Bifidobacterium dentium ATCC 27679 , whole genome [asmbl_id: NC_000000].2633776, GC%: 58.45%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1985958..985992 attL    GTCGGGCTGACAGGATTTGAACCTGCGACATTCTG 0.0 Click
2complement(988212..991037) PHAGE_Acanth_moumouvirus: collagen repeat protein; HMPREF0168_0844; phage(gi441432155) 2e-12 Click
3complement(991062..992537) PHAGE_Bacill_BCJA1c: host specificity protein; HMPREF0168_0845; phage(gi56694921) 1e-17 Click
4complement(992547..993356) hypothetical protein; HMPREF0168_0846 0.0 Click
5complement(993356..995950) PHAGE_Strept_3: putative human platelet-binding protein; HMPREF0168_0847; phage(gi28876274) 1e-82 Click
6complement(995965..996327) PHAGE_Mycoba_BPs: potential virion protein; HMPREF0168_0848; phage(gi189043102) 2e-06 Click
7complement(996399..996668) sugar transferase; HMPREF0168_0849 0.0 Click
8complement(996784..997476) PHAGE_Lactoc_r1t: Structural protein; HMPREF0168_0850; phage(gi23455756) 1e-27 Click
9complement(997491..997865) PHAGE_Lactoc_r1t: hypothetical protein r1tp36; HMPREF0168_0851; phage(gi23455755) 3e-05 Click
10complement(997868..998131) conserved hypothetical protein; HMPREF0168_0852 0.0 Click
11complement(998124..998456) PHAGE_Lactoc_r1t: hypothetical protein r1tp34; HMPREF0168_0853; phage(gi23455753) 2e-06 Click
12complement(998457..998885) PHAGE_Strept_SM1: gp42; HMPREF0168_0854; phage(gi32469473) 5e-07 Click
13complement(998897..999781) PHAGE_Mycoba_BPs: capsid protein; HMPREF0168_0855; phage(gi189043094) 3e-33 Click
14complement(999792..1000304) PHAGE_Mycoba_TM4: hypothetical protein TM4_gp8; HMPREF0168_0856; phage(gi18496894) 5e-11 Click
15complement(1000419..1001213) PHAGE_Mycoba_U2: gp12; HMPREF0168_0857; phage(gi157786406) 8e-07 Click
16complement(1001185..1002612) PHAGE_Lactoc_r1t: Structural protein; HMPREF0168_0858; phage(gi23455746) 2e-39 Click
17complement(1002609..1002989) hypothetical protein; HMPREF0168_0859 0.0 Click
18complement(1003019..1004488) PHAGE_Propio_P100D: putative terminase large subunit; HMPREF0168_0860; phage(gi410491863) 1e-83 Click
19complement(1004457..1004807) PHAGE_Strept_VWB: hypothetical protein VWBp32; HMPREF0168_0861; phage(gi41057248) 1e-11 Click
20complement(1004925..1005257) PHAGE_Lactoc_r1t: hypothetical protein r1tp26; HMPREF0168_0862; phage(gi23455745) 3e-08 Click
21complement(1005260..1005433) precorrin-3B synthase; HMPREF0168_0863 0.0 Click
22complement(1005437..1005595) thiamin biosynthesis lipoprotein ApbE; HMPREF0168_0864 0.0 Click
23complement(1005600..1005986) hypothetical protein; HMPREF0168_0865 0.0 Click
24complement(1006164..1006601) PHAGE_Clavib_CMP1: endonuclease; HMPREF0168_0866; phage(gi282598822) 8e-06 Click
25complement(1006595..1007416) conserved hypothetical protein; HMPREF0168_0867 0.0 Click
26complement(1007438..1007896) hypothetical protein; HMPREF0168_0868 0.0 Click
27complement(1007921..1008145) conserved hypothetical protein; HMPREF0168_0869 0.0 Click
28complement(1008322..1008753) conserved hypothetical protein; HMPREF0168_0870 0.0 Click
291008967..1009383 conserved hypothetical protein; HMPREF0168_0871 0.0 Click
30complement(1009380..1010447) PHAGE_Pectob_My1: YadA domain-containing protein; HMPREF0168_0872; phage(gi410491156) 1e-08 Click
31complement(1011070..1012821) hypothetical protein; HMPREF0168_0873 0.0 Click
32complement(1012818..1013330) hypothetical protein; HMPREF0168_0874 0.0 Click
33complement(1013453..1013647) conserved hypothetical protein; HMPREF0168_0875 0.0 Click
34complement(1013644..1013859) phage transcriptional regulator; HMPREF0168_0876 0.0 Click
351013878..1014297 conserved hypothetical protein; HMPREF0168_0877 0.0 Click
361014354..1015361 PHAGE_Lactob_Lj965: putative integrase; HMPREF0168_0878; phage(gi41179218) 7e-11 Click
371015658..1015692 attR    GTCGGGCTGACAGGATTTGAACCTGCGACATTCTG 0.0 Click