Escherichia coli TW11681 , whole genome shotgun sequence. [asmbl_id: NC_000000].5305843, GC%: 50.69%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1282903..282914 attL    GCAGCAAATCAA 0.0 Click
2complement(290845..292008) PHAGE_Entero_SfV: integrase; PP_00309; phage(gi19549014) 0.0 Click
3complement(292235..292540) PHAGE_Entero_SfV: hypothetical protein SfVp28; PP_00310; phage(gi19549015) 4e-53 Click
4complement(292540..292881) PHAGE_Entero_SfV: hypothetical protein SfVp29; PP_00311; phage(gi19549016) 3e-65 Click
5complement(292893..293429) PHAGE_Entero_SfV: hypothetical protein SfVp30; PP_00312; phage(gi19549017) 2e-101 Click
6complement(293557..294381) PHAGE_Entero_SfV: hypothetical protein SfVp31; PP_00313; phage(gi19549018) 3e-151 Click
7complement(294447..294809) PHAGE_Entero_SfV: hypothetical protein SfVp32; PP_00314; phage(gi19549019) 2e-62 Click
8295027..295794 PHAGE_Entero_HK630: HkaP protein; PP_00315; phage(gi428782827) 9e-13 Click
9complement(296009..296269) PHAGE_Entero_SfV: repressor; PP_00316; phage(gi19549021) 1e-47 Click
10296774..296974 PHAGE_Entero_SfV: repressor; PP_00317; phage(gi19549022) 4e-33 Click
11297018..297575 PHAGE_Entero_SfV: hypothetical protein SfVp36; PP_00318; phage(gi19549023) 1e-92 Click
12297920..298861 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_00319; phage(gi18249881) 3e-41 Click
13298877..299395 PHAGE_Entero_HK630: tail fiber assembly protein; PP_00320; phage(gi428782810) 5e-82 Click
14306185..306196 attR    GCAGCAAATCAA 0.0 Click

Region 2, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1551188..1551727) PHAGE_Acanth_1: hypothetical protein ATCV1_Z765R; PP_01463; phage(gi155371712) 3e-05 Click
2complement(1551829..1553001) putative 3-hydroxyphenylpropionic transporter MhpT [Shigella sonnei 53G] gi|383176935|ref|YP_005454940.1|; PP_01464 0.0 Click
3complement(1553733..1554038) PHAGE_Stx2_c_1717: truncated transposase; PP_01465; phage(gi209447151) 3e-14 Click
4complement(1554447..1555385) PHAGE_Salmon_RE_2010: capsid packaging protein; PP_01466; phage(gi418489696) 7e-157 Click
5complement(1555385..1557151) PHAGE_Salmon_RE_2010: terminase ATPase subunit; PP_01467; phage(gi418489697) 0.0 Click
6complement(1557161..1557295) hypothetical protein KO11_19445 [Escherichia coli KO11FL] gi|386702370|ref|YP_006166207.1|; PP_01468 2e-17 Click
71557294..1558127 PHAGE_Salmon_RE_2010: capsid scaffolding protein; PP_01469; phage(gi418489698) 4e-131 Click
81558144..1558521 PHAGE_Salmon_RE_2010: major capsid protein; PP_01470; phage(gi418489699) 8e-59 Click
91558718..1558936 PHAGE_Salmon_RE_2010: OGR regulator of late gene transcription; PP_01471; phage(gi418489727) 5e-22 Click

Region 3, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12233825..2235192 PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; PP_02127; phage(gi163932195) 2e-05 Click
2complement(2235228..2235716) electron transport protein ygfS [Escherichia coli O55:H7 str. CB9615] gi|291284206|ref|YP_003501024.1|; PP_02128 8e-91 Click
3complement(2235716..2237650) oxidoreductase Fe-S binding subunit [Escherichia coli O55:H7 str. CB9615] gi|291284207|ref|YP_003501025.1|; PP_02129 0.0 Click
4complement(2237738..2237929) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_02130; phage(gi157166067) 2e-29 Click
5complement(2237895..2238044) PHAGE_Stx2_c_1717: transposase; PP_02131; phage(gi209447179) 2e-10 Click
62238161..2238346 PHAGE_Stx2_c_1717: transposase; PP_02132; phage(gi209447153) 2e-17 Click
7complement(2238404..2238523) hypothetical; PP_02133 0.0 Click
8complement(2238931..2239137) PHAGE_Entero_HK630: hypothetical protein; PP_02134; phage(gi428782856) 9e-29 Click
9complement(2240021..2240194) hypothetical protein NRG857_07780 [Escherichia coli O83:H1 str. NRG 857C] gi|387616892|ref|YP_006119914.1|; PP_02135 1e-23 Click
10complement(2240867..2241079) PHAGE_Lactoc_bIL312: Csp; PP_02136; phage(gi13095918) 1e-15 Click
11complement(2241441..2241923) PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; PP_02137; phage(gi16765210) 2e-53 Click
12complement(2241935..2242468) PHAGE_Entero_mEp460: endolysin; PP_02138; phage(gi428782372) 2e-97 Click
13complement(2242465..2242776) PHAGE_Entero_mEp460: hypothetical protein; PP_02139; phage(gi428782371) 1e-29 Click
14complement(2242781..2242987) PHAGE_Entero_mEp460: porin; PP_02140; phage(gi428782370) 1e-31 Click
15complement(2243750..2243965) PHAGE_Lactoc_bIL312: Csp; PP_02141; phage(gi13095918) 5e-16 Click
162244266..2244478 cold shock protein; Qin prophage [Escherichia fergusonii ATCC 35469] gi|218551642|ref|YP_002385434.1|; PP_02142 5e-32 Click
17complement(2244900..2245652) PHAGE_Entero_mEp460: late gene regulator; PP_02143; phage(gi428782366) 4e-137 Click
18complement(2245666..2246592) PHAGE_Entero_mEp460: hypothetical protein; PP_02144; phage(gi428782365) 1e-101 Click
19complement(2247062..2247313) Qin prophage; hypothetical protein [Escherichia coli W] gi|386608944|ref|YP_006124430.1|; PP_02145 1e-40 Click
20complement(2247375..2247491) hypothetical protein CE10_1832 [Escherichia coli O7:K1 str. CE10] gi|386624180|ref|YP_006143908.1|; PP_02146 1e-12 Click
21complement(2248044..2248283) bifunctional antitoxin/transcriptional repressor RelB [Shigella flexneri 5 str. 8401] gi|110805508|ref|YP_689028.1|; PP_02147 2e-36 Click
222248690..2248965 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; PP_02148; phage(gi157166066) 3e-47 Click
232248965..2249852 PROPHAGE_Escher_Sakai: putative transposase; PP_02149; phage(gi15834498) 7e-167 Click

Region 4, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12806374..2806386 attL    TGTGATTACCGTT 0.0 Click
22814955..2817546 PROPHAGE_Escher_CFT073: Pic serine protease precursor; PP_02702; phage(gi26246250) 6e-17 Click
3complement(2818748..2819029) hypothetical protein G2583_1404 [Escherichia coli O55:H7 str. CB9615] gi|291282163|ref|YP_003498981.1|; PP_02703 4e-38 Click
4complement(2819103..2819645) PHAGE_Entero_HK629: terminase small subunit nu1; PP_02704; phage(gi428782012) 8e-25 Click
5complement(2819847..2820230) hypothetical protein NRG857_05770 [Escherichia coli O83:H1 str. NRG 857C] gi|387616495|ref|YP_006119517.1|; PP_02705 2e-64 Click
6complement(2820242..2820583) PHAGE_Entero_HK629: head decoration protein; PP_02706; phage(gi428782018) 7e-10 Click
7complement(2820593..2821633) PHAGE_Entero_HK629: major head subunit; PP_02707; phage(gi428782019) 1e-66 Click
8complement(2821850..2822272) PHAGE_Staphy_1: ss-DNA-binding protein; PP_02708; phage(gi156603906) 6e-09 Click
9complement(2822269..2822520) hypothetical protein ECO26_3113 [Escherichia coli O26:H11 str. 11368] gi|260856174|ref|YP_003230065.1|; PP_02709 2e-32 Click
10complement(2822723..2824129) PHAGE_Rhizob_3: p101; PP_02710; phage(gi195546631) 2e-28 Click
11complement(2824126..2824413) putative prophage protein [Escherichia coli 042] gi|387607877|ref|YP_006096733.1|; PP_02711 3e-34 Click
12complement(2824419..2824646) hypothetical protein NRG857_05735 [Escherichia coli O83:H1 str. NRG 857C] gi|387616488|ref|YP_006119510.1|; PP_02712 9e-15 Click
13complement(2824639..2824875) hypothetical protein ECSP_1494 [Escherichia coli O157:H7 str. TW14359] gi|254792574|ref|YP_003077411.1|; PP_02713 9e-28 Click
14complement(2824865..2825071) hypothetical protein ECOK1_0886 [Escherichia coli IHE3034] gi|386598602|ref|YP_006100108.1|; PP_02715 6e-28 Click
152825268..2825573 hypothetical protein EC55989_0273 [Escherichia coli 55989] gi|218693732|ref|YP_002401399.1|; PP_02714 5e-48 Click
16complement(2826063..2826269) hypothetical protein ECO26_3104 [Escherichia coli O26:H11 str. 11368] gi|260856165|ref|YP_003230056.1|; PP_02716 5e-23 Click
172826271..2826438 hypothetical; PP_02717 0.0 Click
182826434..2826446 attR    TGTGATTACCGTT 0.0 Click
19complement(2826439..2826681) hypothetical protein ECO26_3103 [Escherichia coli O26:H11 str. 11368] gi|260856164|ref|YP_003230055.1|; PP_02718 2e-22 Click
20complement(2826795..2827688) PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; PP_02719; phage(gi16130540) 5e-94 Click

Region 5, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13310839..3310855 attL    CGCCTTATCCGGCCTAC 0.0 Click
2complement(3314011..3314310) PHAGE_Yersin_413C: Ogr; PP_03192; phage(gi30065732) 3e-56 Click
3complement(3314310..3315473) PHAGE_Yersin_413C: gpD; PP_03193; phage(gi30065731) 0.0 Click
4complement(3315473..3315952) PHAGE_Yersin_413C: gpU; PP_03194; phage(gi30065730) 6e-85 Click
5complement(3315967..3318414) PHAGE_Yersin_413C: gpT; PP_03195; phage(gi30065729) 0.0 Click
6complement(3318559..3318834) PHAGE_Yersin_413C: gpE; PP_03196; phage(gi30065727) 3e-44 Click
7complement(3318891..3319409) PHAGE_Yersin_413C: FII; PP_03197; phage(gi30065726) 6e-93 Click
8complement(3319422..3320612) PHAGE_Yersin_413C: gpFI; PP_03198; phage(gi30065725) 0.0 Click
93320636..3320842 hypothetical; PP_03199 0.0 Click
10complement(3320943..3321353) PHAGE_Entero_HK106: tail fiber assembly protein; PP_03200; phage(gi428783304) 1e-26 Click
11complement(3321353..3323518) PHAGE_Klebsi_JD001: putative tail-fiber protein; PP_03201; phage(gi448245166) 2e-67 Click
12complement(3323515..3324126) PHAGE_Yersin_413C: gpI; PP_03202; phage(gi30065721) 9e-84 Click
13complement(3324119..3325027) PHAGE_Yersin_413C: gpJ; PP_03203; phage(gi30065720) 1e-164 Click
14complement(3325032..3325379) PHAGE_Yersin_413C: gpW; PP_03204; phage(gi30065719) 1e-60 Click
15complement(3325376..3326011) PHAGE_Yersin_413C: gpV; PP_03205; phage(gi30065718) 4e-114 Click
16complement(3326078..3326530) PHAGE_Yersin_413C: gpS; PP_03206; phage(gi30065717) 3e-79 Click
17complement(3326523..3326990) PHAGE_Yersin_413C: gpR; PP_03207; phage(gi30065716) 2e-82 Click
18complement(3326953..3327111) PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_03208; phage(gi431810968) 2e-10 Click
19complement(3327098..3327523) PHAGE_Yersin_413C: LysB; PP_03209; phage(gi30065715) 1e-70 Click
20complement(3327511..3327936) PHAGE_Yersin_413C: LysA; PP_03210; phage(gi30065714) 2e-66 Click
21complement(3327951..3328448) PHAGE_Yersin_413C: gpK; PP_03211; phage(gi30065713) 3e-93 Click
22complement(3328448..3328729) PHAGE_Yersin_413C: gpY; PP_03212; phage(gi30065712) 3e-46 Click
23complement(3328733..3328852) PHAGE_Yersin_413C: gpX; PP_03213; phage(gi30065711) 9e-16 Click
24complement(3328936..3329409) PHAGE_Yersin_413C: gpL; PP_03214; phage(gi30065710) 6e-85 Click
25complement(3329545..3330294) PHAGE_Yersin_413C: gpM; PP_03215; phage(gi30065709) 4e-132 Click
26complement(3330298..3331371) PHAGE_Yersin_413C: gpN; PP_03216; phage(gi30065708) 0.0 Click
27complement(3331430..3332284) PHAGE_Yersin_413C: gpO; PP_03217; phage(gi30065707) 3e-160 Click
283332458..3334230 PHAGE_Yersin_413C: gpP; PP_03218; phage(gi30065706) 0.0 Click
293334230..3335264 PHAGE_Yersin_413C: gpQ; PP_03219; phage(gi30065705) 0.0 Click
303335477..3335614 hypothetical; PP_03220 0.0 Click
313335679..3336800 PHAGE_Yersin_413C: hypothetical protein L-413Cp40; PP_03221; phage(gi30065744) 3e-99 Click
323336790..3337779 hypothetical Protein PANA_3163 [Pantoea ananatis LMG 20103] gi|291618716|ref|YP_003521458.1|; PP_03222 2e-103 Click
33complement(3337787..3338731) PHAGE_Thermu_26: C5 cytosine-specific DNA methylase; PP_03223; phage(gi157265426) 3e-36 Click
34complement(3338933..3341209) PHAGE_Yersin_413C: gpA; PP_03224; phage(gi30065742) 0.0 Click
35complement(3341199..3341474) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; PP_03225; phage(gi30065741) 3e-46 Click
36complement(3341471..3341695) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; PP_03226; phage(gi30065740) 2e-36 Click
37complement(3341698..3341997) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; PP_03227; phage(gi30065739) 6e-44 Click
38complement(3341997..3342221) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; PP_03228; phage(gi30065738) 1e-33 Click
39complement(3342285..3342776) PHAGE_Yersin_413C: gpB; PP_03229; phage(gi30065737) 3e-92 Click
40complement(3342782..3342952) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; PP_03230; phage(gi30065736) 1e-26 Click
41complement(3342955..3343227) PHAGE_Yersin_413C: Cox; PP_03231; phage(gi30065735) 9e-48 Click
423343727..3344707 PHAGE_Yersin_413C: Int; PP_03232; phage(gi30065733) 0.0 Click
43complement(3344894..3345394) repressor CpxP [Shigella sonnei Ss046] gi|161986403|ref|YP_312833.2|; PP_03233 9e-88 Click
443345544..3346242 PHAGE_Feldma_virus: putative sensor histidine kinase; PP_03234; phage(gi197322366) 4e-09 Click
453346239..3347612 PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; PP_03235; phage(gi197322490) 1e-08 Click
46complement(3347718..3348392) hypothetical protein ECBD_4113 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253775450|ref|YP_003038281.1|; PP_03236 1e-128 Click
47complement(3348541..3349524) PHAGE_Strept_Sfi11: putative minor tail protein; PP_03237; phage(gi9635024) 3e-06 Click
483356514..3356530 attR    CGCCTTATCCGGCCTAC 0.0 Click

Region 6, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3403895..3407071) PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_03282; phage(gi414087138) 5e-12 Click
2complement(3407111..3407506) PHAGE_Entero_P1: InsB; PP_03283; phage(gi46401642) 1e-73 Click
3complement(3407533..3407808) PHAGE_Entero_P1: InsA; PP_03284; phage(gi46401643) 1e-46 Click
4complement(3407842..3408438) methyl-accepting chemotaxis protein [Enterobacteriaceae bacterium strain FGI 57] gi|440289237|ref|YP_007342002.1|; PP_03285 4e-93 Click
5complement(3408561..3409613) malate/lactate dehydrogenase [Enterobacteriaceae bacterium strain FGI 57] gi|440289238|ref|YP_007342003.1|; PP_03286 8e-139 Click
6complement(3409702..3410493) PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; PP_03287; phage(gi326781942) 3e-05 Click
7complement(3410503..3410748) PHAGE_Megavi_lba: putative zinc-type alcohol dehydrogenase-like protein; PP_03288; phage(gi448825331) 2e-05 Click
8complement(3410819..3411037) PHAGE_Entero_P1: InsB; PP_03289; phage(gi46401642) 3e-32 Click
9complement(3410997..3411206) PHAGE_Entero_P1: InsB; PP_03290; phage(gi46401642) 9e-29 Click
10complement(3411233..3411460) PHAGE_Entero_P1: InsA; PP_03291; phage(gi46401643) 1e-38 Click

Region 7, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3766793..3767098) PHAGE_Stx2_c_1717: truncated transposase; PP_03634; phage(gi209447151) 3e-14 Click
2complement(3768135..3768299) hypothetical; PP_03635 0.0 Click
33768443..3768562 putative phage protein [Escherichia coli ETEC H10407] gi|387611684|ref|YP_006114800.1|; PP_03636 2e-15 Click
43768644..3769189 PHAGE_Entero_HK629: terminase small subunit nu1; PP_03637; phage(gi428782012) 7e-82 Click
53769164..3771089 PHAGE_Entero_HK629: terminase large subunit A; PP_03638; phage(gi428782013) 0.0 Click
63771086..3771292 PHAGE_Entero_HK629: head-tail connector; PP_03639; phage(gi428782014) 4e-32 Click
73771289..3772890 PHAGE_Entero_HK629: portal protein; PP_03640; phage(gi428782015) 0.0 Click
83772871..3774190 PHAGE_Entero_HK629: head maturation protease; PP_03641; phage(gi428782016) 0.0 Click
93774200..3774532 PHAGE_Entero_HK629: head decoration protein; PP_03642; phage(gi428782018) 6e-57 Click
103774588..3775613 PHAGE_Entero_HK629: major head subunit; PP_03643; phage(gi428782019) 0.0 Click
113775655..3776050 PHAGE_Entero_HK629: DNA packaging protein Fi; PP_03644; phage(gi428782020) 2e-56 Click
123776062..3776415 PHAGE_Entero_HK629: head-tail connector Fii; PP_03645; phage(gi428782021) 1e-62 Click
133776427..3777005 PHAGE_Entero_HK629: minor tail protein; PP_03646; phage(gi428782022) 1e-99 Click
143777002..3777397 PHAGE_Entero_HK629: minor tail protein; PP_03647; phage(gi428782023) 2e-70 Click
153777405..3778145 PHAGE_Entero_HK629: major tail protein; PP_03648; phage(gi428782024) 6e-136 Click
163778161..3778583 PHAGE_Entero_HK629: minor tail protein; PP_03649; phage(gi428782025) 8e-69 Click
173778565..3778999 PHAGE_Entero_HK629: tail assembly protein; PP_03650; phage(gi428782026) 4e-81 Click
183778992..3781547 PHAGE_Entero_HK629: tail length tape measure protein; PP_03651; phage(gi428782027) 0.0 Click
193781544..3781873 PHAGE_Entero_HK629: minor tail protein; PP_03652; phage(gi428782028) 2e-59 Click
203781873..3782571 PHAGE_Entero_HK629: minor tail protein; PP_03653; phage(gi428782029) 3e-133 Click
213782721..3783320 PHAGE_Entero_HK629: tail component protein; PP_03654; phage(gi428782030) 2e-117 Click
223783317..3783889 PHAGE_Entero_HK629: tail component protein; PP_03655; phage(gi428782031) 5e-100 Click
233783949..3784644 PHAGE_Entero_HK629: tail fiber; PP_03656; phage(gi428782032) 4e-115 Click
243784605..3787427 PHAGE_Entero_HK629: tail fiber; PP_03657; phage(gi428782032) 0.0 Click
253787495..3788094 PHAGE_Entero_mEp460: Lom protein; PP_03658; phage(gi428782335) 1e-97 Click
26complement(3788095..3788223) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; PP_03659; phage(gi157166059) 2e-17 Click
27complement(3788326..3789270) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_03660; phage(gi9626267) 8e-54 Click
28complement(3789282..3789443) hypothetical; PP_03661 0.0 Click
293789560..3791332 PHAGE_Salmon_ST64B: tail protein; PP_03662; phage(gi23505468) 1e-107 Click
303791336..3791863 PHAGE_Escher_D108: probable tail fiber assembly protein; PP_03663; phage(gi281199695) 5e-94 Click
31complement(3791892..3792425) PHAGE_Escher_D108: tail fiber assembly protein; PP_03664; phage(gi281199696) 5e-100 Click
32complement(3792428..3793087) PHAGE_Escher_D108: tail fiber fragment; PP_03665; phage(gi281199697) 5e-123 Click
333793660..3793779 PHAGE_Entero_HK629: tail fiber assembly protein; PP_03666; phage(gi428782036) 3e-10 Click
34complement(3793834..3794007) hypothetical protein SSON_2178 [Shigella sonnei Ss046] gi|74312645|ref|YP_311064.1|; PP_03667 3e-25 Click
353794559..3794828 PHAGE_Entero_HK629: tail fiber assembly protein; PP_03668; phage(gi428782036) 2e-21 Click

Region 8, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14468620..4468631 attL    GGACAAATGTCT 0.0 Click
2complement(4469180..4469839) PHAGE_Entero_HK630: tail fiber assembly protein; PP_04386; phage(gi428782810) 4e-80 Click
34469906..4470289 PHAGE_Entero_4795: putative antitermination protein Q; PP_04387; phage(gi157166023) 5e-56 Click
4complement(4470478..4471620) Outer membrane porin protein C [Escherichia coli P12b] gi|386703950|ref|YP_006167797.1|; PP_04388 0.0 Click
54472148..4472363 PHAGE_Stx2_c_II: holin; PP_04389; phage(gi302393164) 5e-28 Click
64472363..4473097 PHAGE_Entero_cdtI: lysin; PP_04390; phage(gi148609440) 4e-91 Click
7complement(4473119..4473574) PHAGE_Cronob_phiES15: hypothetical protein; PP_04391; phage(gi401817579) 5e-60 Click
8complement(4474436..4475467) hypothetical protein EAE_21170 [Enterobacter aerogenes KCTC 2190] gi|336250708|ref|YP_004594418.1|; PP_04392 0.0 Click
9complement(4475678..4476163) PHAGE_Escher_TL_2011b: putative adenine methylase; PP_04393; phage(gi418487629) 8e-57 Click
10complement(4476265..4476951) PHAGE_Entero_4795: putative replication protein P; PP_04394; phage(gi157166012) 1e-65 Click
11complement(4476948..4477967) PHAGE_Entero_4795: putative replication protein O; PP_04395; phage(gi157166011) 4e-113 Click
12complement(4477964..4478503) PHAGE_Entero_mEp237: CII protein; PP_04396; phage(gi435439306) 2e-63 Click
13complement(4478534..4478761) PHAGE_Salmon_ST160: Cro; PP_04397; phage(gi318065926) 3e-23 Click
144479079..4479564 PHAGE_Salmon_ST160: C2; PP_04398; phage(gi318065925) 8e-75 Click
154480156..4480338 hypothetical; PP_04399 0.0 Click
164480552..4480758 PHAGE_Entero_HK225: Kil protein; PP_04400; phage(gi428782413) 6e-30 Click
174480834..4481130 PHAGE_Entero_4795: putative host-nuclease inhibitor protein Gam; PP_04401; phage(gi157165999) 9e-53 Click
184481136..4481921 PHAGE_Stx2_c_I: Bet protein; PP_04402; phage(gi20065900) 2e-151 Click
194481918..4482598 PHAGE_Entero_4795: putative exonuclease; PP_04403; phage(gi157165997) 2e-131 Click
204482828..4482941 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF10; PP_04404; phage(gi157165995) 4e-14 Click
214483018..4483233 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_04405; phage(gi20065893) 7e-34 Click
224483598..4483837 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; PP_04406; phage(gi157165989) 2e-06 Click
234483971..4483982 attR    GGACAAATGTCT 0.0 Click
244483977..4484213 phage excisionase [Escherichia coli SE15] gi|387829091|ref|YP_003349028.1|; PP_04407 7e-39 Click
254484203..4484925 PHAGE_Entero_mEp235: integrase; PP_04408; phage(gi428781836) 9e-25 Click

Region 9, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14718395..4719516 PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; PP_04660; phage(gi209901309) 6e-33 Click
2complement(4719567..4719686) hypothetical protein S2141 [Shigella flexneri 2a str. 2457T] gi|30063428|ref|NP_837599.1|; PP_04661 1e-08 Click
34719892..4720938 PHAGE_Entero_mEp460: hypothetical protein; PP_04662; phage(gi428782365) 5e-111 Click
44720944..4721057 hypothetical protein ECS88_1346 [Escherichia coli S88] gi|218558204|ref|YP_002391117.1|; PP_04663 6e-15 Click
54721059..4721310 PHAGE_Escher_HK75: RusA-like protein; PP_04664; phage(gi356870726) 1e-22 Click
64721307..4721996 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_04665; phage(gi169257244) 3e-81 Click
74722207..4722282 tRNA 0.0 Click
84722363..4722438 tRNA 0.0 Click
9complement(4722401..4722520) hypothetical; PP_04666 0.0 Click
104722442..4722516 tRNA 0.0 Click
114722635..4722895 hypothetical; PP_04667 0.0 Click
124722984..4723373 PHAGE_Entero_phiP27: putative holin; PP_04668; phage(gi18249892) 2e-57 Click
134723363..4723638 PHAGE_Entero_phiP27: putative holin; PP_04669; phage(gi18249893) 2e-35 Click
144723641..4724018 PHAGE_Entero_phiP27: putative endolysin; PP_04670; phage(gi18249894) 1e-65 Click
154724060..4724215 hypothetical protein ECW_m1474 [Escherichia coli W] gi|386608709|ref|YP_006124195.1|; PP_04671 7e-20 Click
16complement(4724279..4725193) PHAGE_Stx2_c_1717: transposase; PP_04672; phage(gi209447153) 3e-115 Click
174725300..4726856 phosphoenolpyruvate carboxykinase [Escherichia coli 536] gi|110643636|ref|YP_671366.1|; PP_04673 0.0 Click
184726973..4727290 hypothetical protein ECW_m3659 [Escherichia coli W] gi|386610764|ref|YP_006126250.1|; PP_04674 5e-53 Click
194727349..4727645 HTH-type transcriptional regulator yiaG [Escherichia fergusonii ATCC 35469] gi|218550661|ref|YP_002384452.1|; PP_04675 2e-48 Click
20complement(4727676..4729028) PHAGE_Ectoca_1: EsV-1-65; PP_04676; phage(gi13242537) 4e-10 Click

Region 10, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15029689..5034971 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_05018; phage(gi414087138) 7e-20 Click
25035176..5035460 DNA-binding transcriptional regulator HipB [Escherichia coli HS] gi|157160982|ref|YP_001458300.1|; PP_05019 8e-48 Click
35035460..5036095 HipA N-terminal domain protein, partial [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773523|ref|YP_003036354.1|; PP_05020 3e-117 Click
45036102..5037016 HipA N-terminal domain protein, partial [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773523|ref|YP_003036354.1|; PP_05021 3e-121 Click
5complement(5037190..5038029) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; PP_05022; phage(gi16130763) 6e-160 Click
6complement(5038092..5038418) PROPHAGE_Escher_CFT073: transposase insC; PP_05023; phage(gi26249447) 7e-45 Click
7complement(5038460..5038804) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; PP_05024; phage(gi157166066) 6e-51 Click
85038906..5039667 PHAGE_Entero_Sf6: gene 12 protein; PP_05025; phage(gi41057290) 6e-134 Click
95039667..5041664 PHAGE_Entero_Sf6: gene 13 protein; PP_05026; phage(gi41057291) 0.0 Click
105041763..5043703 PHAGE_Entero_HK620: tail spike protein; PP_05027; phage(gi13559880) 6e-59 Click
11complement(5043856..5044185) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; PP_05028; phage(gi24111655) 5e-54 Click
125044262..5044513 PHAGE_Stx2_c_1717: transposase; PP_05029; phage(gi209447153) 2e-27 Click
13complement(5044540..5044791) hypothetical protein SFxv_5105 [Shigella flexneri 2002017] gi|384546242|ref|YP_005712154.1|; PP_05030 5e-35 Click
14complement(5044976..5045188) hypothetical protein ECH74115_B0083 [Escherichia coli O157:H7 str. EC4115] gi|209395558|ref|YP_002268460.1|; PP_05031 1e-33 Click
15complement(5045320..5045880) conjugal transfer fertility inhibition protein FinO [Shigella sonnei Ss046] gi|74313111|ref|YP_311530.1|; PP_05032 6e-101 Click
16complement(5045935..5046669) PHAGE_Xantho_Cf1c: hypothetical protein Cf1cp5; PP_05033; phage(gi17975752) 2e-14 Click
17complement(5046691..5047110) hypothetical; PP_05034 0.0 Click
18complement(5047159..5052429) PHAGE_Acinet_Acj9: Dda DNA helicase; PP_05035; phage(gi311993295) 2e-05 Click

Region 11, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5086234..5087073) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; PP_05076; phage(gi16130763) 4e-166 Click
2complement(5087097..5087375) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; PP_05077; phage(gi17546153) 4e-35 Click
3complement(5087447..5087815) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; PP_05078; phage(gi24111655) 2e-68 Click
4complement(5087839..5088204) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; PP_05079; phage(gi17546153) 1e-45 Click
55088926..5089192 Qin prophage, cold shock protein [Escherichia coli O7:K1 str. CE10] gi|386624132|ref|YP_006143860.1|; PP_05080 2e-43 Click
65089509..5090099 PHAGE_Escher_D108: G region invertase; PP_05081; phage(gi281199698) 3e-24 Click
7complement(5090371..5093655) PHAGE_Entero_mEp460: side tail fiber protein; PP_05082; phage(gi428782336) 0.0 Click
8complement(5093720..5094163) PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; PP_05083; phage(gi209447197) 4e-83 Click
9complement(5094226..5094561) PHAGE_Entero_cdtI: putative small terminase subunit; PP_05084; phage(gi148609383) 2e-47 Click
105094602..5095279 PHAGE_Stx2_c_1717: truncated transposase; PP_05085; phage(gi209447151) 4e-20 Click
115095279..5095542 PHAGE_Stx2_c_1717: transposase; PP_05086; phage(gi209447152) 3e-33 Click
125095535..5095654 Mannitol-1-phosphate 5-dehydrogenase [Escherichia coli P12b] gi|386703580|ref|YP_006167427.1|; PP_05087 4e-15 Click
13complement(5095773..5096786) PHAGE_Microm_MpV1: hypothetical protein; PP_05088; phage(gi313768235) 2e-45 Click
14complement(5096783..5097733) PHAGE_Microm_MpV1: hypothetical protein; PP_05089; phage(gi313768237) 2e-38 Click
15complement(5097730..5098539) 2-keto-4-pentenoate hydratase [Escherichia coli ATCC 8739] gi|170021270|ref|YP_001726224.1|; PP_05090 1e-150 Click
16complement(5098549..5099430) PHAGE_Mycoba_Pukovnik: gp62; PP_05091; phage(gi192824238) 1e-07 Click

Region 12, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5102771..5103118) PHAGE_Stx2_c_1717: transposase; PP_05095; phage(gi209447153) 3e-42 Click
2complement(5103150..5104721) PHAGE_Stx2_c_1717: transposase; PP_05096; phage(gi209447153) 2e-170 Click
3complement(5104741..5105088) PHAGE_Stx2_c_1717: transposase; PP_05097; phage(gi209447152) 2e-45 Click
4complement(5105088..5105738) PHAGE_Stx2_c_1717: truncated transposase; PP_05098; phage(gi209447151) 8e-17 Click
5complement(5105859..5106008) hypothetical protein ECNA114_4738 [Escherichia coli NA114] gi|386622281|ref|YP_006141861.1|; PP_05099 2e-19 Click
6complement(5106116..5106277) PHAGE_Stx2_c_II: putative host killer protein; PP_05100; phage(gi302393105) 9e-05 Click
7complement(5106453..5106971) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp06; PP_05101; phage(gi209447131) 1e-57 Click
8complement(5107073..5107690) Putative SOS inhibition protein A [Escherichia coli NA114] gi|386622279|ref|YP_006141859.1|; PP_05102 6e-114 Click
9complement(5107687..5108529) PHAGE_Natria_PhiCh1: adenine methyltransferase; PP_05103; phage(gi22091198) 9e-17 Click

Region 13, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15240985..5241041 attL    CCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGT 0.0 Click
25251850..5252392 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; PP_05335; phage(gi16130540) 3e-16 Click
35252911..5253060 hypothetical protein ECNA114_4738 [Escherichia coli NA114] gi|386622281|ref|YP_006141861.1|; PP_05336 9e-21 Click
4complement(5253041..5253376) YubN [Escherichia coli UM146] gi|386602556|ref|YP_006104064.1|; PP_05337 4e-52 Click
5complement(5253373..5253504) hypothetical; PP_05338 0.0 Click
65253566..5253694 hypothetical protein ECH74115_B0065 [Escherichia coli O157:H7 str. EC4115] gi|209395553|ref|YP_002268445.1|; PP_05339 8e-06 Click
75253736..5254251 proline aminopeptidase P II [Shigella sonnei Ss046] gi|74313466|ref|YP_311885.1|; PP_05340 1e-90 Click
85254248..5254385 2-octaprenyl-6-methoxyphenyl hydroxylase [Shigella sonnei Ss046] gi|74313465|ref|YP_311884.1|; PP_05341 1e-17 Click
95254417..5254932 hypothetical protein EcHS_A2484 [Escherichia coli HS] gi|157161821|ref|YP_001459139.1|; PP_05342 2e-97 Click
105255316..5256626 hypothetical protein UTI89_P094 [Escherichia coli UTI89] gi|229577731|ref|YP_538693.3|; PP_05343 7e-151 Click
115256681..5257115 putative regulator of SOS induction [Escherichia coli UTI89] gi|91206340|ref|YP_538694.1|; PP_05344 2e-75 Click
125257112..5257435 Putative SOS inhibition protein A [Escherichia coli NA114] gi|386622279|ref|YP_006141859.1|; PP_05345 3e-54 Click
135257410..5258105 hypothetical protein ECW_m4376 [Escherichia coli W] gi|386611421|ref|YP_006126907.1|; PP_05346 1e-102 Click
145258057..5258173 hypothetical; PP_05347 0.0 Click
15complement(5258344..5259252) nitrate reductase catalytic subunit [Shigella sonnei Ss046] gi|74312727|ref|YP_311146.1|; PP_05348 9e-114 Click
16complement(5259505..5259624) hypothetical; PP_05349 0.0 Click
17complement(5259584..5259802) hypothetical; PP_05350 0.0 Click
185260086..5260355 PHAGE_Stx2_c_1717: putative transposase; PP_05351; phage(gi209447180) 4e-45 Click
195260327..5260467 YubN [Escherichia coli UM146] gi|386602556|ref|YP_006104064.1|; PP_05352 2e-11 Click
20complement(5260448..5260597) hypothetical protein ECNA114_4738 [Escherichia coli NA114] gi|386622281|ref|YP_006141861.1|; PP_05353 9e-21 Click
21complement(5260705..5260866) PHAGE_Stx2_c_II: putative host killer protein; PP_05354; phage(gi302393105) 9e-05 Click
22complement(5261074..5261262) hypothetical protein ECNA114_4737 [Escherichia coli NA114] gi|386622280|ref|YP_006141860.1|; PP_05355 8e-08 Click
235261253..5261600 PHAGE_Stx2_c_1717: transposase; PP_05356; phage(gi209447153) 3e-42 Click
24complement(5261752..5262270) PHAGE_Stx2_c_1717: transposase; PP_05357; phage(gi209447179) 9e-94 Click
255263004..5263684 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_05358; phage(gi414086954) 3e-35 Click
265263689..5264033 beta-D-galactosidase [Shigella sonnei Ss046] gi|74310895|ref|YP_309314.1|; PP_05359 3e-25 Click
275264379..5265122 beta-lactamase TEM [Bacillus subtilis BSn5] gi|321313692|ref|YP_004205979.1|; PP_05360 2e-65 Click
28complement(5265088..5265324) autotransporter (AT) family porin [Escherichia coli HS] gi|157160883|ref|YP_001458201.1|; PP_05361 4e-27 Click
29complement(5265308..5266195) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_05362; phage(gi157166067) 1e-171 Click
30complement(5266195..5266521) PHAGE_Stx2_c_1717: putative transposase; PP_05363; phage(gi209447180) 6e-57 Click
31complement(5266547..5267464) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_05364; phage(gi157166067) 2e-169 Click
32complement(5267464..5267739) PHAGE_Stx2_c_1717: putative transposase; PP_05365; phage(gi209447180) 1e-46 Click
33complement(5267860..5269431) PHAGE_Stx2_c_1717: transposase; PP_05366; phage(gi209447153) 5e-170 Click
34complement(5269451..5269798) PHAGE_Stx2_c_1717: transposase; PP_05367; phage(gi209447152) 2e-45 Click
35complement(5269798..5270475) PHAGE_Stx2_c_1717: truncated transposase; PP_05368; phage(gi209447151) 4e-20 Click
365270617..5270748 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF79; PP_05369; phage(gi157166064) 4e-16 Click
375270729..5270884 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF79; PP_05370; phage(gi157166064) 9e-18 Click
38complement(5270878..5272017) PHAGE_Stx2_c_1717: transposase; PP_05371; phage(gi209447153) 8e-145 Click
395272380..5273888 PHAGE_Vibrio_VHML: ORF37; PP_05372; phage(gi27311204) 4e-10 Click
405274005..5274451 PHAGE_Stx2_c_1717: transposase; PP_05373; phage(gi209447179) 2e-81 Click
415281828..5281884 attR    CCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGT 0.0 Click

Region 14, total : 38 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15280175..5280576 PROPHAGE_Escher_MG1655: IS1 transposase B; PP_05377; phage(gi16131317) 8e-65 Click
2complement(5280687..5281547) beta-lactamase TEM [Bacillus subtilis BSn5] gi|321313692|ref|YP_004205979.1|; PP_05378 5e-161 Click
35281849..5282175 PHAGE_Stx2_c_1717: putative transposase; PP_05379; phage(gi209447180) 1e-56 Click
45282175..5283062 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_05380; phage(gi157166067) 1e-166 Click
55283223..5284245 PROPHAGE_Escher_CFT073: transposase; PP_05381; phage(gi26248360) 0.0 Click
6complement(5284456..5285295) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; PP_05382; phage(gi16130763) 6e-160 Click
7complement(5285358..5285684) PHAGE_Stx2_c_1717: truncated transposase; PP_05383; phage(gi209447151) 7e-05 Click
85285695..5286360 PROPHAGE_Escher_CFT073: transposase/IS protein; PP_05384; phage(gi26248359) 6e-105 Click
9complement(5286404..5286577) hypothetical protein UTI89_P020 [Escherichia coli UTI89] gi|91206265|ref|YP_538619.1|; PP_05385 3e-20 Click
105286571..5287050 PROPHAGE_Escher_CFT073: transposase IS629; PP_05386; phage(gi26250986) 2e-74 Click
115287347..5287460 transposase for IS1668 [Yersinia enterocolitica subsp. palearctica 105.5R(r)] gi|332162322|ref|YP_004298899.1|; PP_05387 4e-07 Click
125287657..5288055 putative group II intron encoded reverse transcriptase/maturase [Escherichia coli O104:H4 str. 2011C-3493] gi|407483923|ref|YP_006781072.1|; PP_05388 7e-61 Click
135288188..5288553 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; PP_05389; phage(gi17546153) 1e-45 Click
145288577..5289416 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; PP_05390; phage(gi16130763) 4e-166 Click
15complement(5289458..5290324) PROPHAGE_Escher_MG1655: IS3 transposase B; PP_05391; phage(gi16128284) 3e-173 Click
16complement(5290321..5290620) PROPHAGE_Escher_MG1655: IS3 transposase A; PP_05392; phage(gi226524700) 4e-49 Click
17complement(5290648..5290803) melibiose:sodium symporter [Shigella sonnei 53G] gi|383181435|ref|YP_005459440.1|; PP_05393 2e-16 Click
18complement(5290767..5292041) PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_05394; phage(gi414087138) 2e-24 Click
195292066..5292770 PROPHAGE_Brucel_1330: transposase, putative; PP_05395; phage(gi23502708) 6e-43 Click
20complement(5292970..5293293) beta-D-galactosidase [Shigella sonnei Ss046] gi|74310895|ref|YP_309314.1|; PP_05396 3e-25 Click
21complement(5294058..5294948) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_05397; phage(gi157166067) 3e-163 Click
225294942..5295148 hypothetical protein UTI89_P020 [Escherichia coli UTI89] gi|91206265|ref|YP_538619.1|; PP_05398 2e-24 Click
235295488..5295563 tRNA 0.0 Click
24complement(5296556..5297098) PROPHAGE_Escher_CFT073: insertion element IS2 transposase InsD; PP_05399; phage(gi26249446) 3e-103 Click
25complement(5297095..5297871) PROPHAGE_Escher_CFT073: transposase/IS protein; PP_05400; phage(gi26248359) 2e-80 Click
26complement(5297939..5298187) PROPHAGE_Escher_CFT073: transposase; PP_05401; phage(gi26248360) 6e-26 Click
275298278..5298574 hypothetical protein EcE24377A_F0028 [Escherichia coli E24377A] gi|157149333|ref|YP_001451397.1|; PP_05402 9e-12 Click
285298685..5299287 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_05403; phage(gi414086954) 1e-34 Click
295299547..5299663 hypothetical protein LPO_3035 [Legionella pneumophila subsp. pneumophila] gi|397665341|ref|YP_006506879.1|; PP_05404 2e-10 Click
30complement(5300321..5300545) elongation factor Tu [Shigella sonnei Ss046] gi|74314474|ref|YP_312893.1|; PP_05405 1e-34 Click
31complement(5300547..5301053) PHAGE_Cafete_BV_PW1: putative eIF-2gamma; PP_05406; phage(gi310831469) 2e-07 Click
32complement(5301086..5301490) PHAGE_Stx2_c_1717: transposase; PP_05407; phage(gi209447179) 2e-59 Click
33complement(5301675..5302151) reverse transcriptase-like protein [Shigella flexneri 2a str. 301] gi|24114239|ref|NP_708749.1|; PP_05408 7e-55 Click
345302162..5302527 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; PP_05409; phage(gi17546153) 1e-45 Click
35complement(5302530..5303360) PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_05410; phage(gi414086954) 3e-34 Click
36complement(5303472..5303651) hypothetical; PP_05411 0.0 Click
37complement(5303630..5304598) PROPHAGE_Escher_CFT073: transposase IS629; PP_05412; phage(gi26251021) 2e-144 Click
38complement(5304618..5304800) PHAGE_Stx2_c_1717: transposase; PP_05413; phage(gi209447152) 7e-18 Click
39complement(5304787..5304912) PHAGE_Stx2_c_1717: transposase; PP_05414; phage(gi209447152) 1e-11 Click