHAGE_Entero_mEp213: hypothetical protein; PP_03986; phage(gi428782627) 8e-70 Click
1163999751..4000047 PHAGE_Entero_mEp235: Abc2 protein; PP_03987; phage(gi428781839) 6e-54 Click
1174000219..4000836 PHAGE_Entero_HK97: Gp37; PP_03988; phage(gi9634184) 8e-48 Click
1184000833..4001648 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; PP_03989; phage(gi89152464) 5e-63 Click
1194001650..4001841 PHAGE_Salmon_ST160: hypothetical protein; PP_03990; phage(gi318065908) 3e-27 Click
1204001844..4002665 PHAGE_Entero_IME10: hypothetical protein; PP_03991; phage(gi422934290) 1e-45 Click
1214002658..4002942 PHAGE_Entero_ST104: ORF6; PP_03992; phage(gi46358654) 4e-51 Click
122complement(4003000..4003170) hypothetical protein ETEC_0781 [Escherichia coli ETEC H10407] gi|387611256|ref|YP_006114372.1|; PP_03993 1e-21 Click
1234003631..4003822 PHAGE_Entero_mEp234: hypothetical protein; PP_03994; phage(gi428782280) 8e-33 Click
124complement(4003803..4004981) PHAGE_Entero_mEp234: integrase; PP_03995; phage(gi428782279) 0.0 Click
1254006591..4006602 attR    AAAAAAGCCGGA 0.0 Click

Region 12, total : 66 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13949870..3949881 attL    AAAAAAGCCGGA 0.0 Click
23952949..3952960 attL    GTTAATTAATAT 0.0 Click
3complement(3962451..3963470) PHAGE_Entero_2: P2 Int-like protein; PP_03930; phage(gi169936064) 6e-101 Click
4complement(3963634..3963750) hypothetical protein t3401 [Salmonella enterica subsp. enterica serovar Typhi str. Ty2] gi|29143722|ref|NP_807064.1|; PP_03931 2e-13 Click
5complement(3963866..3964195) PHAGE_Erwini_ENT90: CI repressor protein; PP_03932; phage(gi431810951) 1e-13 Click
63964561..3964782 PHAGE_Pasteu_F108: Cox; PP_03933; phage(gi109302900) 2e-05 Click
73964815..3965324 PHAGE_Entero_2: bacteriophage regulatory protein CII; PP_03934; phage(gi169936061) 1e-83 Click
83965332..3965532 PHAGE_Entero_2: hypothetical protein STM2735.Fels2; PP_03935; phage(gi169936060) 8e-14 Click
93965496..3965837 PHAGE_Entero_2: hypothetical protein STM2733.Fels2; PP_03936; phage(gi169936058) 8e-52 Click
103965905..3966138 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; PP_03937; phage(gi169936057) 7e-27 Click
113966138..3966365 PHAGE_Entero_2: P2 gpOrf82-like protein; PP_03938; phage(gi169936056) 5e-35 Click
123966362..3967219 PHAGE_Entero_2: DNA adenine methylase-like protein; PP_03939; phage(gi169936055) 8e-120 Click
133967216..3969630 PHAGE_Entero_2: P2 gpA-like protein; PP_03940; phage(gi169936054) 0.0 Click
143969824..3969973 PHAGE_Entero_2: hypothetical protein STM2728.Fels2; PP_03941; phage(gi169936053) 3e-20 Click
153969984..3970205 PHAGE_Entero_2: TumB protein; PP_03942; phage(gi169936052) 4e-25 Click
16complement(3970394..3971452) hypothetical protein [Burkholderia sp. CCGE1003] gi|307730155|ref|YP_003907379.1|; PP_03943 3e-84 Click
173971489..3971500 attR    GTTAATTAATAT 0.0 Click
183972036..3973865 PHAGE_Burkho_KS5: gp44; PP_03944; phage(gi327198042) 1e-13 Click
19complement(3973907..3974932) PHAGE_Entero_2: P2 gpQ-like protein; PP_03945; phage(gi169936049) 2e-170 Click
20complement(3974932..3976698) PHAGE_Entero_2: P2 gpP-like protein; PP_03946; phage(gi169936048) 0.0 Click
213976841..3977674 PHAGE_Entero_2: P2 gpO-like protein; PP_03947; phage(gi169936047) 8e-132 Click
223977691..3978749 PHAGE_Entero_2: P2 gpN-like major capsid protein; PP_03948; phage(gi169936046) 8e-179 Click
233978753..3979403 PHAGE_Entero_2: P2 gpM-like protein; PP_03949; phage(gi169936045) 2e-111 Click
243979499..3979963 PHAGE_Entero_2: P2 gpL-like protein; PP_03950; phage(gi169936044) 5e-79 Click
253979963..3980166 PHAGE_Entero_2: P2 gpX-like tail protein; PP_03951; phage(gi169936043) 1e-32 Click
263980170..3980385 PHAGE_Entero_2: lysis protein; PP_03952; phage(gi169936042) 6e-28 Click
273980366..3980878 PHAGE_Entero_2: endolysin; PP_03953; phage(gi169936041) 3e-81 Click
283980880..3981257 hypothetical protein CE10_1736 [Escherichia coli O7:K1 str. CE10] gi|386624090|ref|YP_006143818.1|; PP_03954 5e-62 Click
293981254..3981682 PHAGE_Entero_2: P2 LysB-like protein; PP_03955; phage(gi169936038) 4e-56 Click
303981642..3981815 PHAGE_Entero_2: P2 LysC-like protein; PP_03956; phage(gi169936037) 8e-20 Click
313981778..3982209 PHAGE_Entero_2: P2 gpR-like tail completion protein; PP_03957; phage(gi169936036) 8e-72 Click
323982202..3982648 PHAGE_Entero_2: P2 gpS-like tail completion protein; PP_03958; phage(gi169936035) 1e-72 Click
333982717..3983295 PHAGE_Entero_2: P2 gpV-like protein; PP_03959; phage(gi169936034) 2e-93 Click
343983292..3983651 PHAGE_Entero_2: P2 gpW-like baseplate protein; PP_03960; phage(gi169936033) 1e-51 Click
353983638..3984546 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; PP_03961; phage(gi169936032) 7e-148 Click
363984539..3985144 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; PP_03962; phage(gi169936031) 2e-110 Click
373985141..3986322 PHAGE_Entero_2: P2 gpH-like protein; PP_03963; phage(gi169936030) 3e-117 Click
38complement(3986481..3986804) PHAGE_Entero_mEp213: holin protein; PP_03964; phage(gi428782657) 1e-55 Click
39complement(3987228..3987344) hypothetical; PP_03965 0.0 Click
40complement(3987402..3987920) PHAGE_Entero_Sf6: gene 59 protein; PP_03966; phage(gi41057332) 4e-97 Click
41complement(3987911..3988582) PHAGE_Entero_HK544: NinI protein; PP_03967; phage(gi428783272) 3e-127 Click
423988602..3988757 hypothetical; PP_03968 0.0 Click
43complement(3988909..3989037) hypothetical; PP_03969 0.0 Click
44complement(3989536..3989895) PHAGE_Entero_mEp234: NinX protein; PP_03970; phage(gi428782302) 3e-42 Click
45complement(3990071..3990598) PHAGE_Entero_mEp213: DNA N-6-adenine-methyltransferase (Dam); PP_03971; phage(gi428782650) 2e-101 Click
46complement(3990595..3990900) PHAGE_Stx2_c_1717: NinB protein; PP_03972; phage(gi209447158) 2e-53 Click
47complement(3991049..3991213) PHAGE_Escher_HK75: hypothetical protein; PP_03973; phage(gi356870720) 2e-23 Click
48complement(3991328..3992704) PHAGE_Entero_HK97: Gp55; PP_03974; phage(gi9634201) 0.0 Click
49complement(3992701..3993522) PHAGE_Entero_mEp213: DNA replication protein O; PP_03975; phage(gi428782645) 4e-155 Click
50complement(3993703..3993999) PHAGE_Entero_mEp235: CII protein; PP_03976; phage(gi428781852) 9e-48 Click
513994045..3994167 hypothetical; PP_03977 0.0 Click
523994672..3995031 PHAGE_Entero_mEp235: prophage repressor; PP_03978; phage(gi428781850) 9e-66 Click
533995347..3995619 PHAGE_Entero_HK629: transcription antitermination protein N; PP_03979; phage(gi428782056) 1e-43 Click
54complement(3995636..3996190) PHAGE_Entero_HK140: superinfection exclusion protein; PP_03980; phage(gi428781984) 4e-101 Click
553996425..3997048 PHAGE_Entero_mEp235: hypothetical protein; PP_03981; phage(gi428781847) 6e-110 Click
563997222..3998190 PHAGE_Entero_IME10: Orf53; PP_03982; phage(gi422934294) 3e-170 Click
573998331..3998483 PHAGE_Escher_HK75: kil protein; PP_03983; phage(gi356870711) 4e-22 Click
583998480..3998638 PHAGE_Entero_Sf6: gene 30 protein; PP_03984; phage(gi41057308) 1e-24 Click
593998740..3999345 PHAGE_Entero_mEp234: essential recombination function protein; PP_03985; phage(gi428782283) 2e-112 Click
603999345..3999728 PHAGE_Entero_mEp213: hypothetical protein; PP_03986; phage(gi428782627) 8e-70 Click
613999751..4000047 PHAGE_Entero_mEp235: Abc2 protein; PP_03987; phage(gi428781839) 6e-54 Click
624000219..4000836 PHAGE_Entero_HK97: Gp37; PP_03988; phage(gi9634184) 8e-48 Click
634000833..4001648 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; PP_03989; phage(gi89152464) 5e-63 Click
644001650..4001841 PHAGE_Salmon_ST160: hypothetical protein; PP_03990; phage(gi318065908) 3e-27 Click
654001844..4002665 PHAGE_Entero_IME10: hypothetical protein; PP_03991; phage(gi422934290) 1e-45 Click
664002658..4002942 PHAGE_Entero_ST104: ORF6; PP_03992; phage(gi46358654) 4e-51 Click
67complement(4003000..4003170) hypothetical protein ETEC_0781 [Escherichia coli ETEC H10407] gi|387611256|ref|YP_006114372.1|; PP_03993 1e-21 Click
684003631..4003822 PHAGE_Entero_mEp234: hypothetical protein; PP_03994; phage(gi428782280) 8e-33 Click
69complement(4003803..4004981) PHAGE_Entero_mEp234: integrase; PP_03995; phage(gi428782279) 0.0 Click
704006591..4006602 attR    AAAAAAGCCGGA 0.0 Click

Region 13, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4444098..4444796) PHAGE_Entero_HK630: minor tail protein L; PP_04437; phage(gi428782805) 8e-133 Click
2complement(4444796..4445134) PHAGE_Entero_4795: putative minor tail protein; PP_04438; phage(gi157166053) 3e-28 Click
3complement(4445127..4448360) PHAGE_Gifsy_1: bacteriophage tail tape measure protein; minor tail protein; Lambda gpH homolog; PP_04439; phage(gi169257221) 7e-123 Click
4complement(4448526..4448780) putative phage protein [Escherichia coli ETEC H10407] gi|387611303|ref|YP_006114419.1|; PP_04440 4e-37 Click
5complement(4448832..4449281) putative phage protein [Escherichia coli ETEC H10407] gi|387611302|ref|YP_006114418.1|; PP_04441 2e-78 Click
6complement(4449342..4450304) PHAGE_Xantho_Xp15: possible phage minor tail protein; PP_04442; phage(gi66392066) 5e-06 Click
7complement(4450331..4450723) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_04443; phage(gi423262013) 2e-09 Click
8complement(4450720..4451100) PHAGE_Salmon_SE2: hypothetical protein; PP_04444; phage(gi375267267) 2e-13 Click
9complement(4451101..4451880) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_04445; phage(gi423262010) 5e-16 Click
10complement(4451884..4452060) PHAGE_Escher_HK639: hypothetical protein; PP_04446; phage(gi356870607) 4e-14 Click
11complement(4452103..4453242) PHAGE_Escher_HK639: hypothetical protein; PP_04447; phage(gi356870606) 3e-163 Click
12complement(4453341..4454177) PHAGE_Escher_HK639: hypothetical protein; PP_04448; phage(gi356870605) 2e-89 Click
13complement(4454210..4455322) PHAGE_Escher_HK639: hypothetical protein; PP_04449; phage(gi356870604) 2e-102 Click
14complement(4455306..4456712) PHAGE_Escher_HK639: hypothetical protein; PP_04450; phage(gi356870603) 0.0 Click
15complement(4456715..4458016) PHAGE_Pseudo_H105/1: phage terminase large subunit; PP_04451; phage(gi327198525) 5e-111 Click
16complement(4457997..4459091) PHAGE_Burkho_BcepMigl: terminase small subunit; PP_04452; phage(gi431809885) 1e-28 Click
17complement(4459095..4459304) putative phage protein [Escherichia coli ETEC H10407] gi|387611289|ref|YP_006114405.1|; PP_04453 2e-30 Click
18complement(4459282..4460214) PHAGE_Lactob_c5: hypothetical protein; PP_04454; phage(gi418488154) 4e-51 Click
19complement(4460207..4460998) PHAGE_Lactob_c5: putative ParB nuclease; PP_04455; phage(gi418488153) 1e-49 Click
20complement(4461136..4462362) potassium transporter subunit [Escherichia coli str. K-12 substr. W3110] gi|388477447|ref|YP_489635.1|; PP_04456 0.0 Click
21complement(4462368..4462511) potassium uptake protein, TrkH family [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773638|ref|YP_003036469.1|; PP_04457 2e-05 Click
22complement(4462730..4463158) PHAGE_Entero_HK630: cell lysis protein Rz; PP_04458; phage(gi428782852) 2e-68 Click

Region 14, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14486354..4486692 PHAGE_Entero_mEp460: tail fiber component; PP_04485; phage(gi428782332) 1e-64 Click
24486689..4487261 PHAGE_Entero_mEp460: tail assembly protein; PP_04486; phage(gi428782333) 1e-71 Click
34487322..4487492 PHAGE_Entero_mEp460: host specificity protein; PP_04487; phage(gi428782334) 3e-10 Click
4complement(4487520..4487711) hypothetical protein ECH74115_B0058 [Escherichia coli O157:H7 str. EC4115] gi|209395559|ref|YP_002268439.1|; PP_04488 7e-26 Click
5complement(4487708..4488055) hypothetical protein ECH74115_B0056 [Escherichia coli O157:H7 str. EC4115] gi|209395597|ref|YP_002268438.1|; PP_04489 2e-40 Click
64488286..4489455 PHAGE_Clostr_st: putative IS transposase (OrfB); PP_04490; phage(gi80159731) 6e-74 Click
74489496..4489945 PHAGE_Entero_mEp460: tail fiber component; PP_04491; phage(gi428782332) 7e-85 Click
84489978..4490484 PHAGE_Entero_mEp460: tail assembly protein; PP_04492; phage(gi428782333) 1e-72 Click
94490545..4491090 PHAGE_Entero_mEp460: host specificity protein; PP_04493; phage(gi428782334) 2e-10 Click
104491092..4491559 hypothetical protein RPSI07_mp1169 [Ralstonia solanacearum PSI07] gi|300694150|ref|YP_003750123.1|; PP_04494 8e-41 Click
114491800..4492081 PROPHAGE_Escher_MG1655: predicted transposase; PP_04495; phage(gi16131356) 2e-47 Click
12complement(4492068..4492349) PHAGE_Pseudo_YuA: hypothetical protein; PP_04496; phage(gi162135127) 6e-10 Click
13complement(4492767..4493537) hypothetical protein SFxv_5049 [Shigella flexneri 2002017] gi|384546186|ref|YP_005712098.1|; PP_04497 3e-141 Click
14complement(4493582..4494016) hypothetical protein SeHA_A0045 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447297|ref|YP_002043883.1|; PP_04498 2e-71 Click
15complement(4494028..4494249) hypothetical protein UTI89_P076 [Escherichia coli UTI89] gi|91206321|ref|YP_538675.1|; PP_04499 3e-35 Click
16complement(4494250..4494897) PHAGE_Natria_PhiCh1: adenine methyltransferase; PP_04500; phage(gi22091198) 2e-20 Click
174495064..4495222 hypothetical protein ECO26_1350 [Escherichia coli O26:H11 str. 11368] gi|260854501|ref|YP_003228392.1|; PP_04501 4e-19 Click
184495219..4495569 PHAGE_Stx2_c_1717: transposase; PP_04502; phage(gi209447152) 3e-39 Click

Region 15, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14508498..4509358 PROPHAGE_Escher_MG1655: predicted transposase; PP_04520; phage(gi16131356) 9e-143 Click
24509327..4509629 PROPHAGE_Escher_MG1655: predicted transposase; PP_04521; phage(gi16131356) 7e-53 Click
3complement(4509859..4510284) PHAGE_Entero_P4: transactivation protein; PP_04522; phage(gi9627519) 2e-75 Click
4complement(4510356..4510568) PHAGE_Entero_P4: head size determination protein sid; PP_04523; phage(gi9627518) 2e-33 Click
5complement(4510576..4510803) PHAGE_Entero_P4: head size determination protein sid; PP_04524; phage(gi9627518) 8e-39 Click
6complement(4510790..4511428) Rhs-family protein [Shigella flexneri 2a str. 2457T] gi|30062130|ref|NP_836301.1|; PP_04525 4e-116 Click
74511531..4511731 hypothetical protein EpC_31840 [Erwinia pyrifoliae Ep1/96] gi|259909809|ref|YP_002650165.1|; PP_04526 7e-18 Click
8complement(4511776..4512114) Hypothetical protein W5S_3964 [Pectobacterium sp. SCC3193] gi|470156397|ref|YP_006284899.1|; PP_04527 4e-06 Click
9complement(4512135..4512323) hypothetical; PP_04528 0.0 Click
104512734..4513297 PHAGE_Entero_mEp460: hypothetical protein; PP_04529; phage(gi428782350) 3e-101 Click
114513425..4513757 PHAGE_Entero_mEp460: hypothetical protein; PP_04530; phage(gi428782349) 1e-59 Click

Region 16, total : 77 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14722196..4722207 attL    CATATTTTGTGA 0.0 Click
2complement(4729272..4731185) PHAGE_Parame_AR158: hypothetical protein AR158_C788L; PP_04753; phage(gi157953978) 8e-34 Click
3complement(4731530..4731835) PHAGE_Entero_SfV: tail protein; PP_04754; phage(gi19549008) 8e-43 Click
4complement(4731835..4732383) PHAGE_Entero_SfV: tail protein; PP_04755; phage(gi19549007) 4e-99 Click
5complement(4732383..4733405) PHAGE_Entero_SfV: tail protein; PP_04756; phage(gi19549006) 0.0 Click
64733453..4733980 PHAGE_Lausan: putative translation elongation factor 1-alpha; PP_04757; phage(gi327409596) 2e-17 Click
74734145..4734636 elongation factor Tu [Shigella sonnei Ss046] gi|74314474|ref|YP_312893.1|; PP_04758 5e-88 Click
84734806..4734991 PHAGE_Entero_SfV: tail protein; PP_04759; phage(gi19548988) 1e-34 Click
94734995..4735345 PHAGE_Salmon_ST64B: tail protein; PP_04760; phage(gi23505468) 7e-21 Click
10complement(4735317..4736054) outer membrane protein assembly complex subunit YfiO [Shigella sonnei Ss046] gi|74313154|ref|YP_311573.1|; PP_04761 1e-137 Click
114736189..4737169 23S rRNA pseudouridine synthase D [Shigella sonnei Ss046] gi|74313153|ref|YP_311572.1|; PP_04762 0.0 Click
124737166..4737897 hypothetical protein ECIAI1_2716 [Escherichia coli IAI1] gi|218555173|ref|YP_002388086.1|; PP_04763 8e-136 Click
134738027..4740600 PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; PP_04764; phage(gi15800640) 2e-75 Click
144740729..4741823 glutamate decarboxylase [Shigella sonnei Ss046] gi|74313937|ref|YP_312356.1|; PP_04765 0.0 Click
15complement(4741871..4742467) PHAGE_Bacill_BtCS33: integrase; PP_04766; phage(gi392972759) 6e-07 Click
16complement(4742947..4743549) PHAGE_Thermu_26: phage XerD-like integrase; PP_04767; phage(gi157265417) 5e-09 Click
17complement(4744145..4744312) hypothetical; PP_04768 0.0 Click
184744515..4744526 attR    CATATTTTGTGA 0.0 Click
19complement(4744785..4744916) hypothetical; PP_04769 0.0 Click
204745016..4745732 hypothetical protein SSON_4473 [Shigella sonnei Ss046] gi|74314766|ref|YP_313185.1|; PP_04770 3e-142 Click
214745752..4746858 PHAGE_Yoka_poxvirus: kelch-like protein; PP_04771; phage(gi345107356) 9e-05 Click
224746923..4747909 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; PP_04772; phage(gi116221995) 5e-105 Click
234747911..4748219 hypothetical protein EcHS_A4533 [Escherichia coli HS] gi|157163751|ref|YP_001461069.1|; PP_04773 4e-56 Click
244748339..4748578 hypothetical protein SARI_03097 [Salmonella enterica subsp. arizonae serovar 62:z4,z23:- str. RSK2980] gi|161504967|ref|YP_001572079.1|; PP_04774 4e-33 Click
254748685..4749278 hypothetical; PP_04775 0.0 Click
264749459..4749620 PHAGE_Entero_P4: head size determination protein sid; PP_04776; phage(gi9627518) 4e-18 Click
27complement(4749885..4750019) PHAGE_Entero_P4: hypothetical protein P4p08; PP_04777; phage(gi9627514) 1e-22 Click
28complement(4750012..4750299) PHAGE_Entero_P4: helper derepression protein; PP_04778; phage(gi9627515) 1e-49 Click
29complement(4750292..4750447) PHAGE_Entero_P4: putative CI repressor; PP_04779; phage(gi9627516) 8e-22 Click
304750511..4750684 hypothetical protein UTI89_P080 [Escherichia coli UTI89] gi|91206325|ref|YP_538679.1|; PP_04780 5e-24 Click
314750681..4750872 hypothetical protein ECH74115_B0058 [Escherichia coli O157:H7 str. EC4115] gi|209395559|ref|YP_002268439.1|; PP_04781 6e-27 Click
324750869..4750991 hypothetical; PP_04782 0.0 Click
33complement(4751047..4751427) hypothetical protein Pecwa_0515 [Pectobacterium wasabiae WPP163] gi|261819852|ref|YP_003257958.1|; PP_04783 4e-16 Click
34complement(4751430..4751600) hypothetical; PP_04784 0.0 Click
35complement(4752000..4752332) Hypothetical protein W5S_0377 [Pectobacterium sp. SCC3193] gi|470152874|ref|YP_006281376.1|; PP_04785 1e-29 Click
364752546..4752662 hypothetical; PP_04786 0.0 Click
37complement(4752725..4752862) hypothetical protein UM146_24316 [Escherichia coli UM146] gi|386602567|ref|YP_006104075.1|; PP_04787 7e-18 Click
384752891..4753148 hypothetical protein UTI89_P085 [Escherichia coli UTI89] gi|91206330|ref|YP_538684.1|; PP_04788 3e-44 Click
394753598..4754998 gamma-aminobutyrate:proton symporter, AAT family [Enterobacteriaceae bacterium strain FGI 57] gi|440288178|ref|YP_007340943.1|; PP_04789 0.0 Click
404755019..4755678 DNA-binding transcriptional regulator CsiR [Shigella sonnei Ss046] gi|161986465|ref|YP_311654.2|; PP_04790 1e-111 Click
41complement(4755682..4756131) PHAGE_Clostr_CD119: XkdP protein; PP_04791; phage(gi90592656) 4e-09 Click
42complement(4756215..4756373) hypothetical protein SSON_2810 [Shigella sonnei Ss046] gi|74313237|ref|YP_311656.1|; PP_04792 8e-24 Click
434756556..4756855 hypothetical protein SSON_2811 [Shigella sonnei Ss046] gi|74313238|ref|YP_311657.1|; PP_04793 2e-45 Click
444756865..4757389 inner membrane protein [Escherichia coli W] gi|386610032|ref|YP_006125518.1|; PP_04794 2e-85 Click
45complement(4757436..4757837) DNA binding protein [Escherichia coli O7:K1 str. CE10] gi|386625386|ref|YP_006145114.1|; PP_04795 4e-66 Click
464758504..4758953 hypothetical protein EC042_2866 [Escherichia coli 042] gi|387608310|ref|YP_006097166.1|; PP_04796 2e-78 Click
47complement(4758990..4759334) hypothetical protein SSON_2816 [Shigella sonnei Ss046] gi|74313243|ref|YP_311662.1|; PP_04797 2e-58 Click
484759485..4759814 hypothetical protein SSON_2817 [Shigella sonnei Ss046] gi|74313244|ref|YP_311663.1|; PP_04798 4e-55 Click
49complement(4759870..4761204) PHAGE_Strept_TG1: putative regulator, GntR family; PP_04799; phage(gi410491962) 3e-06 Click
504761292..4761723 hypothetical protein EFER_0398 [Escherichia fergusonii ATCC 35469] gi|218547811|ref|YP_002381602.1|; PP_04800 4e-74 Click
514761932..4762177 PHAGE_Rhodoc_REQ2: hypothetical protein; PP_04801; phage(gi372449877) 4e-11 Click
524762174..4762584 PHAGE_Bacill_SP10: ribonucleotide reductase stimulatory protein; PP_04802; phage(gi418489617) 6e-15 Click
534762557..4764701 PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; PP_04803; phage(gi158079505) 0.0 Click
544764711..4765358 PHAGE_Mycoba_Myrna: gp256; PP_04804; phage(gi203454817) 3e-89 Click
554765387..4765671 PHAGE_Mycoba_Myrna: gp256; PP_04805; phage(gi203454817) 1e-30 Click
564766028..4767230 PHAGE_Plankt_PaV_LD: ABC transporter; PP_04806; phage(gi371496158) 1e-24 Click
574767223..4768287 PHAGE_Lactob_KC5a: putative minor tail protein; PP_04807; phage(gi90592623) 6e-06 Click
584768345..4769337 glycine betaine transporter periplasmic subunit [Escherichia fergusonii ATCC 35469] gi|218547804|ref|YP_002381595.1|; PP_04808 0.0 Click
594769459..4769749 Rhs family protein [Shigella flexneri 5 str. 8401] gi|110804665|ref|YP_688185.1|; PP_04809 1e-31 Click
604769713..4770108 Rhs-family protein [Shigella flexneri 2a str. 2457T] gi|30062130|ref|NP_836301.1|; PP_04810 2e-64 Click
614770543..4770836 hypothetical protein CSSP291_18030 [Cronobacter sakazakii SP291] gi|449310104|ref|YP_007442460.1|; PP_04811 6e-30 Click
62complement(4770802..4771155) PHAGE_Salmon_ST64B: Portal Protein; PP_04812; phage(gi23505449) 2e-56 Click
63complement(4771250..4771783) PHAGE_Salmon_ST64B: Portal Protein; PP_04813; phage(gi23505449) 2e-98 Click
64complement(4771783..4771959) PHAGE_Salmon_ST64B: putative integral membrane protein; PP_04814; phage(gi23505448) 1e-27 Click
65complement(4771977..4773710) PHAGE_Entero_SfV: large terminase subunit; PP_04815; phage(gi19548992) 0.0 Click
66complement(4773766..4774200) PHAGE_Entero_SfV: small terminase subunit; PP_04816; phage(gi19548991) 2e-71 Click
67complement(4774327..4774746) PHAGE_Salmon_ST64B: hypothetical protein sb56; PP_04817; phage(gi23505500) 1e-64 Click
68complement(4774743..4774946) hypothetical protein PPUBIRD1_2123 [Pseudomonas putida BIRD-1] gi|386011690|ref|YP_005929967.1|; PP_04818 6e-09 Click
69complement(4775064..4775222) hypothetical; PP_04819 0.0 Click
70complement(4775477..4775920) PHAGE_Escher_HK75: Rz; PP_04820; phage(gi356870731) 6e-54 Click
71complement(4775917..4776036) PHAGE_Escher_HK75: lysozyme; PP_04821; phage(gi356870730) 2e-10 Click
72complement(4776598..4777479) PHAGE_Salmon_SE2: DNA methylase N-4/N-6 domain protein; PP_04822; phage(gi375267272) 2e-52 Click
73complement(4777595..4778206) PHAGE_Escher_HK639: endochitinase; PP_04823; phage(gi356870669) 3e-83 Click
74complement(4778206..4778487) PHAGE_Entero_mEp390: putative holin; PP_04824; phage(gi428782713) 1e-21 Click
75complement(4778474..4778860) PHAGE_Entero_mEp390: putative holin; PP_04825; phage(gi428782712) 3e-39 Click
76complement(4779021..4779662) PHAGE_Entero_mEp237: hypothetical protein; PP_04826; phage(gi435439321) 1e-120 Click
77complement(4780135..4780887) PHAGE_Entero_SfV: antitermination protein Q; PP_04827; phage(gi19549033) 1e-145 Click
78complement(4780901..4781818) PHAGE_Entero_mEp460: hypothetical protein; PP_04828; phage(gi428782365) 0.0 Click
79complement(4781898..4782452) PHAGE_Entero_mEp460: KilA-N domain protein; PP_04829; phage(gi428782364) 3e-100 Click