Escherichia coli str. K-12 substr. MG1655star strain K-12 [asmbl_id: NC_000000].4607632, GC%: 50.76%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1560727..560773 attL    CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT 0.0 Click
2complement(560787..561950) PHAGE_Salmon_epsilon34: Tyrosine integrase; PP_00530; phage(gi221328640) 0.0 Click
3complement(562070..562267) PHAGE_Entero_2008: putative exonuclease; PP_00531; phage(gi209427739) 7e-34 Click
4562447..562659 PHAGE_Stx2_c_I: P protein; PP_00532; phage(gi20065922) 3e-32 Click
5562814..563113 PROPHAGE_Escher_MG1655: IS3 transposase A; PP_00533; phage(gi226524700) 4e-49 Click
6563117..563599 PROPHAGE_Escher_MG1655: IS3 transposase B; PP_00534; phage(gi16128284) 8e-86 Click
7563910..564242 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; PP_00535; phage(gi311992758) 1e-10 Click
8564300..564311 attL    TTTTATGCTTTT 0.0 Click
9564317..564439 hypothetical protein NRG857_05587 [Escherichia coli O83:H1 str. NRG 857C] gi|387616458|ref|YP_006119480.1|; PP_00536 2e-09 Click
10564497..566023 PHAGE_Bacill_WBeta: putative site-specific recombinase; PP_00537; phage(gi85701406) 5e-09 Click
11complement(566750..566872) hypothetical protein CE10_0514 [Escherichia coli O7:K1 str. CE10] gi|386622911|ref|YP_006142639.1|; PP_00538 3e-16 Click
12567094..567846 AraC family transcriptional regulator [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253774468|ref|YP_003037299.1|; PP_00539 7e-143 Click
13568061..568516 PHAGE_Cronob_phiES15: hypothetical protein; PP_00540; phage(gi401817579) 2e-60 Click
14568679..568969 PHAGE_Entero_mEp237: hypothetical protein; PP_00541; phage(gi435439317) 8e-49 Click
15568966..569328 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_00542; phage(gi435439318) 1e-61 Click
16569325..569465 PHAGE_Entero_mEp237: hypothetical protein; PP_00543; phage(gi435439319) 1e-10 Click
17569551..569934 PHAGE_Entero_2008: antitermination protein Q; PP_00544; phage(gi209427762) 5e-56 Click
18complement(570409..570831) PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_00545; phage(gi16131377) 5e-48 Click
19complement(570872..571939) outer membrane porin protein [Escherichia coli ETEC H10407] gi|387611282|ref|YP_006114398.1|; PP_00546 0.0 Click
20572512..572727 PHAGE_Stx2_c_II: holin; PP_00547; phage(gi302393164) 5e-28 Click
21572727..573224 PHAGE_Entero_cdtI: lysin; PP_00548; phage(gi148609440) 3e-92 Click
22573221..573682 PHAGE_Entero_HK630: cell lysis protein Rz; PP_00549; phage(gi428782852) 5e-79 Click
23complement(573714..574007) PHAGE_Escher_TL_2011c: Bor protein precursor; PP_00550; phage(gi418487071) 2e-49 Click
24complement(574298..574708) PHAGE_Entero_HK630: hypothetical protein; PP_00551; phage(gi428782855) 7e-75 Click
25574994..575200 PHAGE_Entero_HK630: hypothetical protein; PP_00552; phage(gi428782856) 1e-32 Click
26complement(575365..575499) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_00553; phage(gi209427772) 1e-08 Click
27575948..576493 PHAGE_Entero_HK630: terminase small subunit nu1; PP_00554; phage(gi428782788) 1e-96 Click
28576468..577211 PHAGE_Entero_HK630: tail fiber assembly protein; PP_00555; phage(gi428782810) 8e-75 Click
29577989..578174 PHAGE_Entero_HK630: tail fiber assembly protein; PP_00556; phage(gi428782810) 4e-06 Click
30580932..580943 attR    TTTTATGCTTTT 0.0 Click
31581170..581216 attR    CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT 0.0 Click

Region 2, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11192514..1192527 attL    ATTCATCTTATTTT 0.0 Click
2complement(1193553..1194560) PHAGE_Entero_mEp235: integrase; PP_01137; phage(gi428781836) 1e-54 Click
3complement(1194661..1194792) excisionase [Escherichia coli str. K-12 substr. W3110] gi|388477221|ref|YP_489409.1|; PP_01138 5e-16 Click
4complement(1196133..1196393) PHAGE_Entero_SfV: repressor; PP_01140; phage(gi19549021) 1e-47 Click
51196464..1196604 hypothetical; PP_01139 0.0 Click
61196898..1197098 PHAGE_Entero_SfV: repressor; PP_01141; phage(gi19549022) 7e-32 Click
71197142..1197699 PHAGE_Entero_SfV: hypothetical protein SfVp36; PP_01142; phage(gi19549023) 1e-91 Click
81197875..1198054 hypothetical protein APECO78_04710 [Escherichia coli APEC O78] gi|443616267|ref|YP_007380123.1|; PP_01143 1e-29 Click
91198044..1199411 PHAGE_Entero_SfV: large terminase subunit; PP_01144; phage(gi19548992) 0.0 Click
101199423..1199605 PHAGE_Salmon_ST64B: putative integral membrane protein; PP_01145; phage(gi23505448) 9e-29 Click
111199605..1200078 PHAGE_Salmon_ST64B: Portal Protein; PP_01146; phage(gi23505449) 9e-76 Click
121200047..1200796 PHAGE_Entero_SfV: tail protein; PP_01147; phage(gi19549009) 3e-136 Click
131200787..1201371 PHAGE_Entero_SfV: tail protein; PP_01148; phage(gi19548988) 1e-113 Click
141201375..1202004 PHAGE_Entero_SfV: hypothetical protein SfVp21; PP_01149; phage(gi19548989) 5e-54 Click
151202045..1202419 PHAGE_Entero_mEp213: tail fiber assembly protein; PP_01150; phage(gi428782612) 5e-24 Click
16complement(1202391..1202993) PHAGE_Entero_HK106: tail fiber assembly protein; PP_01151; phage(gi428783304) 3e-100 Click
17complement(1202993..1203532) PHAGE_Entero_HK106: side tail fiber protein; PP_01152; phage(gi428783303) 7e-49 Click
181203559..1204113 PHAGE_Entero_2: DNA-invertase; PP_01153; phage(gi169936026) 8e-89 Click
191204220..1205053 PHAGE_Lactob_H: hypothetical protein; PP_01154; phage(gi148750872) 4e-05 Click
201205287..1205451 isocitrate dehydrogenase [Shigella sonnei Ss046] gi|74311695|ref|YP_310114.1|; PP_01155 1e-23 Click
21complement(1206178..1206291) hypothetical; PP_01156 0.0 Click
22complement(1206577..1206981) PHAGE_Entero_HK629: putative envelope protein; PP_01157; phage(gi428782079) 2e-29 Click
231210545..1210558 attR    ATTCATCTTATTTT 0.0 Click

Region 3, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1403360..1404295) PHAGE_Parame_FR483: hypothetical protein FR483_N404R; PP_01355; phage(gi155370502) 3e-08 Click
21404201..1404212 attL    TCAGCAATGGCT 0.0 Click
3complement(1404347..1405111) PHAGE_Entero_4795: putative integrase; PP_01357; phage(gi157165986) 4e-68 Click
41405278..1405430 hypothetical; PP_01356 0.0 Click
5complement(1405584..1405799) hypothetical protein SSON53_10525 [Shigella sonnei 53G] gi|383178640|ref|YP_005456645.1|; PP_01358 3e-36 Click
6complement(1406331..1407140) PHAGE_Entero_epsilon15: RecT; PP_01359; phage(gi30387413) 1e-81 Click
7complement(1407133..1409733) PHAGE_Salmon_SPN3UB: RecE; PP_01360; phage(gi423262421) 2e-68 Click
8complement(1409835..1410158) hypothetical protein ECO26_1920 [Escherichia coli O26:H11 str. 11368] gi|260855049|ref|YP_003228940.1|; PP_01361 3e-54 Click
9complement(1410185..1410361) PHAGE_Salmon_SPN3UB: hypothetical protein; PP_01362; phage(gi423262423) 8e-06 Click
10complement(1410355..1410576) PHAGE_Escher_P13374: host killing protein; PP_01363; phage(gi410491620) 9e-06 Click
111412766..1412777 attR    TCAGCAATGGCT 0.0 Click

Region 4, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11413031..1413453 PHAGE_Entero_mEp237: CII protein; PP_01366; phage(gi435439306) 3e-08 Click
21413466..1414323 PHAGE_Salmon_SPN3UB: PrpO; PP_01367; phage(gi423262427) 9e-23 Click
31414330..1415076 PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_01368; phage(gi169257280) 3e-76 Click
41415048..1415659 DNA-binding protein [Escherichia coli str. K-12 substr. W3110] gi|388477444|ref|YP_489632.1|; PP_01369 8e-100 Click
51415686..1415991 PHAGE_Entero_lambda: cell lysis protein; PP_01370; phage(gi9626310) 3e-47 Click
61416129..1417586 potassium transporter subunit [Escherichia coli str. K-12 substr. W3110] gi|388477447|ref|YP_489635.1|; PP_01371 0.0 Click
71417724..1417987 PHAGE_Psychr_pOW20_A: DNA methylase; PP_01372; phage(gi472339820) 6e-21 Click
81417968..1418327 hypothetical protein Y75_p1344 [Escherichia coli str. K-12 substr. W3110] gi|388477449|ref|YP_489637.1|; PP_01373 7e-61 Click
91418504..1418635 putative phage protein [Escherichia coli ETEC H10407] gi|387611303|ref|YP_006114419.1|; PP_01374 3e-17 Click
101418801..1419829 PHAGE_Escher_HK639: tail length tape measure protein; PP_01375; phage(gi356870615) 6e-27 Click
111419829..1419960 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; PP_01376; phage(gi209447197) 1e-16 Click
12complement(1420093..1421073) PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_01377; phage(gi16131377) 0.0 Click
131421161..1421331 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_01378; phage(gi148609401) 2e-27 Click
14complement(1421332..1421505) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; PP_01379; phage(gi157166059) 7e-29 Click
15complement(1421619..1421852) hypothetical; PP_01381 0.0 Click
16complement(1421893..1422630) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01380; phage(gi9626267) 2e-56 Click
171422666..1422800 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_01382 8e-16 Click
181422761..1424758 PHAGE_Entero_lambda: Tail fiber; PP_01383; phage(gi9626268) 7e-89 Click
191424758..1425102 PHAGE_Entero_lambda: Putative fiber assembly protein; PP_01384; phage(gi9626269) 8e-51 Click
201425099..1425275 PHAGE_Entero_lambda: Putative fiber assembly protein; PP_01385; phage(gi9626269) 4e-19 Click
21complement(1425426..1426016) PHAGE_Escher_D108: G region invertase; PP_01386; phage(gi281199698) 7e-25 Click

Region 5, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11610386..1610397 attL    TAACGGCAGCAA 0.0 Click
21620746..1620949 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; PP_01567; phage(gi410491512) 1e-13 Click
3complement(1620984..1622444) PHAGE_Microm_MpV1: hypothetical protein; PP_01568; phage(gi313768442) 1e-40 Click
4complement(1622533..1623816) PHAGE_Burkho_phi1026b: gp59; PP_01569; phage(gi38707949) 1e-33 Click
51624678..1624821 DNA-binding transcriptional regulator [Escherichia coli O103:H2 str. 12009] gi|260842783|ref|YP_003220561.1|; PP_01570 1e-06 Click
61625006..1625596 PHAGE_Escher_D108: G region invertase; PP_01571; phage(gi281199698) 5e-25 Click
7complement(1625694..1625969) PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_01572; phage(gi16129505) 1e-37 Click
8complement(1625977..1626195) PHAGE_Entero_HK630: tail fiber assembly protein; PP_01573; phage(gi428782810) 6e-28 Click
9complement(1626195..1627097) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01574; phage(gi16129506) 2e-176 Click
10complement(1627108..1627677) PHAGE_Entero_HK630: terminase small subunit nu1; PP_01575; phage(gi428782788) 3e-94 Click
11complement(1628919..1629092) Qin prophage hypothetical protein [Escherichia coli W] gi|386608932|ref|YP_006124418.1|; PP_01576 1e-23 Click
12complement(1629765..1629977) PHAGE_Lactoc_bIL312: Csp; PP_01577; phage(gi13095918) 1e-15 Click
13complement(1630340..1630822) PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; PP_01578; phage(gi16765210) 2e-53 Click
14complement(1630834..1631367) PHAGE_Entero_mEp460: endolysin; PP_01579; phage(gi428782372) 2e-97 Click
15complement(1631364..1631675) PHAGE_Entero_mEp460: hypothetical protein; PP_01580; phage(gi428782371) 1e-29 Click
16complement(1631680..1631886) PHAGE_Entero_mEp460: porin; PP_01581; phage(gi428782370) 1e-31 Click
17complement(1632649..1632864) PHAGE_Lactoc_bIL312: Csp; PP_01582; phage(gi13095918) 5e-16 Click
181633165..1633377 cold shock protein; Qin prophage [Escherichia fergusonii ATCC 35469] gi|218551642|ref|YP_002385434.1|; PP_01583 5e-32 Click
19complement(1633799..1634551) PHAGE_Entero_mEp460: late gene regulator; PP_01584; phage(gi428782366) 4e-137 Click
20complement(1634565..1635614) PHAGE_Entero_mEp460: hypothetical protein; PP_01585; phage(gi428782365) 1e-113 Click
21complement(1635961..1636212) Qin prophage; hypothetical protein [Escherichia coli W] gi|386608944|ref|YP_006124430.1|; PP_01586 1e-40 Click
22complement(1636274..1636390) hypothetical protein CE10_1832 [Escherichia coli O7:K1 str. CE10] gi|386624180|ref|YP_006143908.1|; PP_01587 1e-12 Click
23complement(1636943..1637182) bifunctional antitoxin/transcriptional repressor RelB [Shigella flexneri 5 str. 8401] gi|110805508|ref|YP_689028.1|; PP_01588 2e-36 Click
241637715..1638047 Qin prophage hypothetical protein [Escherichia coli W] gi|386608948|ref|YP_006124434.1|; PP_01589 6e-54 Click
25complement(1638656..1638946) hypothetical protein Y75_p1544 [Escherichia coli str. K-12 substr. W3110] gi|388477644|ref|YP_489832.1|; PP_01590 6e-49 Click
26complement(1638930..1639160) PHAGE_Pectob_ZF40: putative cro anti-repressor; PP_01591; phage(gi422936651) 1e-08 Click
271639818..1639973 PHAGE_Salico_CGphi29: hypothetical protein; PP_01592; phage(gi472340166) 2e-09 Click
281639975..1640103 hypothetical protein ECW_m1736 [Escherichia coli W] gi|386608962|ref|YP_006124448.1|; PP_01593 1e-15 Click
291640133..1640351 hypothetical protein ECW_m1737 [Escherichia coli W] gi|386608963|ref|YP_006124449.1|; PP_01594 7e-34 Click
30complement(1640355..1640519) hypothetical protein [Escherichia coli DH1] gi|386595614|ref|YP_006092014.1|; PP_01595 1e-23 Click
31complement(1640720..1640890) hypothetical protein ECNA114_4765 [Escherichia coli NA114] gi|386622308|ref|YP_006141888.1|; PP_01597 2e-27 Click
321640919..1641107 Qin prophage; cell division inhibition protein [Escherichia coli W] gi|386608965|ref|YP_006124451.1|; PP_01596 3e-28 Click
331641104..1641295 Qin prophage; hypothetical protein [Escherichia coli W] gi|386608966|ref|YP_006124452.1|; PP_01598 5e-29 Click
341641388..1642308 hypothetical protein Y75_p1552 [Escherichia coli str. K-12 substr. W3110] gi|388477652|ref|YP_489840.1|; PP_01599 0.0 Click
351642467..1642847 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; PP_01600; phage(gi24111655) 3e-71 Click
361642702..1642713 attR    TAACGGCAGCAA 0.0 Click
371642822..1644018 PHAGE_Entero_2008: putative integrase; PP_01601; phage(gi209427727) 4e-135 Click

Region 6, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12455532..2455547 attL    TTGCAGGTTCGATTCC 0.0 Click
22455687..2456880 PROPHAGE_Escher_MG1655: CPS-53 (KpLE1) prophage; predicted prophage CPS-53 integrase; PP_02396; phage(gi16130281) 0.0 Click
32457392..2458312 PHAGE_Entero_SfV: bactoprenol glucosyltransferase; PP_02397; phage(gi19549012) 6e-163 Click
42458309..2459640 inner membrane protein [Escherichia coli str. K-12 substr. W3110] gi|388478401|ref|YP_490593.1|; PP_02398 0.0 Click
52459981..2460283 PHAGE_Entero_HK106: tail fiber assembly protein; PP_02399; phage(gi428783304) 2e-46 Click
6complement(2460255..2460647) PHAGE_Entero_mEp213: tail fiber assembly protein; PP_02400; phage(gi428782612) 1e-26 Click
7complement(2460722..2461315) PHAGE_Entero_SfV: hypothetical protein SfVp21; PP_02401; phage(gi19548989) 2e-51 Click
8complement(2461290..2461565) PHAGE_Entero_SfV: DNA adenine methylase; PP_02402; phage(gi19549028) 2e-50 Click
9complement(2461565..2462059) PHAGE_Entero_SfV: hypothetical protein SfVp40; PP_02403; phage(gi19549027) 2e-87 Click
10complement(2462056..2462424) PHAGE_Entero_HK140: DNA replication protein O; PP_02404; phage(gi428781991) 2e-14 Click
11complement(2462574..2462747) hypothetical; PP_02405 0.0 Click
122462782..2463144 PHAGE_Entero_SfV: hypothetical protein SfVp32; PP_02406; phage(gi19549019) 6e-63 Click
132463210..2464034 PHAGE_Entero_SfV: hypothetical protein SfVp31; PP_02407; phage(gi19549018) 3e-151 Click
142464162..2464698 PHAGE_Entero_SfV: hypothetical protein SfVp30; PP_02408; phage(gi19549017) 3e-99 Click
152464710..2465051 PHAGE_Entero_SfV: hypothetical protein SfVp29; PP_02409; phage(gi19549016) 7e-63 Click
162465051..2465356 PHAGE_Entero_SfV: hypothetical protein SfVp28; PP_02410; phage(gi19549015) 3e-52 Click
172465453..2465468 attR    TTGCAGGTTCGATTCC 0.0 Click
182465488..2465688 PHAGE_Entero_HK633: hypothetical protein; PP_02411; phage(gi428782548) 3e-34 Click
19complement(2465872..2466807) PHAGE_Burkho_phi1026b: gp58; PP_02412; phage(gi38707948) 1e-15 Click