Enterococcus faecalis TX0017 .1, whole [asmbl_id: NC_000000].2996543, GC%: 37.37%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
113653..15539 PHAGE_Strept_YMC_2011: lpxtg cell wall surface protein, collagen binding domain protein; HMPREF9500_00013; phage(gi399498696) 6e-05 Click
215661..16218 UPF0090 family protein; HMPREF9500_00014 0.0 Click
3complement(16215..16343) hypothetical protein; HMPREF9500_00015 0.0 Click
416362..17561 transcription termination factor NusA; HMPREF9500_00016 0.0 Click
517567..17881 cytosolic protein YlxR; HMPREF9500_00017 0.0 Click
617871..18176 ribosomal protein L7Ae; HMPREF9500_00018 0.0 Click
718189..20585 PHAGE_Cafete_BV_PW1: putative eIF-2/eIF-5B; HMPREF9500_00019; phage(gi310831102) 2e-23 Click
820610..20960 ribosome-binding factor A; HMPREF9500_00020 0.0 Click
9complement(21333..21818) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9500_00021; phage(gi282598746) 4e-62 Click
10complement(21853..22335) PHAGE_Entero_phiEf11: cI-like repressor; HMPREF9500_00022; phage(gi282598745) 9e-21 Click
1122552..22686 conserved hypothetical protein; HMPREF9500_00023 0.0 Click
1222732..23487 PHAGE_Strept_M102: hypothetical protein M102_gp21; HMPREF9500_00024; phage(gi242345592) 2e-33 Click
1323506..24348 PHAGE_Entero_EF62phi: D replication protein DC; HMPREF9500_00025; phage(gi384519773) 7e-27 Click
1424415..24807 conserved hypothetical protein; HMPREF9500_00026 0.0 Click
1524827..25234 PHAGE_Lactob_Sha1: phage transcriptional activator RinA; HMPREF9500_00027; phage(gi418489798) 2e-18 Click
1625455..25871 PHAGE_Entero_phiEf11: putative major structural protein; HMPREF9500_00028; phage(gi282598740) 2e-07 Click
1725884..26396 PHAGE_Strept_TP_J34: putative major tail protein; HMPREF9500_00029; phage(gi444475914) 1e-38 Click
1826429..26788 PHAGE_Strept_858: orf17; HMPREF9500_00030; phage(gi168229290) 3e-12 Click
1926881..27174 PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_45; HMPREF9500_00031; phage(gi13487846) 4e-08 Click
2027164..30097 PHAGE_Strept_Dp_1: TMP; HMPREF9500_00032; phage(gi327198366) 3e-123 Click
2130099..31025 PHAGE_Entero_phiEf11: putative phage tail protein; HMPREF9500_00033; phage(gi282598752) 6e-147 Click
2231038..32495 PHAGE_Entero_phiEf11: putative phage structural protein; HMPREF9500_00034; phage(gi282598760) 2e-173 Click
2332528..34297 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9500_00035; phage(gi282598748) 0.0 Click
2434321..34716 PHAGE_Entero_EF62phi: holin; HMPREF9500_00036; phage(gi384519787) 5e-38 Click
2534835..35159 PHAGE_Lister_vB_LmoM_AG20: N/A; HMPREF9500_00037; phage(gi472437328) 5e-09 Click
2635160..35935 PHAGE_Entero_1: amidase; HMPREF9500_00038; phage(gi225626379) 8e-23 Click

Region 2, total : 78 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1183928..183943 attL    AAATGGTGATACATTT 0.0 Click
2complement(183966..185192) PHAGE_Lactob_Lj965: putative integrase; HMPREF9500_00174; phage(gi41179218) 3e-32 Click
3complement(185192..185473) conserved hypothetical protein; HMPREF9500_00175 0.0 Click
4complement(185629..186108) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_00176; phage(gi281416277) 3e-28 Click
5complement(186281..187036) PHAGE_Entero_phiEf11: LysM domain protein; HMPREF9500_00177; phage(gi282598770) 8e-17 Click
6complement(187054..187518) PHAGE_Lister_B025: gp36; HMPREF9500_00178; phage(gi157325252) 8e-21 Click
7complement(187535..187864) PHAGE_Lister_B054: gp41; HMPREF9500_00179; phage(gi157325325) 7e-21 Click
8188016..188213 PHAGE_Lister_B054: gp42; HMPREF9500_00180; phage(gi157325326) 4e-08 Click
9188203..188397 PHAGE_Entero_EF62phi: hypothetical protein; HMPREF9500_00181; phage(gi384519764) 9e-05 Click
10188466..189020 conserved hypothetical protein; HMPREF9500_00182 0.0 Click
11189070..189231 VrlI family protein; HMPREF9500_00183 0.0 Click
12189212..189409 conserved hypothetical protein; HMPREF9500_00184 0.0 Click
13189410..189640 PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF9500_00185; phage(gi281416334) 2e-07 Click
14189696..189986 conserved hypothetical protein; HMPREF9500_00186 0.0 Click
15189991..192105 PHAGE_Brocho_NF5: gp34; HMPREF9500_00187; phage(gi327197619) 3e-63 Click
16192106..193278 conserved hypothetical protein; HMPREF9500_00188 0.0 Click
17193278..193979 PHAGE_Lister_B054: gp51; HMPREF9500_00189; phage(gi157325335) 3e-42 Click
18193991..194755 PHAGE_Strept_3: hypothetical protein SpyM3_1139; HMPREF9500_00190; phage(gi28876309) 2e-12 Click
19194771..195223 PHAGE_Geobac_GBSV1: putative recombination protein U; HMPREF9500_00191; phage(gi158267612) 8e-18 Click
20195289..195603 conserved hypothetical protein; HMPREF9500_00192 0.0 Click
21195687..196436 PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_00193; phage(gi281416237) 3e-118 Click
22196461..196622 hypothetical protein; HMPREF9500_00194 0.0 Click
23196653..196880 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9500_00195; phage(gi282598739) 8e-09 Click
24196922..197113 PHAGE_Entero_phiEF24C: hypothetical protein EFP_gp194; HMPREF9500_00196; phage(gi158079490) 5e-08 Click
25197120..197332 conserved hypothetical protein; HMPREF9500_00197 0.0 Click
26197344..197646 conserved hypothetical protein; HMPREF9500_00198 0.0 Click
27197671..198213 PHAGE_Entero_EF62phi: hypothetical protein; HMPREF9500_00199; phage(gi384519769) 1e-37 Click
28198231..198443 hypothetical protein; HMPREF9500_00200 0.0 Click
29198440..198622 PHAGE_Entero_phiEF24C: hypothetical protein EFP_gp108; HMPREF9500_00201; phage(gi158079404) 1e-06 Click
30198634..199200 PHAGE_Lister_B054: gp69; HMPREF9500_00202; phage(gi157325352) 2e-16 Click
31199214..199531 replicase domain protein; HMPREF9500_00203 0.0 Click
32199525..199731 PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9500_00204; phage(gi281416521) 2e-29 Click
33199732..199923 PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9500_00205; phage(gi281416459) 1e-13 Click
34199924..200103 PHAGE_Lactoc_1: ORF24; HMPREF9500_00206; phage(gi13786555) 3e-07 Click
35200235..200423 conserved hypothetical protein; HMPREF9500_00207 0.0 Click
36200524..201108 sigma-70, region 4; HMPREF9500_00208 0.0 Click
37201268..201352 tRNA 0.0 Click
38201815..202117 conserved domain protein; HMPREF9500_00210 0.0 Click
39202162..203430 PHAGE_Strept_1: transferase; HMPREF9500_00211; phage(gi39653711) 2e-60 Click
40203556..203786 PHAGE_Lister_B054: gp79; HMPREF9500_00212; phage(gi157325363) 4e-15 Click
41203801..204526 PHAGE_Staphy_PH15: putative small terminase subunit; HMPREF9500_00213; phage(gi119967834) 1e-08 Click
42204507..205943 PHAGE_Lister_B054: TerL; HMPREF9500_00214; phage(gi157325286) 1e-166 Click
43205966..207360 PHAGE_Lister_B054: gp3; HMPREF9500_00215; phage(gi157325287) 6e-148 Click
44207350..208594 PHAGE_Lister_B054: gp4; HMPREF9500_00216; phage(gi157325288) 5e-58 Click
45208587..208751 conserved hypothetical protein; HMPREF9500_00217 0.0 Click
46208808..209095 PHAGE_Lactob_LP65: hypothetical protein LP65_gp078; HMPREF9500_00218; phage(gi56693126) 8e-25 Click
47209088..209297 LysM domain protein; HMPREF9500_00219 0.0 Click
48209310..210410 PHAGE_Lister_B054: gp6; HMPREF9500_00220; phage(gi157325290) 1e-111 Click
49210413..210883 PHAGE_Lister_B054: gp7; HMPREF9500_00221; phage(gi157325291) 3e-29 Click
50210905..211786 PHAGE_Lister_B054: gp8; HMPREF9500_00222; phage(gi157325292) 3e-84 Click
51211776..212192 PHAGE_Lister_B054: gp9; HMPREF9500_00223; phage(gi157325293) 4e-22 Click
52212204..212545 PHAGE_Lister_B054: gp10; HMPREF9500_00224; phage(gi157325294) 2e-20 Click
53212545..213147 PHAGE_Lister_B054: gp11; HMPREF9500_00225; phage(gi157325295) 2e-38 Click
54213147..213506 conserved hypothetical protein; HMPREF9500_00226 0.0 Click
55213493..213969 PHAGE_Lister_B054: gp13; HMPREF9500_00227; phage(gi157325297) 2e-26 Click
56213966..215003 PHAGE_Lister_B054: gp14; HMPREF9500_00228; phage(gi157325298) 9e-105 Click
57215028..215417 PHAGE_Lister_B054: gp15; HMPREF9500_00229; phage(gi157325299) 2e-33 Click
58215470..215802 PHAGE_Lister_B054: gp16; HMPREF9500_00230; phage(gi157325300) 2e-28 Click
59215843..215983 PHAGE_Lister_B054: gp17; HMPREF9500_00231; phage(gi157325301) 2e-08 Click
60215986..221151 PHAGE_Lister_B054: Tmp; HMPREF9500_00232; phage(gi157325302) 0.0 Click
61221151..221708 PHAGE_Lister_B054: gp19; HMPREF9500_00233; phage(gi157325303) 1e-40 Click
62221718..222080 PHAGE_Lister_B054: gp20; HMPREF9500_00234; phage(gi157325304) 4e-30 Click
63222081..222911 PHAGE_Lister_B054: gp21; HMPREF9500_00235; phage(gi157325305) 4e-66 Click
64222911..223243 PHAGE_Lister_B054: gp22; HMPREF9500_00236; phage(gi157325306) 5e-24 Click
65223243..223590 PHAGE_Lister_B054: gp23; HMPREF9500_00237; phage(gi157325307) 4e-12 Click
66223583..224737 PHAGE_Lister_B054: gp24; HMPREF9500_00238; phage(gi157325308) 8e-118 Click
67224721..225350 PHAGE_Lister_B054: gp25; HMPREF9500_00239; phage(gi157325309) 3e-60 Click
68225363..226751 PHAGE_Lister_B054: gp26; HMPREF9500_00240; phage(gi157325310) 1e-18 Click
69226767..227201 conserved hypothetical protein; HMPREF9500_00241 0.0 Click
70227201..227329 phage uncharacterized protein, XkdX family; HMPREF9500_00242 0.0 Click
71227334..227690 PHAGE_Lactoc_r1t: hypothetical protein r1tp46; HMPREF9500_00243; phage(gi23455765) 3e-24 Click
72227687..227884 conserved hypothetical protein; HMPREF9500_00244 0.0 Click
73227943..229049 PHAGE_Entero_1: amidase; HMPREF9500_00245; phage(gi225626379) 1e-36 Click
74229143..229216 tRNA 0.0 Click
75complement(229428..230195) PHAGE_Lactob_Lj965: hypothetical protein Ljo_0291; HMPREF9500_00247; phage(gi41179221) 3e-24 Click
76complement(230224..230478) hypothetical protein; HMPREF9500_00248 0.0 Click
77complement(230536..230682) hypothetical protein; HMPREF9500_00249 0.0 Click
78complement(230806..231054) conserved hypothetical protein; HMPREF9500_00250 0.0 Click
79231144..231159 attR    AAATGGTGATACATTT 0.0 Click
80complement(231419..231598) conserved hypothetical protein; HMPREF9500_00251 0.0 Click
81complement(231657..232100) PHAGE_Bacill_phiAGATE: putative ribonucleotide reductase class Ib, NrdI; HMPREF9500_00252; phage(gi448260994) 3e-07 Click
82232473..232796 PHAGE_Human__8: LANA; HMPREF9500_00253; phage(gi139472804) 2e-05 Click

Region 3, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(858870..859091) PHAGE_Lactoc_bIL312: Csp; HMPREF9500_00883; phage(gi13095918) 1e-26 Click
2complement(859923..861182) PHAGE_Entero_phiEf11: endolysin; HMPREF9500_00884; phage(gi282598713) 0.0 Click
3complement(861195..861575) PHAGE_Bacill_B103: lysis protein; HMPREF9500_00885; phage(gi22855162) 9e-11 Click
4complement(861586..861708) phage uncharacterized protein, XkdX family; HMPREF9500_00886 0.0 Click
5complement(861710..862105) conserved hypothetical protein; HMPREF9500_00887 0.0 Click
6complement(862124..862576) PHAGE_Entero_1: host specificity protein; HMPREF9500_00888; phage(gi225626383) 5e-19 Click
7complement(862593..862813) hypothetical protein; HMPREF9500_00889 0.0 Click
8862814..862997 PROPHAGE_Escher_CFT073: transposase insF; HMPREF9500_00890; phage(gi26250329) 2e-07 Click
9complement(863267..863662) aspartate 1-decarboxylase; HMPREF9500_00891 0.0 Click
10complement(863675..864523) pantoate--beta-alanine ligase; HMPREF9500_00892 0.0 Click
11complement(864538..865365) PHAGE_Ostreo_OlV5: 3-methyl-2-oxobutanoate hydroxymethyltransferase; HMPREF9500_00893; phage(gi472341345) 8e-53 Click
12complement(865377..866237) conserved domain protein; HMPREF9500_00894 0.0 Click
13866476..866622 conserved domain protein; HMPREF9500_00895 0.0 Click
14866692..867645 PROPHAGE_Shewan_MR-1: ISSod4, transposase; HMPREF9500_00896; phage(gi24373869) 2e-47 Click
15complement(867970..869289) PHAGE_Acanth_moumouvirus: DNA topoisomerase 1; HMPREF9500_00897; phage(gi441432186) 9e-07 Click
16complement(869286..869939) PHAGE_Ectoca_1: EsV-1-65; HMPREF9500_00898; phage(gi13242537) 8e-07 Click
17870225..870614 PROPHAGE_Staphy_N315: transposase; HMPREF9500_00899; phage(gi15927655) 5e-20 Click
18870650..871270 PROPHAGE_Staphy_N315: transposase; HMPREF9500_00900; phage(gi15927655) 5e-27 Click
19complement(871401..872777) efflux ABC transporter, permease protein; HMPREF9500_00901 0.0 Click
20complement(872777..873433) PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF9500_00902; phage(gi371496158) 7e-26 Click

Region 4, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1954137..954164 attL    AAATAAATTATTTAGTTTCACGGTGTAA 0.0 Click
2954797..955210 PHAGE_Strept_PH15: hypothetical protein phiPH15_gp59; HMPREF9500_01000; phage(gi190151474) 2e-07 Click
3complement(955275..956381) PHAGE_Entero_1: amidase; HMPREF9500_01001; phage(gi225626379) 4e-37 Click
4complement(956436..956849) PHAGE_Entero_EF62phi: holin; HMPREF9500_01002; phage(gi384519787) 2e-40 Click
5complement(956870..957658) PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9500_01003; phage(gi281416548) 3e-43 Click
6complement(957670..958725) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9500_01004; phage(gi281416485) 2e-56 Click
7complement(958736..959860) PHAGE_Lactoc_phiLC3: hypothetical protein phiLC3p43; HMPREF9500_01005; phage(gi45597432) 8e-91 Click
8complement(959863..960762) PHAGE_Entero_phiFL4A: tail protein; HMPREF9500_01006; phage(gi281416483) 4e-51 Click
9complement(960762..965510) PHAGE_Strept_1: tail tapemeasure protein; HMPREF9500_01007; phage(gi28876187) 1e-167 Click
10complement(965529..965651) hypothetical protein; HMPREF9500_01008 0.0 Click
11complement(965732..966079) conserved hypothetical protein; HMPREF9500_01009 0.0 Click
12complement(966135..966608) PHAGE_Entero_phiEf11: putative phage major tail protein; HMPREF9500_01010; phage(gi282598736) 2e-21 Click
13complement(966682..967275) PHAGE_Strept_1: putative major tail protein; HMPREF9500_01011; phage(gi28876184) 3e-23 Click
14complement(967308..967727) PHAGE_Strept_1: hypothetical protein SpyM3_0718; HMPREF9500_01012; phage(gi28876183) 4e-12 Click
15complement(967724..968116) PHAGE_Strept_1: hypothetical protein SpyM3_0717; HMPREF9500_01013; phage(gi28876182) 3e-10 Click
16complement(968113..968499) PHAGE_Strept_1: hypothetical protein SpyM3_0716; HMPREF9500_01014; phage(gi28876181) 2e-15 Click
17complement(968474..968755) PHAGE_Lister_B025: gp7; HMPREF9500_01015; phage(gi157325224) 1e-11 Click
18complement(968832..970019) PHAGE_Staphy_P954: major capsid protein a; HMPREF9500_01016; phage(gi257136406) 6e-52 Click
19complement(970016..970735) PHAGE_Staphy_2638A: ORF013; HMPREF9500_01017; phage(gi66395463) 1e-40 Click
20complement(970722..971885) PHAGE_Staphy_phi5967PVL: phage portal protein; HMPREF9500_01018; phage(gi431810270) 1e-69 Click
21complement(971917..972084) hypothetical protein; HMPREF9500_01019 0.0 Click
22972190..972357 PHAGE_Entero_P22: hypothetical protein P22gp16; HMPREF9500_01020; phage(gi9635553) 2e-05 Click
23complement(972391..974073) PHAGE_Strept_1: large terminase subunit; HMPREF9500_01021; phage(gi28876175) 0.0 Click
24complement(974070..974369) PHAGE_Strept_1: hypothetical protein SpyM3_0709; HMPREF9500_01022; phage(gi28876174) 6e-15 Click
25complement(974515..974781) conserved domain protein; HMPREF9500_01023 0.0 Click
26complement(974778..975503) hypothetical protein; HMPREF9500_01024 0.0 Click
27complement(975494..975805) PHAGE_Strept_1: hypothetical protein SpyM3_0708; HMPREF9500_01025; phage(gi28876173) 1e-24 Click
28complement(975798..976112) conserved domain protein; HMPREF9500_01026 0.0 Click
29complement(976249..976320) tRNA 0.0 Click
30complement(976622..977089) PHAGE_Brocho_NF5: gp53; HMPREF9500_01028; phage(gi327197638) 8e-11 Click
31complement(977274..977498) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9500_01029; phage(gi282598761) 3e-29 Click
32complement(977495..977680) PHAGE_Entero_phiEf11: hypothetical protein PHIEF11_0057; HMPREF9500_01030; phage(gi282598723) 3e-25 Click
33complement(977681..978187) PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF9500_01031; phage(gi281416352) 1e-20 Click
34complement(978204..978527) hypothetical protein; HMPREF9500_01032 0.0 Click
35complement(978546..978803) conserved domain protein; HMPREF9500_01033 0.0 Click
36complement(978796..979152) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_01034; phage(gi281416243) 5e-56 Click
37complement(979149..979580) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9500_01035; phage(gi282598710) 8e-48 Click
38complement(979605..980210) PHAGE_Lister_B054: gp58; HMPREF9500_01036; phage(gi157325342) 4e-19 Click
39complement(980230..980763) conserved hypothetical protein; HMPREF9500_01037 0.0 Click
40complement(980849..981118) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9500_01038; phage(gi282598762) 5e-08 Click
41complement(981257..982096) PHAGE_Lactoc_bIL309: DnaC; HMPREF9500_01039; phage(gi13095820) 2e-24 Click
42complement(982108..982887) PHAGE_Lactob_Lrm1: DNA replication protein; HMPREF9500_01040; phage(gi195661236) 1e-49 Click
43complement(982902..983717) PHAGE_Lactob_LF1: hypothetical protein; HMPREF9500_01041; phage(gi418489429) 1e-61 Click
44complement(983680..984699) PHAGE_Strept_1: hypothetical protein EJ-1p21; HMPREF9500_01042; phage(gi39653695) 9e-65 Click
45complement(984726..985031) hypothetical protein; HMPREF9500_01043 0.0 Click
46985082..985336 conserved domain protein; HMPREF9500_01044 0.0 Click
47complement(985311..985529) hypothetical protein; HMPREF9500_01045 0.0 Click
48complement(985633..985857) PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9500_01046; phage(gi281416504) 6e-25 Click
49complement(985854..986153) PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9500_01047; phage(gi281416503) 6e-09 Click
50complement(986220..986399) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9500_01048; phage(gi282598741) 1e-20 Click
51complement(986434..986703) conserved domain protein; HMPREF9500_01049 0.0 Click
52complement(986716..986898) conserved domain protein; HMPREF9500_01050 0.0 Click
53987197..987517 PHAGE_Strept_1: putative repressor; HMPREF9500_01051; phage(gi28876149) 7e-13 Click
54987489..987956 PHAGE_Strept_5: putative cI-like repressor, metallo-prtoeinase motif; HMPREF9500_01052; phage(gi28876433) 7e-07 Click
55988068..988430 hypothetical protein; HMPREF9500_01053 0.0 Click
56988461..989003 hypothetical protein; HMPREF9500_01054 0.0 Click
57989150..990331 PHAGE_Temper_1: integrase-like protein; HMPREF9500_01055; phage(gi16271777) 6e-55 Click
58990427..990454 attR    AAATAAATTATTTAGTTTCACGGTGTAA 0.0 Click

Region 5, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1523110..1524870) PHAGE_Strept_Dp_1: DnaX DNA polymerase III clamp loader complex gamma-tau-delta subunit; HMPREF9500_01572; phage(gi327198331) 5e-53 Click
2complement(1524942..1526192) putative galactose-1-phosphate uridylyltransferase; HMPREF9500_01573 0.0 Click
3complement(1526173..1526481) PHAGE_Prochl_P_SSM2: nucleotide sugar epimerase; HMPREF9500_01574; phage(gi61806141) 2e-06 Click
4complement(1526484..1527765) PHAGE_Lactob_Lj965: putative terminase large subunit; HMPREF9500_01575; phage(gi41179257) 2e-166 Click
5complement(1527743..1528600) PHAGE_Entero_phiFL3A: terminase small subunit; HMPREF9500_01576; phage(gi281416254) 5e-31 Click
6complement(1528647..1528985) PHAGE_Entero_phiFL3A: terminase small subunit; HMPREF9500_01577; phage(gi281416253) 6e-06 Click
7complement(1529018..1529386) PHAGE_Lactob_phig1e: hypothetical protein phig1ep40; HMPREF9500_01578; phage(gi254854753) 6e-06 Click
8complement(1529406..1529657) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_01579; phage(gi281416251) 9e-27 Click
9complement(1529731..1529922) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_01580; phage(gi281416250) 2e-27 Click
10complement(1529960..1531294) PHAGE_Entero_phiFL3A: DNA adenine methyltransferase; HMPREF9500_01581; phage(gi281416249) 0.0 Click
11complement(1531297..1531464) conserved hypothetical protein; HMPREF9500_01582 0.0 Click
12complement(1531896..1531967) tRNA 0.0 Click
13complement(1532198..1532365) conserved domain protein; HMPREF9500_01584 0.0 Click
14complement(1532352..1532768) PHAGE_Entero_phiFL3A: transcriptional regulator; HMPREF9500_01585; phage(gi281416247) 6e-62 Click
15complement(1532761..1532880) hypothetical protein; HMPREF9500_01586 0.0 Click
16complement(1533289..1533888) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_01587; phage(gi281416245) 9e-14 Click
17complement(1533881..1534021) hypothetical protein; HMPREF9500_01588 0.0 Click
18complement(1534038..1534796) conserved hypothetical protein; HMPREF9500_01589 0.0 Click
19complement(1534849..1534989) PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF9500_01590; phage(gi281416346) 9e-16 Click
20complement(1535000..1535185) conserved domain protein; HMPREF9500_01591 0.0 Click
21complement(1535185..1535484) PHAGE_Entero_phiFL3A: resolvase; HMPREF9500_01592; phage(gi281416236) 2e-39 Click
22complement(1535596..1535895) PHAGE_Entero_phiFL3A: ArpR DNA binding protein; HMPREF9500_01593; phage(gi281416235) 2e-46 Click
23complement(1535896..1536198) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_01594; phage(gi281416234) 1e-50 Click
24complement(1536617..1537066) conserved hypothetical protein; HMPREF9500_01595 0.0 Click
25complement(1537090..1537455) YodA protein; HMPREF9500_01596 0.0 Click
26complement(1537458..1537628) hypothetical protein; HMPREF9500_01597 0.0 Click
27complement(1537808..1538896) PHAGE_Parame_AR158: hypothetical protein AR158_c415L; HMPREF9500_01598; phage(gi157953605) 9e-05 Click
28complement(1538921..1539367) hypothetical protein; HMPREF9500_01599 0.0 Click
29complement(1539706..1539870) conserved domain protein; HMPREF9500_01600 0.0 Click
30complement(1539894..1540043) ribosomal protein L33; HMPREF9500_01601 0.0 Click
31complement(1540064..1540441) conserved domain protein; HMPREF9500_01602 0.0 Click
32complement(1540472..1540672) ribosomal protein L32; HMPREF9500_01603 0.0 Click
33complement(1540666..1540926) ribosomal protein S14p/S29e; HMPREF9500_01604 0.0 Click
34complement(1541449..1543215) PHAGE_Bacill_SPBc2: ABC transporter; HMPREF9500_01605; phage(gi9630145) 7e-32 Click

Region 6, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11548544..1548555 attL    TCTATTACTGAA 0.0 Click
2complement(1554714..1555721) PHAGE_Strept_7201: ORF4; HMPREF9500_01617; phage(gi9634630) 5e-18 Click
3complement(1555981..1556337) conserved hypothetical protein; HMPREF9500_01618 0.0 Click
4complement(1556330..1557112) PHAGE_Natria_PhiCh1: putative plasmid partitioning protein Soj; HMPREF9500_01619; phage(gi22091150) 7e-24 Click
5complement(1557366..1557662) replication control protein PrgN; HMPREF9500_01620 0.0 Click
6complement(1558094..1558306) transcriptional regulator, UvrC family; HMPREF9500_01621 0.0 Click
7complement(1558263..1558613) conserved hypothetical protein; HMPREF9500_01622 0.0 Click
8complement(1558610..1559938) PHAGE_Bacill_SPBc2: IMPB/MUCB/SAMB family protein; HMPREF9500_01623; phage(gi9630142) 3e-82 Click
9complement(1560366..1560668) conserved domain protein; HMPREF9500_01624 0.0 Click
10complement(1560680..1560889) conserved hypothetical protein; HMPREF9500_01625 0.0 Click
11complement(1560950..1561174) transcriptional regulator, UvrC family; HMPREF9500_01626 0.0 Click
12complement(1561168..1561482) conserved domain protein; HMPREF9500_01627 0.0 Click
131561612..1562202 PROPHAGE_Escher_CFT073: transposase; HMPREF9500_01628; phage(gi26246249) 5e-15 Click
14complement(1562203..1562587) PHAGE_Burkho_Bcep22: Bcep22gp27; HMPREF9500_01629; phage(gi38640333) 2e-21 Click
15complement(1562591..1563271) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9500_01630; phage(gi282598737) 1e-101 Click
16complement(1563268..1564206) PHAGE_Entero_phiEf11: putative replication protein; HMPREF9500_01631; phage(gi282598768) 1e-138 Click
17complement(1564191..1564868) PHAGE_Entero_phiEf11: putative single-strand DNA binding protein; HMPREF9500_01632; phage(gi282598727) 1e-116 Click
18complement(1564852..1565106) PHAGE_Entero_phiEf11: hypothetical protein PHIEF11_0043; HMPREF9500_01633; phage(gi282598707) 6e-26 Click
19complement(1565286..1565609) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_01634; phage(gi281416230) 5e-48 Click
20complement(1565682..1566425) PHAGE_Strept_MM1: hypothetical protein MM1p18; HMPREF9500_01635; phage(gi15088760) 7e-44 Click
21complement(1566438..1566845) PHAGE_Strept_phiNJ2: hypothetical protein; HMPREF9500_01636; phage(gi414090240) 7e-22 Click
22complement(1566918..1567112) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9500_01637; phage(gi281416225) 6e-20 Click
231567165..1567347 conserved domain protein; HMPREF9500_01638 0.0 Click
24complement(1567381..1568103) PHAGE_Entero_phiFL3A: anti-repressor protein; HMPREF9500_01639; phage(gi281416221) 1e-46 Click
25complement(1568118..1568402) conserved hypothetical protein; HMPREF9500_01640 0.0 Click
26complement(1568415..1568615) PHAGE_Lactoc_bIL312: repressor; HMPREF9500_01641; phage(gi13095896) 2e-09 Click
271568850..1569275 PHAGE_Bacill_BCJA1c: repressor; HMPREF9500_01642; phage(gi56694874) 8e-32 Click
281569272..1569766 PHAGE_Bacill_phi105: hypothetical protein phi105_33; HMPREF9500_01643; phage(gi22855026) 4e-14 Click
291569808..1570275 hypothetical protein; HMPREF9500_01644 0.0 Click
301570003..1570014 attR    TCTATTACTGAA 0.0 Click
311570341..1571495 PROPHAGE_Oceano_HTE831: integrase; HMPREF9500_01645; phage(gi23097608) 1e-75 Click
32complement(1571583..1571870) ribosomal protein L27; HMPREF9500_01646 0.0 Click
33complement(1571883..1572227) PHAGE_Entero_phiFL3A: ribosomal protein; HMPREF9500_01647; phage(gi281416258) 4e-05 Click

Region 7, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11709520..1709531 attL    TTGTTTTTCTAT 0.0 Click
2complement(1709674..1711101) PROPHAGE_Deinoc_R1: transposase, putative; HMPREF9500_01788; phage(gi15807743) 7e-18 Click
3complement(1711079..1711672) PHAGE_Escher_D108: G region invertase; HMPREF9500_01789; phage(gi281199698) 1e-43 Click
41712010..1714091 PHP domain protein; HMPREF9500_01790 0.0 Click
51714072..1714374 conserved hypothetical protein; HMPREF9500_01791 0.0 Click
6complement(1714828..1715225) conserved domain protein; HMPREF9500_01792 0.0 Click
71715272..1715493 conserved hypothetical protein; HMPREF9500_01793 0.0 Click
81715506..1716009 PHAGE_Rhodoc_RER2: antirestriction protein; HMPREF9500_01794; phage(gi372449960) 7e-08 Click
91716074..1716910 conserved domain protein; HMPREF9500_01795 0.0 Click
10complement(1716917..1717657) conserved hypothetical protein; HMPREF9500_01796 0.0 Click
111717709..1718098 conserved hypothetical protein; HMPREF9500_01797 0.0 Click
121718085..1720532 putative ATP/GTP-binding protein; HMPREF9500_01798 0.0 Click
131720537..1722660 PHAGE_Bathyc_BpV1: hypothetical protein; HMPREF9500_01799; phage(gi313768111) 9e-08 Click
141722657..1723661 PHAGE_Bacill_36: baseplate hub protein; HMPREF9500_01800; phage(gi156564128) 3e-11 Click
151723680..1724591 conserved hypothetical protein; HMPREF9500_01801 0.0 Click
161724678..1724946 PHAGE_Staphy_TEM123: head-tail connector proteins; HMPREF9500_01802; phage(gi388570344) 2e-08 Click
171724943..1725218 hypothetical protein; HMPREF9500_01803 0.0 Click
181725215..1725553 PHAGE_Lactob_Lj928: putative major tail protein; HMPREF9500_01804; phage(gi41179323) 4e-11 Click
191725550..1725942 PHAGE_Lactob_Lj928: hypothetical protein Ljo_1429; HMPREF9500_01805; phage(gi41179324) 1e-13 Click
201725935..1726496 PHAGE_Lactob_Lj928: hypothetical protein Ljo_1428; HMPREF9500_01806; phage(gi41179325) 8e-30 Click
21complement(1726497..1727031) PHAGE_Lactob_Lj928: hypothetical protein Ljo_1428; HMPREF9500_01807; phage(gi41179325) 1e-29 Click
22complement(1727050..1727442) PHAGE_Lactob_Lj928: hypothetical protein Ljo_1429; HMPREF9500_01808; phage(gi41179324) 3e-14 Click
23complement(1727439..1727777) PHAGE_Lactob_Lj928: putative major tail protein; HMPREF9500_01809; phage(gi41179323) 1e-11 Click
24complement(1727774..1728049) hypothetical protein; HMPREF9500_01810 0.0 Click
25complement(1728046..1728314) PHAGE_Staphy_TEM123: head-tail connector proteins; HMPREF9500_01811; phage(gi388570344) 4e-09 Click
261728422..1728730 PHAGE_Entero_phiEf11: putative phage major tail protein; HMPREF9500_01812; phage(gi282598736) 1e-12 Click
271736700..1736711 attR    TTGTTTTTCTAT 0.0 Click