Enterococcus faecalis TX0309A .1, whole [asmbl_id: NC_000000].3111309, GC%: 37.17%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1223055..223068 attL    TTTTATAAAAAAAC 0.0 Click
2complement(225859..227880) PHAGE_Cafete_BV_PW1: putative DNA mismatch repair protein MutS; HMPREF9506_00249; phage(gi310831476) 2e-14 Click
3complement(228180..228524) hypothetical protein; HMPREF9506_00250 0.0 Click
4complement(228538..228720) conserved hypothetical protein; HMPREF9506_00251 0.0 Click
5complement(228749..229636) PHAGE_Pseudo_UFV_P2: major head protein; HMPREF9506_00252; phage(gi410491826) 2e-09 Click
6complement(229650..230295) PHAGE_Deep_s_D6E: scaffold protein; HMPREF9506_00253; phage(gi423262331) 1e-05 Click
7complement(230350..231036) PROPHAGE_Brucel_1330: transposase, putative; HMPREF9506_00254; phage(gi23502708) 6e-37 Click
8complement(231148..231396) PHAGE_Lactob_LF1: hypothetical protein; HMPREF9506_00255; phage(gi418489439) 6e-10 Click
9complement(231487..232410) ROK family protein; HMPREF9506_00256 0.0 Click
10complement(232441..232560) hypothetical protein; HMPREF9506_00257 0.0 Click
11complement(232591..232803) conserved hypothetical protein; HMPREF9506_00258 0.0 Click
12complement(232796..233860) conserved hypothetical protein; HMPREF9506_00259 0.0 Click
13complement(233999..234409) PHAGE_Synech_S_CAM1: bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase; HMPREF9506_00260; phage(gi472339599) 6e-15 Click
14241360..241373 attR    TTTTATAAAAAAAC 0.0 Click

Region 2, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(380162..381232) PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF9506_00406; phage(gi371496158) 3e-33 Click
2382482..382554 tRNA 0.0 Click
3382712..382960 conserved hypothetical protein; HMPREF9506_00408 0.0 Click
4complement(382979..383977) PHAGE_Clostr_phiC2: putative abortive infection bacteriophage resistance protein ORF 37; HMPREF9506_00409; phage(gi134287370) 5e-17 Click
5complement(384078..384151) tRNA 0.0 Click
6complement(384758..385759) PHAGE_Entero_1: amidase; HMPREF9506_00411; phage(gi225626379) 6e-35 Click
7complement(385731..386009) holin; HMPREF9506_00412 0.0 Click
8complement(386009..386263) PHAGE_Lister_A006: gp18; HMPREF9506_00413; phage(gi157325432) 7e-05 Click
9complement(386276..386695) PHAGE_Entero_EF62phi: phage XkdX domain protein; HMPREF9506_00414; phage(gi384519786) 6e-59 Click
10complement(386683..387543) PHAGE_Entero_EF62phi: bacteriophage tail fiber protein; HMPREF9506_00415; phage(gi384519785) 4e-74 Click
11complement(387530..388018) PHAGE_Lactoc_P087: hypothetical protein P087_gp77; HMPREF9506_00416; phage(gi229605046) 4e-37 Click
12complement(388031..388723) conserved hypothetical protein; HMPREF9506_00417 0.0 Click
13complement(388720..391296) PHAGE_Lactoc_P087: hypothetical protein P087_gp75; HMPREF9506_00418; phage(gi229605044) 8e-43 Click
14complement(391333..392244) conserved hypothetical protein; HMPREF9506_00419 0.0 Click
15complement(392250..393365) PHAGE_Lactoc_P087: hypothetical protein P087_gp74; HMPREF9506_00420; phage(gi229605043) 5e-32 Click
16complement(393370..398532) PHAGE_Entero_1: type measure protein; HMPREF9506_00421; phage(gi225626385) 3e-45 Click

Region 3, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1401036..401047 attL    ACTTGTAGAAAT 0.0 Click
2complement(402584..403762) PHAGE_Lactoc_P087: structural protein; HMPREF9506_00429; phage(gi229605032) 9e-06 Click
3complement(403766..404797) PHAGE_Staphy_GH15: hypothetical protein; HMPREF9506_00430; phage(gi418488003) 1e-06 Click
4complement(404799..405107) conserved domain protein; HMPREF9506_00431 0.0 Click
5complement(405104..405283) conserved hypothetical protein; HMPREF9506_00432 0.0 Click
6complement(405301..405630) conserved hypothetical protein; HMPREF9506_00433 0.0 Click
7complement(405650..406231) conserved domain protein; HMPREF9506_00434 0.0 Click
8complement(406215..406745) conserved hypothetical protein; HMPREF9506_00435 0.0 Click
9complement(406742..408022) PHAGE_Lactoc_P087: structural protein; HMPREF9506_00436; phage(gi229605026) 6e-16 Click
10complement(408040..409263) PHAGE_Lactoc_P087: hypothetical protein P087_gp56; HMPREF9506_00437; phage(gi229605025) 1e-25 Click
11complement(409311..409598) PHAGE_Lactoc_P087: hypothetical protein P087_gp56; HMPREF9506_00438; phage(gi229605025) 4e-05 Click
12complement(409564..409983) PHAGE_Strept_1: hypothetical protein EJ-1p38; HMPREF9506_00439; phage(gi39653712) 3e-18 Click
13complement(409973..411175) PHAGE_Strept_1: transferase; HMPREF9506_00440; phage(gi39653711) 7e-112 Click
14complement(411200..411271) tRNA 0.0 Click
15complement(411583..412008) PHAGE_Entero_phiFL1A: transcriptional regulator ArpU family; HMPREF9506_00442; phage(gi281416357) 6e-27 Click
16complement(412154..412279) conserved hypothetical protein; HMPREF9506_00443 0.0 Click
17complement(412307..412507) PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF9506_00444; phage(gi281416353) 4e-26 Click
18complement(412521..413075) PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF9506_00445; phage(gi281416352) 9e-29 Click
19complement(413075..413440) PHAGE_Entero_EF62phi: hypothetical protein; HMPREF9506_00446; phage(gi384519770) 1e-37 Click
20complement(413560..414102) PHAGE_Entero_EF62phi: hypothetical protein; HMPREF9506_00447; phage(gi384519769) 1e-36 Click
21complement(414127..414351) conserved hypothetical protein; HMPREF9506_00448 0.0 Click
22complement(414338..414457) conserved hypothetical protein; HMPREF9506_00449 0.0 Click
23complement(414441..414653) conserved hypothetical protein; HMPREF9506_00450 0.0 Click
24complement(414731..415216) PHAGE_Entero_phiFL1A: DNA cytosine methyltransferase; HMPREF9506_00451; phage(gi281416347) 2e-83 Click
25complement(415269..415439) PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF9506_00452; phage(gi281416346) 4e-11 Click
26complement(415520..415879) PHAGE_Vibrio_VvAW1: hypothetical protein; HMPREF9506_00453; phage(gi460042924) 1e-05 Click
27complement(415882..416214) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9506_00454; phage(gi282598762) 5e-20 Click
28complement(416211..416636) PHAGE_Entero_phiFL1A: resolvase; HMPREF9506_00455; phage(gi281416343) 1e-61 Click
29complement(416645..417514) PHAGE_Entero_EF62phi: D replication protein DC; HMPREF9506_00456; phage(gi384519773) 8e-19 Click
30complement(417528..418403) PHAGE_Entero_phiFL1A: recombinase; HMPREF9506_00457; phage(gi281416341) 6e-59 Click
31complement(418393..419211) PHAGE_Strept_3: hypothetical protein SpyM3_1132; HMPREF9506_00458; phage(gi28876302) 5e-65 Click
32complement(419171..420094) PHAGE_Strept_1: hypothetical protein EJ-1p21; HMPREF9506_00459; phage(gi39653695) 2e-68 Click
33complement(420084..420452) conserved hypothetical protein; HMPREF9506_00460 0.0 Click
34complement(420439..420729) conserved hypothetical protein; HMPREF9506_00461 0.0 Click
35complement(420814..421140) conserved hypothetical protein; HMPREF9506_00462 0.0 Click
36complement(421141..421350) PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF9506_00463; phage(gi281416334) 4e-06 Click
37complement(421493..421726) helix-turn-helix protein; HMPREF9506_00464 0.0 Click
38complement(421759..422286) conserved hypothetical protein; HMPREF9506_00465 0.0 Click
39complement(422344..422541) conserved hypothetical protein; HMPREF9506_00466 0.0 Click
40complement(422531..422752) PHAGE_Lister_B054: gp42; HMPREF9506_00467; phage(gi157325326) 6e-09 Click
41422902..423261 PHAGE_Lister_B054: gp41; HMPREF9506_00468; phage(gi157325325) 2e-22 Click
42423271..423738 PHAGE_Lister_B025: gp36; HMPREF9506_00469; phage(gi157325252) 8e-24 Click
43423756..424619 conserved hypothetical protein; HMPREF9506_00470 0.0 Click
44424595..424606 attR    ACTTGTAGAAAT 0.0 Click
45424709..425947 PHAGE_Lister_2389: integrase; HMPREF9506_00471; phage(gi17488529) 9e-36 Click
46426230..427720 PHAGE_Salmon_SPN9CC: O-antigen conversion translocase; HMPREF9506_00472; phage(gi389060489) 1e-11 Click

Region 4, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1899762..899773 attL    AATAAAATTTTT 0.0 Click
2complement(913915..914981) PHAGE_Staphy_SpaA1: phage portal protein, SPP1; HMPREF9506_00990; phage(gi399498867) 9e-20 Click
3complement(915047..915908) PHAGE_Lactoc_1: TerL; HMPREF9506_00991; phage(gi13786562) 6e-122 Click
4complement(915898..916359) PHAGE_Entero_phiFL4A: terminase small subunit; HMPREF9506_00992; phage(gi281416464) 6e-50 Click
5complement(916392..916718) hypothetical protein; HMPREF9506_00993 0.0 Click
6complement(916705..917118) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_00994; phage(gi281416463) 6e-59 Click
7complement(917124..918491) PHAGE_Entero_phiFL4A: DNA helicase; HMPREF9506_00995; phage(gi281416462) 0.0 Click
8complement(918492..918875) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_00996; phage(gi281416461) 2e-56 Click
9complement(919145..921577) PHAGE_Entero_phiFL4A: VirE domain protein; HMPREF9506_00997; phage(gi281416460) 0.0 Click
10complement(921779..922081) PHAGE_Lactoc_P087: hypothetical protein P087_gp18; HMPREF9506_00998; phage(gi229604987) 9e-13 Click
11complement(922100..922339) PHAGE_Entero_phiEF24C: hypothetical protein EFP_gp165; HMPREF9506_00999; phage(gi158079461) 1e-13 Click
12complement(922352..924313) PHAGE_Entero_phiFL4A: DNA polymerase; HMPREF9506_01000; phage(gi281416455) 0.0 Click
13complement(924310..924858) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01001; phage(gi281416454) 6e-94 Click
14complement(924845..925084) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01002; phage(gi281416453) 6e-17 Click
15complement(925119..925694) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01003; phage(gi281416452) 6e-106 Click
16complement(925721..926062) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01004; phage(gi281416451) 8e-57 Click
17complement(926066..926314) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01005; phage(gi281416450) 4e-38 Click
18complement(926314..927489) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01006; phage(gi281416449) 0.0 Click
19complement(927492..927971) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01007; phage(gi281416448) 1e-70 Click
20complement(927987..928139) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01008; phage(gi281416447) 4e-23 Click
21complement(928153..928401) conserved hypothetical protein; HMPREF9506_01009 0.0 Click
22complement(928391..929086) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01010; phage(gi281416446) 9e-89 Click
23complement(929101..929382) hypothetical protein; HMPREF9506_01011 0.0 Click
24complement(929477..929671) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01012; phage(gi281416445) 4e-30 Click
25complement(929672..929854) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01013; phage(gi281416444) 2e-25 Click
26complement(929851..930051) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_01014; phage(gi281416443) 5e-33 Click
27931634..932209 PHAGE_Clostr_phiC2: putative integrase; HMPREF9506_01016; phage(gi134287379) 1e-24 Click
28complement(932193..932402) PHAGE_Entero_phiEf11: antirepressor; HMPREF9506_01017; phage(gi282598719) 1e-19 Click
29945146..945157 attR    AATAAAATTTTT 0.0 Click

Region 5, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11136630..1136643 attL    AAAATCAATTATTT 0.0 Click
2complement(1151540..1151761) PHAGE_Lactoc_bIL312: Csp; HMPREF9506_01246; phage(gi13095918) 1e-26 Click
3complement(1152577..1153818) PHAGE_Entero_phiFL3A: endolysin; HMPREF9506_01247; phage(gi281416276) 1e-171 Click
4complement(1153819..1154052) PHAGE_Entero_phiFL3A: holin; HMPREF9506_01248; phage(gi281416275) 4e-32 Click
5complement(1154045..1154266) PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9506_01249; phage(gi281416274) 2e-34 Click
6complement(1154301..1154456) PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp56; HMPREF9506_01250; phage(gi215401226) 1e-05 Click
7complement(1154458..1154802) conserved hypothetical protein; HMPREF9506_01251 0.0 Click
8complement(1154792..1155283) PHAGE_Entero_1: host specificity protein; HMPREF9506_01252; phage(gi225626383) 4e-07 Click
9complement(1155283..1155570) PHAGE_Weisse_phiYS61: putative tail fiber protein; HMPREF9506_01253; phage(gi399528395) 4e-09 Click
10complement(1155567..1156163) PHAGE_Ralsto_RSL1: unnamed protein product; HMPREF9506_01254; phage(gi189426961) 1e-10 Click
11complement(1156156..1156661) conserved domain protein; HMPREF9506_01255 0.0 Click
12complement(1156662..1157512) PHAGE_Prochl_P_SSM2: nucleotide sugar epimerase; HMPREF9506_01256; phage(gi61806141) 1e-30 Click
13complement(1157525..1158151) conserved hypothetical protein; HMPREF9506_01258 0.0 Click
141158125..1158271 hypothetical protein; HMPREF9506_01257 0.0 Click
151158334..1159293 PHAGE_Spirop_R8A2B: putative transposase; HMPREF9506_01259; phage(gi9626114) 3e-24 Click
161161521..1161534 attR    AAAATCAATTATTT 0.0 Click

Region 6, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11946750..1946761 attL    AGCAGGAATTGA 0.0 Click
21950221..1951287 PHAGE_Staphy_SpaA1: phage portal protein, SPP1; HMPREF9506_02047; phage(gi399498867) 2e-20 Click
31951288..1952034 Cna protein B-type domain protein; HMPREF9506_02048 0.0 Click
41952035..1952215 conserved domain protein; HMPREF9506_02049 0.0 Click
51952208..1952606 PHAGE_Clostr_phiC2: hypothetical protein phiC2p11; HMPREF9506_02050; phage(gi134287346) 7e-06 Click
61952609..1952769 conserved domain protein; HMPREF9506_02051 0.0 Click
7complement(1952770..1952930) conserved domain protein; HMPREF9506_02052 0.0 Click
8complement(1952933..1953331) PHAGE_Clostr_phiC2: hypothetical protein phiC2p11; HMPREF9506_02053; phage(gi134287346) 7e-06 Click
9complement(1953324..1953692) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp11; HMPREF9506_02054; phage(gi90592647) 2e-09 Click
101953712..1954289 PHAGE_Lactob_phiAT3: putative transposase B; HMPREF9506_02055; phage(gi48697274) 2e-52 Click
11complement(1954490..1954648) conserved hypothetical protein; HMPREF9506_02056 0.0 Click
12complement(1954762..1955334) PHAGE_Clostr_phiCD38_2: recombinase/resolvase; HMPREF9506_02057; phage(gi333798162) 1e-39 Click
13complement(1955350..1955955) PHAGE_Orycte_virus: FIC protein-like protein; HMPREF9506_02058; phage(gi213159337) 3e-06 Click
14complement(1956281..1956934) PHAGE_Lactob_phiadh: hypothetical protein phiadhp03; HMPREF9506_02059; phage(gi9633003) 2e-24 Click
15complement(1957040..1957690) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_02060; phage(gi281416437) 3e-10 Click
16complement(1957695..1958036) PHAGE_Lactoc_bIL312: repressor; HMPREF9506_02061; phage(gi13095896) 5e-19 Click
171958332..1958523 PHAGE_Strept_MM1: hypothetical protein MM1p05; HMPREF9506_02062; phage(gi15088748) 4e-06 Click
181968936..1968947 attR    AGCAGGAATTGA 0.0 Click

Region 7, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12059127..2059900 PHAGE_Entero_1: type measure protein; HMPREF9506_02158; phage(gi225626385) 8e-81 Click
22059901..2060355 PHAGE_Entero_phiFL4A: tail tape measure protein; HMPREF9506_02159; phage(gi281416482) 7e-12 Click
32060356..2062508 PHAGE_Entero_phiFL4A: tail tape measure protein; HMPREF9506_02160; phage(gi281416482) 1e-42 Click
42062498..2063232 PHAGE_Lactob_1: tail protein; HMPREF9506_02161; phage(gi219563208) 3e-16 Click
52063214..2066021 PHAGE_Lactoc_bIL285: endopeptidase; HMPREF9506_02162; phage(gi13095734) 3e-155 Click
62066040..2066915 PHAGE_Lactoc_bIL285: Orf55; HMPREF9506_02163; phage(gi13095735) 3e-18 Click
72066908..2067225 conserved domain protein; HMPREF9506_02164 0.0 Click
82067218..2067535 conserved domain protein; HMPREF9506_02165 0.0 Click
92067535..2068086 conserved hypothetical protein; HMPREF9506_02166 0.0 Click
102068089..2068475 conserved hypothetical protein; HMPREF9506_02167 0.0 Click
112068475..2068612 phage uncharacterized protein, XkdX family; HMPREF9506_02168 0.0 Click
122068647..2068880 PHAGE_Entero_phiFL4A: holin; HMPREF9506_02169; phage(gi281416487) 2e-26 Click
132068883..2069089 PHAGE_Entero_phiFL4A: holin; HMPREF9506_02170; phage(gi281416488) 2e-23 Click
142069092..2070393 PHAGE_Entero_phiFL4A: endolysin; HMPREF9506_02171; phage(gi281416489) 0.0 Click
15complement(2070715..2070987) conserved domain protein; HMPREF9506_02172 0.0 Click
16complement(2070984..2071319) transcriptional regulator, ArsR family; HMPREF9506_02173 0.0 Click
172071499..2072521 PHAGE_Acanth_mimivirus: probable zinc-type alcohol dehydrogenase-like protein; HMPREF9506_02174; phage(gi311977890) 1e-10 Click
182072643..2073446 conserved domain protein; HMPREF9506_02175 0.0 Click
192073439..2074254 conserved hypothetical protein; HMPREF9506_02176 0.0 Click
202074382..2076553 PHAGE_Bathyc_BpV1: hypothetical protein; HMPREF9506_02177; phage(gi313768111) 7e-08 Click

Region 8, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12143277..2143288 attL    AACATTGACTTT 0.0 Click
2complement(2144350..2144724) PROPHAGE_Oceano_HTE831: integrase; HMPREF9506_02239; phage(gi23097608) 2e-07 Click
32144830..2144842 attL    TCCATTCTGTAAA 0.0 Click
4complement(2145016..2145585) PROPHAGE_Oceano_HTE831: integrase; HMPREF9506_02240; phage(gi23097608) 1e-05 Click
5complement(2145674..2145946) conserved hypothetical protein; HMPREF9506_02241 0.0 Click
6complement(2145943..2146776) PHAGE_Spirop_SVTS2: putative rep protein; HMPREF9506_02242; phage(gi45597172) 3e-12 Click
7complement(2146980..2147483) conserved hypothetical protein; HMPREF9506_02243 0.0 Click
8complement(2147480..2147809) conserved hypothetical protein; HMPREF9506_02244 0.0 Click
9complement(2147930..2148308) conserved repeat domain protein; HMPREF9506_02245 0.0 Click
10complement(2148305..2148572) conserved repeat domain protein; HMPREF9506_02246 0.0 Click
112148573..2148904 conserved hypothetical protein; HMPREF9506_02247 0.0 Click
122149251..2149582 conserved hypothetical protein; HMPREF9506_02248 0.0 Click
132149802..2150491 PHAGE_Entero_phiFL2A: phage head protein; HMPREF9506_02249; phage(gi281416528) 1e-14 Click
142150492..2151076 PHAGE_Entero_1: type measure protein; HMPREF9506_02250; phage(gi225626385) 1e-64 Click
152151077..2151259 PROPHAGE_Escher_CFT073: transposase insF; HMPREF9506_02251; phage(gi26250329) 2e-07 Click
16complement(2151529..2151924) aspartate 1-decarboxylase; HMPREF9506_02252 0.0 Click
17complement(2151937..2152785) pantoate--beta-alanine ligase; HMPREF9506_02253 0.0 Click
18complement(2152800..2153627) PHAGE_Ostreo_OlV5: 3-methyl-2-oxobutanoate hydroxymethyltransferase; HMPREF9506_02254; phage(gi472341345) 8e-53 Click
19complement(2153639..2154499) conserved domain protein; HMPREF9506_02255 0.0 Click
202154682..2154694 attR    TCCATTCTGTAAA 0.0 Click
212154736..2154882 conserved domain protein; HMPREF9506_02256 0.0 Click
222154952..2155905 PROPHAGE_Shewan_MR-1: ISSod4, transposase; HMPREF9506_02257; phage(gi24373869) 2e-47 Click
23complement(2156230..2157549) PHAGE_Acanth_moumouvirus: DNA topoisomerase 1; HMPREF9506_02258; phage(gi441432186) 9e-07 Click
24complement(2157546..2158199) PHAGE_Ectoca_1: EsV-1-65; HMPREF9506_02259; phage(gi13242537) 8e-07 Click
252158594..2158983 PROPHAGE_Staphy_N315: transposase; HMPREF9506_02260; phage(gi15927655) 4e-20 Click
262159019..2159639 PROPHAGE_Staphy_N315: transposase; HMPREF9506_02261; phage(gi15927655) 5e-27 Click
27complement(2159770..2161146) efflux ABC transporter, permease protein; HMPREF9506_02262 0.0 Click
28complement(2161146..2161802) PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF9506_02263; phage(gi371496158) 6e-26 Click
292175495..2175506 attR    AACATTGACTTT 0.0 Click

Region 9, total : 63 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2539923..2541293) PHAGE_Bacill_SPBc2: ABC transporter; HMPREF9506_02648; phage(gi9630145) 8e-22 Click
22541369..2541617 conserved hypothetical protein; HMPREF9506_02649 0.0 Click
3complement(2541654..2542139) conserved hypothetical protein; HMPREF9506_02650 0.0 Click
42542440..2542586 conserved domain protein; HMPREF9506_02651 0.0 Click
52542596..2542826 toxin-antitoxin system, antitoxin component, Xre domain protein; HMPREF9506_02652 0.0 Click
62542847..2542860 attL    AAAGGAGAAAGTAA 0.0 Click
72542862..2543077 conserved domain protein; HMPREF9506_02653 0.0 Click
8complement(2543545..2544363) PHAGE_Parame_1: hypothetical protein; HMPREF9506_02654; phage(gi9631618) 9e-11 Click
9complement(2544391..2544464) tRNA 0.0 Click
10complement(2544537..2545796) PHAGE_Entero_phiFL3A: endolysin; HMPREF9506_02656; phage(gi281416276) 0.0 Click
11complement(2545801..2546004) PHAGE_Entero_phiEf11: phage holin; HMPREF9506_02657; phage(gi282598749) 1e-30 Click
12complement(2546001..2546249) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9506_02658; phage(gi282598731) 6e-33 Click
13complement(2546291..2547112) PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9506_02659; phage(gi281416548) 7e-49 Click
14complement(2547123..2548178) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_02660; phage(gi281416485) 2e-56 Click
15complement(2548189..2549313) PHAGE_Lactoc_phiLC3: hypothetical protein phiLC3p43; HMPREF9506_02661; phage(gi45597432) 6e-91 Click
16complement(2549316..2550215) PHAGE_Entero_phiFL4A: tail protein; HMPREF9506_02662; phage(gi281416483) 3e-51 Click
17complement(2550215..2554963) PHAGE_Strept_1: tail tapemeasure protein; HMPREF9506_02663; phage(gi28876187) 5e-169 Click
18complement(2554982..2555104) hypothetical protein; HMPREF9506_02664 0.0 Click
19complement(2555185..2555532) conserved hypothetical protein; HMPREF9506_02665 0.0 Click
20complement(2555589..2556062) PHAGE_Entero_phiEf11: putative phage major tail protein; HMPREF9506_02666; phage(gi282598736) 2e-21 Click
21complement(2556136..2556729) PHAGE_Lister_B025: Tsh; HMPREF9506_02667; phage(gi157325228) 2e-21 Click
22complement(2556762..2557157) PHAGE_Lister_B025: gp10; HMPREF9506_02668; phage(gi157325227) 3e-20 Click
23complement(2557154..2557558) PHAGE_Lister_B025: gp9; HMPREF9506_02669; phage(gi157325225) 1e-18 Click
24complement(2557555..2557929) PHAGE_Lister_B025: gp8; HMPREF9506_02670; phage(gi157325226) 3e-29 Click
25complement(2557916..2558221) PHAGE_Lister_B025: gp7; HMPREF9506_02671; phage(gi157325224) 3e-11 Click
26complement(2558299..2559444) PHAGE_Lister_B025: Cps; HMPREF9506_02672; phage(gi157325222) 7e-119 Click
27complement(2559471..2560235) PHAGE_Lister_B025: gp4; HMPREF9506_02673; phage(gi157325221) 5e-53 Click
28complement(2560213..2561388) PHAGE_Staphy_phi5967PVL: phage portal protein; HMPREF9506_02674; phage(gi431810270) 2e-90 Click
29complement(2561424..2561591) hypothetical protein; HMPREF9506_02675 0.0 Click
30complement(2561604..2563244) PHAGE_Lister_B025: putative terminase large subunit; HMPREF9506_02676; phage(gi157325219) 3e-155 Click
31complement(2563241..2563594) PHAGE_Staphy_phi5967PVL: hypothetical protein; HMPREF9506_02677; phage(gi431810268) 3e-34 Click
32complement(2563731..2563928) hypothetical protein; HMPREF9506_02678 0.0 Click
33complement(2563919..2564230) PHAGE_Lister_B025: gp65; HMPREF9506_02679; phage(gi157325282) 2e-24 Click
34complement(2564223..2564537) conserved domain protein; HMPREF9506_02680 0.0 Click
35complement(2564530..2564718) conserved domain protein; HMPREF9506_02681 0.0 Click
36complement(2564876..2564949) tRNA 0.0 Click
37complement(2565210..2565740) PHAGE_Brocho_NF5: gp53; HMPREF9506_02683; phage(gi327197638) 2e-13 Click
38complement(2565832..2566026) PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF9506_02684; phage(gi281416354) 3e-24 Click
39complement(2566027..2566434) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF9506_02685; phage(gi281416446) 6e-23 Click
40complement(2566427..2566687) PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9506_02686; phage(gi281416518) 5e-43 Click
41complement(2566684..2567166) PHAGE_Entero_phiEF24C: hypothetical protein EFP_gp196; HMPREF9506_02687; phage(gi158079492) 3e-32 Click
42complement(2567204..2567485) conserved domain protein; HMPREF9506_02688 0.0 Click
43complement(2567643..2567984) PHAGE_Entero_phiFL2A: recombinase; HMPREF9506_02689; phage(gi281416510) 3e-42 Click
44complement(2568005..2568460) conserved domain protein; HMPREF9506_02690 0.0 Click
45complement(2568457..2568711) hypothetical protein; HMPREF9506_02691 0.0 Click
46complement(2568714..2569226) PHAGE_Staphy_SpaA1: recombination protein U; HMPREF9506_02692; phage(gi399498915) 8e-07 Click
47complement(2569216..2569539) hypothetical protein; HMPREF9506_02693 0.0 Click
48complement(2569529..2570344) PHAGE_Clostr_phiSM101: hypothetical protein; HMPREF9506_02694; phage(gi110804073) 1e-31 Click
49complement(2570571..2571323) PHAGE_Strept_MM1: hypothetical protein MM1p18; HMPREF9506_02695; phage(gi15088760) 6e-48 Click
50complement(2571343..2571801) PHAGE_Strept_phiNJ2: hypothetical protein; HMPREF9506_02696; phage(gi414090240) 2e-28 Click
51complement(2571858..2572133) conserved domain protein; HMPREF9506_02697 0.0 Click
52complement(2572127..2572354) PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9506_02698; phage(gi281416504) 2e-15 Click
53complement(2572351..2572665) PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9506_02699; phage(gi281416503) 7e-11 Click
54complement(2572670..2572831) hypothetical protein; HMPREF9506_02700 0.0 Click
55complement(2572815..2572985) hypothetical protein; HMPREF9506_02701 0.0 Click
56complement(2572975..2573109) conserved hypothetical protein; HMPREF9506_02702 0.0 Click
57complement(2573128..2573349) conserved domain protein; HMPREF9506_02703 0.0 Click
58complement(2573364..2573534) conserved domain protein; HMPREF9506_02704 0.0 Click
592573608..2574198 hypothetical protein; HMPREF9506_02705 0.0 Click
60complement(2574176..2574319) conserved domain protein; HMPREF9506_02706 0.0 Click
61complement(2574354..2574512) PHAGE_Brocho_BL3: gp35; HMPREF9506_02707; phage(gi327409427) 1e-06 Click
62complement(2574532..2574759) PHAGE_Staphy_2638A: ORF052; HMPREF9506_02708; phage(gi66395489) 2e-13 Click
632574874..2575365 PHAGE_Staphy_vB_SepiS_phiIPLA7: repressor; HMPREF9506_02709; phage(gi399529150) 5e-25 Click
642575383..2575847 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9506_02710; phage(gi282598746) 8e-27 Click
652575929..2576510 hypothetical protein; HMPREF9506_02711 0.0 Click
662576574..2576587 attR    AAAGGAGAAAGTAA 0.0 Click
672576589..2577983 PHAGE_Lister_A118: putative integrase; HMPREF9506_02712; phage(gi16798814) 1e-64 Click

Region 10, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12907531..2909927 PHAGE_Cafete_BV_PW1: putative eIF-2/eIF-5B; HMPREF9506_03038; phage(gi310831102) 2e-23 Click
22909952..2910302 ribosome-binding factor A; HMPREF9506_03039 0.0 Click
32910385..2910615 hypothetical protein; HMPREF9506_03040 0.0 Click
4complement(2910675..2911160) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9506_03041; phage(gi282598746) 4e-62 Click
5complement(2911195..2911677) PHAGE_Entero_phiEf11: cI-like repressor; HMPREF9506_03042; phage(gi282598745) 9e-21 Click
62911856..2912029 conserved hypothetical protein; HMPREF9506_03043 0.0 Click
72912075..2912830 PHAGE_Strept_M102: hypothetical protein M102_gp21; HMPREF9506_03044; phage(gi242345592) 2e-33 Click
82912849..2913103 hypothetical protein; HMPREF9506_03045 0.0 Click
92913064..2913690 PHAGE_Entero_EF62phi: D replication protein DC; HMPREF9506_03046; phage(gi384519773) 1e-23 Click
102913757..2914149 conserved hypothetical protein; HMPREF9506_03047 0.0 Click
112914169..2914576 PHAGE_Lactob_Sha1: phage transcriptional activator RinA; HMPREF9506_03048; phage(gi418489798) 6e-18 Click
122914579..2914716 hypothetical protein; HMPREF9506_03049 0.0 Click
132914798..2915214 PHAGE_Entero_phiEf11: putative major structural protein; HMPREF9506_03050; phage(gi282598740) 2e-07 Click
142915227..2915739 PHAGE_Strept_TP_J34: putative major tail protein; HMPREF9506_03051; phage(gi444475914) 1e-38 Click
152915772..2916131 PHAGE_Strept_858: orf17; HMPREF9506_03052; phage(gi168229290) 3e-12 Click
162916224..2916517 PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_45; HMPREF9506_03053; phage(gi13487846) 4e-08 Click
172916507..2919440 PHAGE_Strept_P9: tail protein; HMPREF9506_03054; phage(gi157311175) 7e-58 Click
182919442..2920368 PHAGE_Entero_phiEf11: putative phage tail protein; HMPREF9506_03055; phage(gi282598752) 2e-146 Click
192920381..2921838 PHAGE_Entero_phiEf11: putative phage structural protein; HMPREF9506_03056; phage(gi282598760) 1e-173 Click
202921871..2923640 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9506_03057; phage(gi282598748) 0.0 Click
212923664..2924059 PHAGE_Entero_EF62phi: holin; HMPREF9506_03058; phage(gi384519787) 5e-38 Click
222924178..2925302 PHAGE_Entero_1: amidase; HMPREF9506_03059; phage(gi225626379) 2e-38 Click

Region 11, total : 70 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13063551..3063573 attL    TGGTGATACATTTGGTGATACAT 0.0 Click
2complement(3063597..3064823) PROPHAGE_Oceano_HTE831: integrase; HMPREF9506_03187; phage(gi23097608) 8e-32 Click
3complement(3064823..3065104) conserved hypothetical protein; HMPREF9506_03188 0.0 Click
4complement(3065265..3065861) PHAGE_Lister_B025: gp35; HMPREF9506_03189; phage(gi157325253) 8e-37 Click
5complement(3065889..3066353) PHAGE_Lister_B025: gp36; HMPREF9506_03190; phage(gi157325252) 4e-21 Click
6complement(3066370..3066678) PHAGE_Staphy_phi7401PVL: phage repressor; HMPREF9506_03191; phage(gi448244648) 4e-11 Click
73066779..3067090 helix-turn-helix protein; HMPREF9506_03192 0.0 Click
83067069..3067215 conserved hypothetical protein; HMPREF9506_03193 0.0 Click
93067284..3067838 conserved hypothetical protein; HMPREF9506_03194 0.0 Click
103067888..3068049 VrlI family protein; HMPREF9506_03195 0.0 Click
113068061..3068228 conserved hypothetical protein; HMPREF9506_03196 0.0 Click
123068229..3068444 PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9506_03197; phage(gi281416225) 4e-06 Click
133068500..3068790 conserved hypothetical protein; HMPREF9506_03198 0.0 Click
143068795..3070909 PHAGE_Brocho_NF5: gp34; HMPREF9506_03199; phage(gi327197619) 2e-64 Click
153070910..3072082 conserved hypothetical protein; HMPREF9506_03200 0.0 Click
163072082..3072783 PHAGE_Lister_B054: gp51; HMPREF9506_03201; phage(gi157325335) 3e-42 Click
173072795..3073559 PHAGE_Strept_3: hypothetical protein SpyM3_1139; HMPREF9506_03202; phage(gi28876309) 2e-12 Click
183073575..3074072 PHAGE_Geobac_GBSV1: putative recombination protein U; HMPREF9506_03203; phage(gi158267612) 1e-17 Click
193074093..3074407 conserved hypothetical protein; HMPREF9506_03204 0.0 Click
203074491..3075240 PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF9506_03205; phage(gi281416237) 6e-118 Click
213075265..3075492 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9506_03206; phage(gi282598739) 1e-34 Click
223075513..3075740 conserved hypothetical protein; HMPREF9506_03207 0.0 Click
233075737..3076171 PHAGE_Temper_1: hypothetical protein phiNIH1.1_19; HMPREF9506_03208; phage(gi16271795) 2e-13 Click
243076155..3076592 PHAGE_Entero_phiFL2A: YopX superfamily protein; HMPREF9506_03209; phage(gi281416516) 1e-14 Click
253076593..3076931 PHAGE_Entero_phiEF24C: hypothetical protein EFP_gp161; HMPREF9506_03210; phage(gi158079457) 5e-29 Click
263076928..3077281 DNA topoisomerase domain protein; HMPREF9506_03211 0.0 Click
273077278..3077865 PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9506_03212; phage(gi281416519) 4e-57 Click
283077862..3078347 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF9506_03213; phage(gi282598755) 1e-90 Click
293078348..3078665 replicase domain protein; HMPREF9506_03214 0.0 Click
303078659..3078865 PHAGE_Entero_phiFL2A: hypothetical protein; HMPREF9506_03215; phage(gi281416521) 3e-29 Click
313078866..3079045 PHAGE_Lactoc_1: ORF24; HMPREF9506_03216; phage(gi13786555) 4e-07 Click
323079177..3079365 conserved hypothetical protein; HMPREF9506_03217 0.0 Click
333079466..3080050 sigma-70, region 4; HMPREF9506_03218 0.0 Click
343080210..3080294 tRNA 0.0 Click
353080757..3081059 conserved domain protein; HMPREF9506_03220 0.0 Click
363081104..3082372 PHAGE_Strept_1: transferase; HMPREF9506_03221; phage(gi39653711) 6e-62 Click
373082498..3082728 PHAGE_Lister_B054: gp79; HMPREF9506_03222; phage(gi157325363) 4e-15 Click
383082743..3083468 PHAGE_Staphy_PH15: putative small terminase subunit; HMPREF9506_03223; phage(gi119967834) 1e-09 Click
393083449..3084885 PHAGE_Lister_B054: TerL; HMPREF9506_03224; phage(gi157325286) 5e-166 Click
403084908..3086302 PHAGE_Lister_B054: gp3; HMPREF9506_03225; phage(gi157325287) 3e-149 Click
413086265..3087536 PHAGE_Lister_B054: gp4; HMPREF9506_03226; phage(gi157325288) 2e-57 Click
423087529..3087693 conserved hypothetical protein; HMPREF9506_03227 0.0 Click
433087750..3088037 PHAGE_Lactob_LP65: hypothetical protein LP65_gp078; HMPREF9506_03228; phage(gi56693126) 8e-25 Click
443088030..3088239 LysM domain protein; HMPREF9506_03229 0.0 Click
453088252..3089352 PHAGE_Lister_B054: gp6; HMPREF9506_03230; phage(gi157325290) 6e-112 Click
463089355..3089825 PHAGE_Lister_B054: gp7; HMPREF9506_03231; phage(gi157325291) 3e-29 Click
473089847..3090728 PHAGE_Lister_B054: gp8; HMPREF9506_03232; phage(gi157325292) 3e-84 Click
483090718..3091134 PHAGE_Lister_B054: gp9; HMPREF9506_03233; phage(gi157325293) 5e-21 Click
493091146..3091487 PHAGE_Lister_B054: gp10; HMPREF9506_03234; phage(gi157325294) 6e-20 Click
503091487..3092089 PHAGE_Lister_B054: gp11; HMPREF9506_03235; phage(gi157325295) 3e-38 Click
513092089..3092448 PHAGE_Lister_B054: gp12; HMPREF9506_03236; phage(gi157325296) 4e-07 Click
523092435..3092911 PHAGE_Lister_B054: gp13; HMPREF9506_03237; phage(gi157325297) 1e-26 Click
533092908..3093945 PHAGE_Lister_B054: gp14; HMPREF9506_03238; phage(gi157325298) 9e-105 Click
543093961..3094359 PHAGE_Lister_B054: gp15; HMPREF9506_03239; phage(gi157325299) 2e-33 Click
553094412..3094744 PHAGE_Lister_B054: gp16; HMPREF9506_03240; phage(gi157325300) 1e-28 Click
563094785..3094925 PHAGE_Lister_B054: gp17; HMPREF9506_03241; phage(gi157325301) 2e-08 Click
573094928..3100093 PHAGE_Lister_B054: Tmp; HMPREF9506_03242; phage(gi157325302) 0.0 Click
583100093..3100650 PHAGE_Lister_B054: gp19; HMPREF9506_03243; phage(gi157325303) 1e-40 Click
593100660..3101022 PHAGE_Lister_B054: gp20; HMPREF9506_03244; phage(gi157325304) 4e-30 Click
603101023..3101853 PHAGE_Lister_B054: gp21; HMPREF9506_03245; phage(gi157325305) 4e-66 Click
613101853..3102185 PHAGE_Lister_B054: gp22; HMPREF9506_03246; phage(gi157325306) 2e-23 Click
623102185..3102532 PHAGE_Lister_B054: gp23; HMPREF9506_03247; phage(gi157325307) 8e-12 Click
633102525..3103679 PHAGE_Lister_B054: gp24; HMPREF9506_03248; phage(gi157325308) 4e-117 Click
643103663..3104292 PHAGE_Lister_B054: gp25; HMPREF9506_03249; phage(gi157325309) 1e-59 Click
653104305..3105954 PHAGE_Lister_B054: gp26; HMPREF9506_03250; phage(gi157325310) 2e-18 Click
663105976..3106410 conserved hypothetical protein; HMPREF9506_03251 0.0 Click
673106410..3106538 phage uncharacterized protein, XkdX family; HMPREF9506_03252 0.0 Click
683106543..3106899 PHAGE_Lactoc_r1t: hypothetical protein r1tp46; HMPREF9506_03253; phage(gi23455765) 3e-24 Click
693106896..3107093 conserved hypothetical protein; HMPREF9506_03254 0.0 Click
703107152..3108258 PHAGE_Entero_1: amidase; HMPREF9506_03255; phage(gi225626379) 4e-38 Click
713108411..3109061 PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp12; HMPREF9506_03256; phage(gi115334622) 2e-36 Click
723109061..3109825 PHAGE_Geobac_GBSV1: GepA protein; HMPREF9506_03257; phage(gi115334623) 9e-63 Click
733111145..3111167 attR    TGGTGATACATTTGGTGATACAT 0.0 Click