Streptococcus pyogenes M1 GAS, complete genome. [asmbl_id: NC_000000].1852441, GC%: 38.51%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1529591..529606 attL    CATGTACAACTATACT 0.0 Click
2complement(529631..531046) PHAGE_Lactoc_1: INT; bacteriophage; phage 370.1; SPy_0655(gi13786532) 4e-115 Click
3complement(531167..531532) PHAGE_Strept_O1205: hypothetical protein O1205p02; SPy_0656; phage(gi23455850) 2e-17 Click
4complement(531559..532320) PHAGE_Lactob_Sha1: bifunctional S24 family peptidase/transcriptional regulator; SPy_0657; phage(gi418489831) 4e-30 Click
5532504..532734 PHAGE_Lactoc_bIL286: repressor; SPy_0658; phage(gi13095748) 7e-21 Click
6532803..532940 hypothetical protein, phage associated; SPy_0659 0.0 Click
7532942..533067 hypothetical protein, phage associated; SPy_0660 0.0 Click
8533064..533291 hypothetical protein, phage associated; SPy_0661 0.0 Click
9533291..534610 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp13; SPy_0663; phage(gi56694881) 2e-160 Click
10534625..535716 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp14; SPy_0664; phage(gi56694882) 1e-103 Click
11535756..536178 PHAGE_Strept_MM1: hypothetical protein MM1p17; SPy_0665; phage(gi15088759) 2e-40 Click
12536180..536914 PHAGE_Strept_MM1: hypothetical protein MM1p18; SPy_0666; phage(gi15088760) 4e-79 Click
13536936..537571 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp15; SPy_0667; phage(gi56694883) 7e-31 Click
14537571..539154 PHAGE_Bacill_BCJA1c: DEAD box family helicase; SPy_0669; phage(gi56694884) 0.0 Click
15539164..539793 PHAGE_Clostr_phiCP26F: hypothetical protein; SPy_0670; phage(gi422933952) 3e-41 Click
16539783..542056 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp22; SPy_0671; phage(gi56694890) 0.0 Click
17542334..542552 PHAGE_Strept_MM1: hypothetical protein MM1p19; SPy_0672; phage(gi15088761) 1e-19 Click
18542545..542940 PHAGE_Bacill_BCJA1c: rus; SPy_0673; phage(gi56694892) 2e-46 Click
19542937..543158 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp25; SPy_0674; phage(gi56694893) 5e-06 Click
20543435..544070 PHAGE_Strept_2: hypothetical protein SpyM3_0951; SPy_0676; phage(gi28876235) 2e-113 Click
21544343..544777 PHAGE_Temper_1: hypothetical protein phiNIH1.1_22; SPy_0677; phage(gi16271798) 4e-57 Click
22545087..546253 PHAGE_Temper_1: hypothetical protein phiNIH1.1_23; SPy_0679; phage(gi16271799) 1e-62 Click
23546596..547072 PHAGE_Temper_1: hypothetical protein phiNIH1.1_26; SPy_0680; phage(gi16271802) 2e-53 Click
24547155..548366 PHAGE_Temper_1: terminase large subunit; SPy_0681; phage(gi16271803) 0.0 Click
25548380..549882 PHAGE_Temper_1: minor capsid protein; SPy_0682; phage(gi16271804) 0.0 Click
26549887..551380 PHAGE_Temper_1: minor capsid protein; SPy_0683; phage(gi16271805) 0.0 Click
27551380..551607 hypothetical protein, phage associated; SPy_0684 0.0 Click
28551694..551960 PHAGE_Temper_1: hypothetical protein phiNIH1.1_31; SPy_0685; phage(gi16271807) 2e-41 Click
29552086..552700 PHAGE_Temper_1: hypothetical protein phiNIH1.1_32; SPy_0686; phage(gi16271808) 7e-110 Click
30552704..553522 PHAGE_Temper_1: major capsid protein; SPy_0688; phage(gi16271809) 3e-150 Click
31553576..553992 PHAGE_Temper_1: hypothetical protein phiNIH1.1_34; SPy_0689; phage(gi16271810) 4e-58 Click
32553982..554314 PHAGE_Temper_1: minor capsid protein; SPy_0690; phage(gi16271811) 2e-60 Click
33554314..554670 PHAGE_Temper_1: minor capsid protein; SPy_0691; phage(gi16271812) 3e-65 Click
34554667..555065 PHAGE_Temper_1: minor capsid protein; SPy_0693; phage(gi16271813) 2e-72 Click
35555065..555460 PHAGE_Temper_1: tail protein; SPy_0694; phage(gi16271814) 1e-71 Click
36555589..556023 PHAGE_Temper_1: hypothetical protein phiNIH1.1_39; SPy_0695; phage(gi16271815) 2e-76 Click
37556027..556608 PHAGE_Temper_1: hypothetical protein phiNIH1.1_40; SPy_0696; phage(gi16271816) 6e-108 Click
38556598..559858 PHAGE_Temper_1: tail protein; SPy_0697; phage(gi16271817) 0.0 Click
39559855..560571 PHAGE_Temper_1: hypothetical protein phiNIH1.1_42; SPy_0698; phage(gi16271818) 3e-137 Click
40560568..562712 PHAGE_Temper_1: hypothetical protein phiNIH1.1_43; SPy_0700; phage(gi16271819) 0.0 Click
41562709..563722 PHAGE_Temper_1: hyaluronidase; SPy_0701; phage(gi16271820) 0.0 Click
42563737..565623 PHAGE_Temper_1: hypothetical protein phiNIH1.1_45; SPy_0702; phage(gi16271821) 0.0 Click
43565635..566066 PHAGE_Temper_1: hypothetical protein phiNIH1.1_46; SPy_0703; phage(gi16271822) 2e-69 Click
44566069..566686 PHAGE_Temper_1: hypothetical protein phiNIH1.1_47; SPy_0705; phage(gi16271823) 1e-98 Click
45566696..566971 PHAGE_Strept_2: hypothetical protein SpyM3_0924; SPy_0706; phage(gi28876208) 2e-45 Click
46566968..567195 PHAGE_Strept_2: putative holin; SPy_0707; phage(gi28876207) 4e-35 Click
47567311..568513 PHAGE_Temper_1: cell wall hydrolase; SPy_0710; phage(gi16271826) 0.0 Click
48complement(568581..569288) PHAGE_Temper_1: SpeL; SPy_0711; phage(gi16271829) 3e-13 Click
49complement(569399..570157) PHAGE_Strept_3: putative mitogenic factor; SPy_0712; phage(gi28876265) 2e-08 Click
50570494..570509 attR    CATGTACAACTATACT 0.0 Click

Region 2, total : 60 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1775802..776671 PHAGE_Escher_phAPEC8: putative glucose-1-phosphate thymidylyltransferase; SPy_0933; phage(gi448260372) 4e-102 Click
2776671..777264 PHAGE_Sphing_PAU: gp186; SPy_0935; phage(gi435844689) 1e-08 Click
3777508..778548 PHAGE_Escher_phAPEC8: putative dTDP-glucose 4,6-dehydratase; SPy_0936; phage(gi448260373) 8e-69 Click
4778526..778576 attL    AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAACG 0.0 Click
5complement(778642..779781) PHAGE_Strept_SMP: integrase; SPy_0937; phage(gi119953753) 4e-123 Click
6complement(780035..780844) PHAGE_Staphy_PT1028: ORF005; SPy_0938; phage(gi66395169) 1e-25 Click
7complement(780857..781603) PHAGE_Strept_PH15: putative transcriptional repressor; SPy_0939; phage(gi190151419) 8e-56 Click
8781793..781951 PHAGE_Strept_2: hypothetical protein SpyM3_0976; SPy_0940; phage(gi28876260) 6e-19 Click
9complement(782130..782969) PHAGE_Staphy_phiPVL108: hypothetical protein SABPV108_gp21; SPy_0942; phage(gi119443673) 7e-17 Click
10783029..783169 hypothetical protein; SPy_0943 0.0 Click
11complement(783087..783314) hypothetical protein; SPy_0944 0.0 Click
12783388..783594 hypothetical protein - phage associated; SPy_0945 0.0 Click
13783634..784362 PHAGE_Temper_1: antirepressor; SPy_0946; phage(gi16271781) 3e-115 Click
14784394..784660 hypothetical protein - phage associated; SPy_0947 0.0 Click
15complement(784595..785401) conserved hypothetical protein - phage associated; SPy_0948 0.0 Click
16complement(785543..785779) PHAGE_Strept_2: hypothetical protein SpyM3_0968; SPy_0949; phage(gi28876252) 7e-34 Click
17786231..786416 PHAGE_Temper_1: hypothetical protein phiNIH1.1_07; SPy_0952; phage(gi16271783) 4e-25 Click
18786899..787285 PHAGE_Strept_3: hypothetical protein SpyM3_1139; SPy_0953; phage(gi28876309) 2e-71 Click
19787266..787499 PHAGE_Strept_3: hypothetical protein SpyM3_1138; SPy_0954; phage(gi28876308) 4e-40 Click
20787645..787851 PHAGE_Strept_3: hypothetical protein SpyM3_1137; SPy_0956; phage(gi28876307) 7e-31 Click
21787907..788236 PHAGE_Strept_3: hypothetical protein SpyM3_1136; SPy_0957; phage(gi28876306) 3e-25 Click
22788239..789030 PHAGE_Lister_B054: gp50; SPy_0958; phage(gi157325334) 1e-41 Click
23789040..789705 PHAGE_Strept_M102: hypothetical protein M102_gp28; SPy_0959; phage(gi242345599) 2e-63 Click
24789709..790068 PHAGE_Strept_M102: hypothetical protein M102_gp28; SPy_0960; phage(gi242345599) 9e-15 Click
25790264..790602 PHAGE_Strept_3: hypothetical protein SpyM3_1129; SPy_0961; phage(gi28876299) 5e-11 Click
26790599..791111 PHAGE_Strept_1: hypothetical protein EJ-1p24; SPy_0962; phage(gi39653698) 3e-66 Click
27791288..791533 PHAGE_Temper_1: hypothetical protein phiNIH1.1_19; SPy_0963; phage(gi16271795) 4e-23 Click
28791585..792046 PHAGE_Strept_5: hypothetical protein SpyM3_1331; SPy_0965; phage(gi28876413) 3e-47 Click
29792496..792936 PHAGE_Temper_1: hypothetical protein phiNIH1.1_22; SPy_0967; phage(gi16271798) 1e-80 Click
30793251..794165 hypothetical protein; SPy_0968 0.0 Click
31794184..794645 hypothetical protein - phage associated; SPy_0970 0.0 Click
32794673..795155 PHAGE_Staphy_phiETA2: small terminase; SPy_0971; phage(gi122891755) 7e-20 Click
33795133..796422 PHAGE_Strept_SMP: terminase large subunit; SPy_0972; phage(gi119953777) 0.0 Click
34797917..799542 PHAGE_Strept_858: orf7; SPy_0975; phage(gi168229280) 1e-61 Click
35799533..799712 hypothetical protein; SPy_0976 0.0 Click
36799772..800041 PHAGE_Strept_5: hypothetical protein SpyM3_1324; SPy_0977; phage(gi28876406) 1e-37 Click
37800131..800301 hypothetical protein; SPy_0978 0.0 Click
38800430..800678 hypothetical protein; SPy_0979 0.0 Click
39800680..801426 PHAGE_Lactoc_bIL309: anti-repressor; SPy_0980; phage(gi13095813) 3e-60 Click
40801538..802071 PHAGE_Staphy_IPLA88: putative scaffold protein; SPy_0981; phage(gi215401211) 4e-21 Click
41802081..802461 PHAGE_Strept_2: capsid; SPy_0982; phage(gi273809733) 1e-11 Click
42802464..803513 PHAGE_Strept_858: orf10; SPy_0984; phage(gi168229283) 4e-110 Click
43803525..803791 PHAGE_Bacill_1: hypothetical protein BV1_gp22; SPy_0985; phage(gi155042937) 1e-06 Click
44803803..804156 PHAGE_Strept_Sfi11: gp113; SPy_0986; phage(gi9635017) 9e-26 Click
45804153..804461 PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_40; SPy_0987; phage(gi13487841) 1e-10 Click
46804442..804807 PHAGE_Entero_phiEf11: phage protein HK97; SPy_0988; phage(gi282598738) 6e-20 Click
47804804..805193 PHAGE_Lactoc_Tuc2009: major structural protein 2; SPy_0989; phage(gi13487843) 6e-47 Click
48805290..805856 PHAGE_Brocho_NF5: gp11; SPy_0991; phage(gi327197596) 9e-47 Click
49805916..806269 PHAGE_Entero_phiEf11: putative phage protein; SPy_0992; phage(gi282598743) 9e-24 Click
50806311..806640 PHAGE_Entero_phiEf11: putative phage protein; SPy_0993; phage(gi282598753) 4e-11 Click
51806655..810290 PHAGE_Strept_Sfi11: putative minor tail protein; SPy_0994; phage(gi9635024) 0.0 Click
52810323..811102 PHAGE_Strept_1: putative tail protein; SPy_0995; phage(gi28876188) 2e-68 Click
53811099..813147 PHAGE_Strept_1: putative tail fiber protein; SPy_0996; phage(gi28876189) 0.0 Click
54813147..814265 PHAGE_Strept_3: hyaluronoglucosaminidase; SPy_0997; phage(gi28876271) 2e-171 Click
55814278..816188 PHAGE_Strept_1: hypothetical protein SpyM3_0726; SPy_0998; phage(gi28876191) 0.0 Click
56816202..816363 hypothetical protein; SPy_0999 0.0 Click
57816366..816977 PHAGE_Temper_1: hypothetical protein phiNIH1.1_47; SPy_1001; phage(gi16271823) 3e-103 Click
58816988..817284 PHAGE_Temper_1: hypothetical protein phiNIH1.1_48; SPy_1002; phage(gi16271824) 7e-50 Click
59817578..818912 PHAGE_Strept_M102: hypothetical protein M102_gp19; SPy_1006; phage(gi242345590) 1e-69 Click
60819186..819863 PHAGE_Staphy_phiN315: enterotoxin P; SPy_1007; phage(gi30043936) 2e-28 Click
61819889..820599 PHAGE_Staphy_phiNM3: enterotoxin type A precursor; SPy_1008; phage(gi118725111) 8e-18 Click
62820960..821010 attR    AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAACG 0.0 Click

Region 3, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11182568..1182579 attL    AACTAACAAAAA 0.0 Click
2complement(1186921..1188783) PHAGE_Parame_AR158: hypothetical protein AR158_C785L; SPy_1434; phage(gi157953975) 1e-30 Click
31189728..1190534 PHAGE_Strept_3: putative mitogenic factor; SPy_1436; phage(gi28876265) 9e-06 Click
41190754..1191239 hypothetical protein; SPy_1437 0.0 Click
5complement(1191309..1192514) PHAGE_Strept_2: putative cell wall hydrolase; SPy_1438; phage(gi28876206) 0.0 Click
6complement(1192630..1192857) PHAGE_Strept_6: putative holin; SPy_1440; phage(gi28876443) 4e-35 Click
7complement(1192854..1193129) PHAGE_Strept_2: hypothetical protein SpyM3_0924; SPy_1441; phage(gi28876208) 2e-45 Click
8complement(1193139..1193756) PHAGE_Strept_2: hypothetical protein SpyM3_0925; SPy_1442; phage(gi28876209) 1e-109 Click
9complement(1193759..1194190) PHAGE_Temper_1: hypothetical protein phiNIH1.1_46; SPy_1443; phage(gi16271822) 5e-75 Click
10complement(1194202..1195986) PHAGE_Strept_3: hypothetical protein SpyM3_1100; SPy_1444; phage(gi28876270) 0.0 Click
11complement(1196001..1197113) PHAGE_Strept_3: hyaluronoglucosaminidase; SPy_1445; phage(gi28876271) 0.0 Click
12complement(1197113..1199071) PHAGE_Strept_3: putative platelet-binding protein; SPy_1446; phage(gi28876272) 0.0 Click
13complement(1199068..1199763) PHAGE_Strept_3: hypothetical protein SpyM3_1103; SPy_1447; phage(gi28876273) 6e-121 Click
14complement(1199760..1202117) PHAGE_Strept_3: putative human platelet-binding protein; SPy_1448; phage(gi28876274) 0.0 Click
15complement(1202117..1202488) PHAGE_Strept_3: hypothetical protein SpyM3_1105; SPy_1449; phage(gi28876275) 8e-65 Click
16complement(1202503..1202766) PHAGE_Strept_3: hypothetical protein SpyM3_1106; SPy_1450; phage(gi28876276) 1e-42 Click
17complement(1202777..1203370) PHAGE_Strept_3: putative structural protein; SPy_1451; phage(gi28876277) 4e-100 Click
18complement(1203382..1203717) PHAGE_Strept_3: hypothetical protein SpyM3_1108; SPy_1452; phage(gi28876278) 3e-59 Click
19complement(1203718..1203954) PHAGE_Strept_3: hypothetical protein SpyM3_1109; SPy_1453; phage(gi28876279) 1e-36 Click
20complement(1203947..1204276) PHAGE_Strept_3: hypothetical protein SpyM3_1110; SPy_1454; phage(gi28876280) 9e-42 Click
21complement(1204245..1204667) PHAGE_Strept_3: hypothetical protein SpyM3_1111; SPy_1455; phage(gi28876281) 5e-72 Click
22complement(1204677..1204877) PHAGE_Strept_3: hypothetical protein SpyM3_1112; SPy_1456; phage(gi28876282) 4e-32 Click
23complement(1204877..1205788) PHAGE_Strept_3: putative structural protein; SPy_1457; phage(gi28876283) 2e-171 Click
24complement(1205813..1206274) PHAGE_Strept_3: hypothetical protein SpyM3_1114; SPy_1459; phage(gi28876284) 3e-81 Click
25complement(1206355..1207770) PHAGE_Strept_3: putative terminase; SPy_1460; phage(gi28876285) 0.0 Click
26complement(1207880..1208146) PHAGE_Strept_3: hypothetical protein SpyM3_1117; SPy_1461; phage(gi28876287) 2e-35 Click
27complement(1208139..1208399) PHAGE_Strept_3: hypothetical protein SpyM3_1118; SPy_1462; phage(gi28876288) 3e-23 Click
28complement(1208368..1208592) PHAGE_Strept_3: hypothetical protein SpyM3_1119; SPy_1463; phage(gi28876289) 1e-38 Click
29complement(1208598..1210091) PHAGE_Strept_3: hypothetical protein SpyM3_1120; SPy_1464; phage(gi28876290) 0.0 Click
30complement(1210084..1211352) PHAGE_Strept_3: putative structural protein; SPy_1465; phage(gi28876291) 0.0 Click
31complement(1211349..1211705) PHAGE_Strept_3: hypothetical protein SpyM3_1122; SPy_1466; phage(gi28876292) 4e-64 Click
32complement(1211854..1212198) PHAGE_Strept_3: hypothetical protein SpyM3_1123; SPy_1468; phage(gi28876293) 3e-59 Click
33complement(1212307..1212726) PHAGE_Strept_3: hypothetical protein SpyM3_1124; SPy_1469; phage(gi28876294) 6e-71 Click
34complement(1212994..1213629) PHAGE_Strept_2: hypothetical protein SpyM3_0951; SPy_1470; phage(gi28876235) 2e-113 Click
35complement(1213631..1213900) PHAGE_Strept_6: hypothetical protein SpyM3_1438; SPy_1471; phage(gi28876468) 3e-36 Click
36complement(1213984..1214496) PHAGE_Strept_3: hypothetical protein SpyM3_1128; SPy_1473; phage(gi28876298) 2e-58 Click
37complement(1214493..1214906) PHAGE_Strept_3: hypothetical protein SpyM3_1129; SPy_1474; phage(gi28876299) 1e-12 Click
38complement(1215011..1215808) PHAGE_Strept_3: hypothetical protein SpyM3_1132; SPy_1475; phage(gi28876302) 1e-144 Click
39complement(1215801..1216001) PHAGE_Strept_3: hypothetical protein SpyM3_1133; SPy_1476; phage(gi28876303) 2e-32 Click
40complement(1215998..1216987) PHAGE_Strept_3: putative recombinase; SPy_1477; phage(gi28876304) 2e-101 Click
41complement(1216987..1217319) PHAGE_Strept_3: hypothetical protein SpyM3_1136; SPy_1478; phage(gi28876306) 3e-25 Click
42complement(1217375..1217581) PHAGE_Strept_3: hypothetical protein SpyM3_1137; SPy_1479; phage(gi28876307) 7e-32 Click
43complement(1217727..1217960) PHAGE_Strept_3: hypothetical protein SpyM3_1138; SPy_1481; phage(gi28876308) 4e-40 Click
44complement(1217941..1218327) PHAGE_Strept_3: hypothetical protein SpyM3_1139; SPy_1482; phage(gi28876309) 2e-71 Click
45complement(1218816..1219001) PHAGE_Strept_3: hypothetical protein SpyM3_1140; SPy_1483; phage(gi28876310) 3e-28 Click
46complement(1219003..1219314) PHAGE_Strept_3: putative excisionase; SPy_1484; phage(gi28876311) 3e-57 Click
47complement(1219584..1219796) PHAGE_Strept_3: putative Cro-like repressor protein; SPy_1485; phage(gi28876312) 2e-33 Click
481219998..1220753 PHAGE_Strept_3: putative cI-like repressor; SPy_1486; phage(gi28876313) 1e-141 Click
491220765..1221283 PHAGE_Strept_3: hypothetical protein SpyM3_1144; SPy_1487; phage(gi28876314) 2e-96 Click
501221278..1221289 attR    AACTAACAAAAA 0.0 Click
511221407..1222549 PHAGE_Strept_3: putative integrase; SPy_1488; phage(gi28876315) 0.0 Click
52complement(1222637..1222912) PHAGE_Bacill_36: DNA-binding HU protein; SPy_1489; phage(gi156564019) 3e-29 Click