Escherichia coli O157:H7 str. EC4191 , whole genome [asmbl_id: NC_000000].5201104, GC%: 50.22%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 38 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
164074..66857 PHAGE_Acanth_moumouvirus: putative Zn-dependent peptidase; PP_00056; phage(gi441432193) 8e-20 Click
265817..65828 attL    AAACGCTGGAGT 0.0 Click
3complement(67388..68044) PHAGE_Entero_HK106: tail fiber assembly protein; PP_00057; phage(gi428783304) 9e-80 Click
4complement(68044..69363) PHAGE_Salmon_RE_2010: tail fiber protein; PP_00058; phage(gi418489713) 2e-108 Click
5complement(69360..69971) PHAGE_Yersin_413C: gpI; PP_00059; phage(gi30065721) 3e-82 Click
6complement(69964..70872) PHAGE_Yersin_413C: gpJ; PP_00060; phage(gi30065720) 3e-166 Click
7complement(70877..71224) PHAGE_Yersin_413C: gpW; PP_00061; phage(gi30065719) 2e-59 Click
8complement(71221..71856) PHAGE_Yersin_413C: gpV; PP_00062; phage(gi30065718) 1e-116 Click
9complement(71923..72375) PHAGE_Yersin_413C: gpS; PP_00063; phage(gi30065717) 1e-77 Click
10complement(72368..72835) PHAGE_Yersin_413C: gpR; PP_00064; phage(gi30065716) 2e-83 Click
11complement(72798..72956) PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_00065; phage(gi431810968) 2e-10 Click
12complement(72943..73368) PHAGE_Yersin_413C: LysB; PP_00066; phage(gi30065715) 4e-68 Click
13complement(73356..73781) PHAGE_Yersin_413C: LysA; PP_00067; phage(gi30065714) 1e-67 Click
14complement(73796..74293) PHAGE_Yersin_413C: gpK; PP_00068; phage(gi30065713) 3e-94 Click
15complement(74293..74574) PHAGE_Yersin_413C: gpY; PP_00069; phage(gi30065712) 3e-46 Click
16complement(74578..74781) PHAGE_Yersin_413C: gpX; PP_00070; phage(gi30065711) 2e-32 Click
17complement(74781..75254) PHAGE_Yersin_413C: gpL; PP_00071; phage(gi30065710) 2e-85 Click
18complement(75390..76133) PHAGE_Yersin_413C: gpM; PP_00072; phage(gi30065709) 7e-135 Click
19complement(76137..77210) PHAGE_Yersin_413C: gpN; PP_00073; phage(gi30065708) 0.0 Click
20complement(77269..78123) PHAGE_Yersin_413C: gpO; PP_00074; phage(gi30065707) 3e-160 Click
2178297..80069 PHAGE_Yersin_413C: gpP; PP_00075; phage(gi30065706) 0.0 Click
2280069..81103 PHAGE_Yersin_413C: gpQ; PP_00076; phage(gi30065705) 0.0 Click
23complement(81142..81303) hypothetical protein ECSP_2869 [Escherichia coli O157:H7 str. TW14359] gi|254793897|ref|YP_003078734.1|; PP_00077 1e-21 Click
24complement(81421..83388) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; PP_00078; phage(gi9631364) 7e-09 Click
25complement(83388..83900) hypothetical protein ECSP_2871 [Escherichia coli O157:H7 str. TW14359] gi|254793899|ref|YP_003078736.1|; PP_00079 2e-88 Click
26complement(83887..85110) virulence factor [Escherichia coli O157:H7 str. TW14359] gi|254793900|ref|YP_003078737.1|; PP_00080 0.0 Click
27complement(85200..87482) PHAGE_Yersin_413C: gpA; PP_00081; phage(gi30065742) 0.0 Click
28complement(87472..87747) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; PP_00082; phage(gi30065741) 1e-46 Click
29complement(87744..87968) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; PP_00083; phage(gi30065740) 9e-35 Click
30complement(87971..88270) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; PP_00084; phage(gi30065739) 8e-49 Click
31complement(88270..88494) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; PP_00085; phage(gi30065738) 1e-32 Click
32complement(88558..89058) PHAGE_Yersin_413C: gpB; PP_00086; phage(gi30065737) 8e-94 Click
33complement(89055..89225) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; PP_00087; phage(gi30065736) 1e-26 Click
34complement(89236..89511) PHAGE_Yersin_413C: Cox; PP_00088; phage(gi30065735) 3e-17 Click
3589758..89769 attR    AAACGCTGGAGT 0.0 Click
3690048..91061 PHAGE_Yersin_413C: Int; PP_00089; phage(gi30065733) 1e-91 Click
37complement(91326..91586) hypothetical protein SSON_2135 [Shigella sonnei Ss046] gi|74312607|ref|YP_311026.1|; PP_00090 5e-43 Click
3892049..92948 phosphatidylglycerol kinase, metal-dependent [Escherichia coli W] gi|386609485|ref|YP_006124971.1|; PP_00091 2e-170 Click
39complement(93030..93764) galactitol utilization operon repressor [Escherichia coli O157:H7 str. TW14359] gi|254793913|ref|YP_003078750.1|; PP_00092 2e-129 Click
40complement(93909..94949) PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; PP_00093; phage(gi326781942) 8e-11 Click

Region 2, total : 45 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(488115..488591) PHAGE_Burkho_phiE202: gp9, Cpp15; PP_00492; phage(gi134288743) 2e-08 Click
2complement(488719..489432) PHAGE_Entero_mEp234: prophage repressor; PP_00493; phage(gi428782293) 3e-133 Click
3489533..489733 PHAGE_Entero_HK544: Cro protein; PP_00494; phage(gi428783258) 7e-32 Click
4490008..490145 PHAGE_Entero_lambda: cII protein; PP_00495; phage(gi9626294) 1e-18 Click
5490178..490309 PHAGE_Entero_lambda: DNA replication protein; PP_00496; phage(gi9626295) 4e-18 Click
6complement(490438..490644) PHAGE_Entero_HK225: Kil protein; PP_00497; phage(gi428782413) 6e-30 Click
7complement(491125..491502) PHAGE_Lactob_Lj965: hypothetical protein Ljo_0305; PP_00498; phage(gi41179237) 1e-32 Click
8complement(491480..492541) PHAGE_Lactob_Lj965: hypothetical protein Ljo_0304; PP_00499; phage(gi41179236) 4e-66 Click
9complement(492622..493236) PHAGE_Entero_mEp460: prophage repressor; PP_00500; phage(gi428782354) 2e-42 Click
10493716..494255 PHAGE_Entero_mEp237: CII protein; PP_00501; phage(gi435439306) 1e-63 Click
11494267..495145 PHAGE_Salmon_vB_SemP_Emek: DNA replication protein; PP_00502; phage(gi399498840) 2e-28 Click
12495244..495372 hypothetical; PP_00503 0.0 Click
13complement(495942..496217) PHAGE_Stx2_c_I: Q protein; PP_00504; phage(gi20065938) 4e-45 Click
14complement(496303..496440) PHAGE_Entero_mEp237: hypothetical protein; PP_00505; phage(gi435439319) 4e-10 Click
15complement(496440..496817) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_00506; phage(gi435439318) 3e-59 Click
16complement(496834..497892) PHAGE_Entero_mEp460: DNA methylase; PP_00507; phage(gi428782369) 3e-174 Click
17complement(498043..498240) PHAGE_Entero_mEp460: hypothetical protein; PP_00508; phage(gi428782368) 3e-08 Click
18complement(498465..499019) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; PP_00509; phage(gi399528832) 9e-07 Click
19complement(499194..500798) PHAGE_Entero_HK630: tail length tape measure protein H; PP_00510; phage(gi428782803) 0.0 Click
20complement(500779..501168) PHAGE_Entero_HK630: tail assembly protein GT; PP_00511; phage(gi428782802) 4e-43 Click
21complement(501219..501650) PHAGE_Entero_HK630: minor tail protein G; PP_00512; phage(gi428782801) 5e-45 Click
22complement(501664..502416) PHAGE_Entero_HK630: major tail protein V; PP_00513; phage(gi428782800) 1e-112 Click
23complement(502386..502718) PHAGE_Entero_mEp460: minor tail protein; PP_00514; phage(gi428782331) 1e-51 Click
24complement(502728..503057) PHAGE_Entero_mEp460: minor tail protein; PP_00515; phage(gi428782330) 2e-61 Click
25complement(503057..506122) PHAGE_Entero_mEp460: tail length tape measure protein; PP_00516; phage(gi428782329) 0.0 Click
26complement(506094..506369) PHAGE_Entero_mEp460: tail assembly protein; PP_00517; phage(gi428782328) 5e-48 Click
27complement(506432..506818) PHAGE_Entero_mEp460: minor tail protein; PP_00518; phage(gi428782327) 1e-64 Click
28complement(506879..507622) PHAGE_Entero_mEp460: major tail protein; PP_00519; phage(gi428782326) 4e-137 Click
29complement(507633..508034) PHAGE_Entero_mEp460: minor tail protein; PP_00520; phage(gi428782325) 1e-72 Click
30complement(508031..508609) PHAGE_Entero_mEp460: minor tail protein; PP_00521; phage(gi428782324) 2e-103 Click
31complement(508621..508896) PHAGE_Entero_mEp460: hypothetical protein; PP_00522; phage(gi428782323) 4e-47 Click
32complement(508889..509212) PHAGE_Entero_mEp460: hypothetical protein; PP_00523; phage(gi428782322) 1e-54 Click
33complement(509299..511257) PHAGE_Entero_mEp460: putative protease/scaffold protein; PP_00524; phage(gi428782321) 0.0 Click
34complement(511271..511633) PHAGE_Entero_mEp460: portal protein; PP_00525; phage(gi428782320) 3e-66 Click
35complement(511728..512780) PHAGE_Entero_mEp460: portal protein; PP_00526; phage(gi428782320) 0.0 Click
36complement(512780..512992) PHAGE_Entero_mEp460: hypothetical protein; PP_00527; phage(gi428782319) 8e-35 Click
37complement(512989..515091) PHAGE_Entero_mEp460: terminase large subunit; PP_00528; phage(gi428782318) 0.0 Click
38complement(515091..515582) PHAGE_Entero_mEp460: terminase small subunit; PP_00529; phage(gi428782317) 5e-74 Click
39complement(516257..516400) PHAGE_Entero_mEp460: hypothetical protein; PP_00530; phage(gi428782374) 1e-19 Click
40complement(516438..516644) PHAGE_Salmon_SPN3UB: Rz1; PP_00531; phage(gi423262446) 5e-33 Click
41complement(516856..517599) PHAGE_Entero_mEp460: tail fiber component; PP_00532; phage(gi428782332) 2e-149 Click
42complement(517605..518021) PHAGE_Entero_mEp460: minor tail protein; PP_00533; phage(gi428782331) 4e-78 Click
43518129..519193 hemolysin activator protein [Escherichia coli O157:H7 str. TW14359] gi|254792391|ref|YP_003077228.1|; PP_00534 0.0 Click
44519434..519949 hypothetical protein Z1641 [Escherichia coli O157:H7 str. EDL933] gi|15801127|ref|NP_287144.1|; PP_00535 5e-98 Click
45519946..522114 PHAGE_Porcin_virus: Pol1; PP_00536; phage(gi19387582) 1e-08 Click

Region 3, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1754487..754499 attL    CGGCGTTGAAAGC 0.0 Click
2762975..764834 PHAGE_Ralsto_RSL1: gsp gene product; PP_00779; phage(gi189426829) 9e-27 Click
3765126..766412 PHAGE_Bathyc_BpV1: hypothetical protein; PP_00780; phage(gi313768202) 9e-07 Click
4complement(766673..766816) hypothetical protein G2583_4399 [Escherichia coli O55:H7 str. CB9615] gi|291285033|ref|YP_003501851.1|; PP_00781 1e-20 Click
5complement(766834..768171) PHAGE_Entero_Sf6: putative transposase OrfB; PP_00782; phage(gi41057343) 5e-100 Click
6768143..768604 PHAGE_Entero_mEp460: hypothetical protein; PP_00783; phage(gi428782365) 9e-36 Click
7complement(768639..768797) PHAGE_Entero_HK633: hypothetical protein; PP_00784; phage(gi428782546) 7e-16 Click
8768796..769953 PHAGE_Entero_Sf6: gene 16 protein; PP_00785; phage(gi41057294) 0.0 Click
9complement(770128..771264) PHAGE_Entero_Sf6: gene 12 protein; PP_00786; phage(gi41057290) 7e-85 Click
10complement(771274..771900) PHAGE_Entero_Sf6: gene 11 protein; PP_00787; phage(gi41057289) 9e-74 Click
11complement(771941..772408) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; PP_00788; phage(gi89885999) 2e-64 Click
12complement(772408..772977) PHAGE_Entero_Sf6: gene 9 protein; PP_00789; phage(gi41057287) 3e-93 Click
13777777..777789 attR    CGGCGTTGAAAGC 0.0 Click

Region 4, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11095617..1095629 attL    GCAAAAACTGCTC 0.0 Click
2complement(1099481..1103704) PHAGE_Megavi_lba: DNA-directed RNA polymerase subunit 1; PP_01115; phage(gi448825325) 1e-38 Click
3complement(1103781..1105085) PHAGE_Singap_iridovirus: DNA-directed RNA polymerase II second largest subunit; PP_01116; phage(gi56692710) 1e-23 Click
41105112..1105228 PHAGE_Escher_HK75: RusA-like protein; PP_01117; phage(gi356870726) 8e-06 Click
51105218..1105589 PHAGE_Entero_2008: antitermination protein Q; PP_01118; phage(gi209427762) 4e-54 Click
61105741..1106559 hypothetical protein ECSP_1101 [Escherichia coli O157:H7 str. TW14359] gi|254792194|ref|YP_003077031.1|; PP_01119 6e-156 Click
71106846..1107085 PHAGE_Entero_phiP27: hypothetical protein P27p23; PP_01120; phage(gi18249887) 2e-20 Click
8complement(1107149..1107289) hypothetical; PP_01121 0.0 Click
91107306..1107851 envelope protein encoded within prophage CP-933N [Escherichia coli O157:H7 str. TW14359] gi|254792196|ref|YP_003077033.1|; PP_01122 9e-90 Click
101107949..1111851 PROPHAGE_Shigel_301: serine protease; PP_01123; phage(gi24114232) 0.0 Click
11complement(1112014..1112154) hypothetical protein ECH74115_B0105 [Escherichia coli O157:H7 str. EC4115] gi|209395579|ref|YP_002268481.1|; PP_01124 2e-19 Click
12complement(1112316..1112480) PHAGE_Entero_P1: InsA; PP_01125; phage(gi46401643) 3e-07 Click
131113643..1113762 hypothetical; PP_01126 0.0 Click
141114030..1114851 polysaccharide deacetylase family protein [Escherichia coli O157:H7 str. EC4115] gi|209395609|ref|YP_002268486.1|; PP_01127 3e-164 Click
151114851..1115957 UDP-sugar hydrolase [Escherichia coli O157:H7 str. EC4115] gi|209395585|ref|YP_002268487.1|; PP_01128 0.0 Click
161116047..1117768 hypothetical protein ECH74115_B0113 [Escherichia coli O157:H7 str. EC4115] gi|209395618|ref|YP_002268488.1|; PP_01129 0.0 Click
171117842..1118351 lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase [Escherichia coli O157:H7 str. EC4115] gi|209395556|ref|YP_002268489.1|; PP_01130 4e-92 Click
181118760..1118894 hypothetical; PP_01131 0.0 Click
19complement(1119094..1119258) hypothetical; PP_01132 0.0 Click
20complement(1119286..1120131) Phospholipase, patatin family [Escherichia coli P12b] gi|386705273|ref|YP_006169120.1|; PP_01133 9e-158 Click
21complement(1120119..1120355) PHAGE_Rhodot_RM378: hypothetical protein Rm378p022; PP_01134; phage(gi30044012) 2e-06 Click
22complement(1120352..1120747) hypothetical protein P12B_c2102, partial [Escherichia coli P12b] gi|386705272|ref|YP_006169119.1|; PP_01135 2e-57 Click
231120707..1120719 attR    GCAAAAACTGCTC 0.0 Click
241120799..1121002 hypothetical protein G2583_2482 [Escherichia coli O55:H7 str. CB9615] gi|291283207|ref|YP_003500025.1|; PP_01136 6e-33 Click
251121002..1122081 PHAGE_Xylell_Xfas53: integrase; PP_01137; phage(gi273810420) 1e-20 Click

Region 5, total : 44 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11227593..1227612 attL    TGCCGGATGCGGCGTGAACG 0.0 Click
21241361..1242044 PHAGE_Ectoca_1: EsV-1-65; PP_01263; phage(gi13242537) 3e-08 Click
31242034..1243482 PHAGE_Ectoca_1: EsV-1-65; PP_01264; phage(gi13242537) 4e-10 Click
4complement(1244160..1244879) hypothetical; PP_01265 0.0 Click
5complement(1244852..1246093) PHAGE_Entero_2008: putative portal protein; PP_01266; phage(gi209427777) 0.0 Click
6complement(1246109..1246228) PHAGE_Entero_mEp460: host specificity protein; PP_01267; phage(gi428782334) 6e-07 Click
71246230..1246889 PHAGE_Salmon_1: hypothetical bacteriophage protein; PP_01268; phage(gi169257202) 4e-61 Click
8complement(1247080..1247292) hypothetical protein ECO26_1359 [Escherichia coli O26:H11 str. 11368] gi|260854510|ref|YP_003228401.1|; PP_01269 4e-25 Click
9complement(1247308..1247793) PHAGE_Pseudo_YuA: hypothetical protein; PP_01270; phage(gi162135127) 1e-13 Click
10complement(1247856..1248131) hypothetical; PP_01271 0.0 Click
11complement(1248500..1248640) PHAGE_Entero_HK630: head-tail connector Fii; PP_01272; phage(gi428782797) 2e-12 Click
12complement(1248652..1249050) PHAGE_Entero_HK225: head assembly protein Fi; PP_01273; phage(gi428782384) 7e-21 Click
13complement(1249190..1249831) PHAGE_Entero_4795: putative tail component; PP_01274; phage(gi157166057) 6e-67 Click
14complement(1249993..1250643) PHAGE_Entero_mEp460: Lom protein; PP_01275; phage(gi428782335) 2e-94 Click
15complement(1250714..1251538) PHAGE_Entero_mEp460: host specificity protein; PP_01276; phage(gi428782334) 9e-131 Click
16complement(1251558..1252103) PHAGE_Entero_mEp460: putative exonuclease; PP_01277; phage(gi428782342) 3e-22 Click
17complement(1252186..1252851) PHAGE_Stx2_c_1717: NinI protein; PP_01278; phage(gi209447164) 3e-130 Click
181253365..1253505 hypothetical protein ECSP_1474, partial [Escherichia coli O157:H7 str. TW14359] gi|254792555|ref|YP_003077392.1|; PP_01279 7e-12 Click
191253808..1254686 PHAGE_Salmon_vB_SemP_Emek: antirepressor; PP_01280; phage(gi399498814) 2e-94 Click
201254740..1255261 PHAGE_Entero_mEp460: tail fiber component; PP_01281; phage(gi428782332) 2e-49 Click
21complement(1255439..1256002) PHAGE_Thalas_BA3: hypothetical protein BA3_0002; PP_01282; phage(gi160700596) 5e-21 Click
22complement(1256049..1257410) hypothetical protein ECH74115_B0062 [Escherichia coli O157:H7 str. EC4115] gi|209395615|ref|YP_002268443.1|; PP_01283 0.0 Click
231257714..1257863 hypothetical protein ECH74115_B0060 [Escherichia coli O157:H7 str. EC4115] gi|209395533|ref|YP_002268441.1|; PP_01284 1e-19 Click
24complement(1258035..1258562) PHAGE_Entero_mEp460: host specificity protein; PP_01285; phage(gi428782334) 8e-87 Click
25complement(1258623..1259195) PHAGE_Entero_mEp460: tail assembly protein; PP_01286; phage(gi428782333) 8e-73 Click
261259165..1260055 hypothetical protein ECSP_0574 [Escherichia coli O157:H7 str. TW14359] gi|254791689|ref|YP_003076526.1|; PP_01287 6e-140 Click
27complement(1260018..1260224) hypothetical; PP_01288 0.0 Click
281260568..1260864 PROPHAGE_Escher_CFT073: transposase; PP_01289; phage(gi26246249) 3e-26 Click
291260894..1261151 PROPHAGE_Escher_CFT073: transposase; PP_01290; phage(gi26246249) 9e-34 Click
30complement(1261833..1262744) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; PP_01291; phage(gi148609405) 2e-146 Click
311263218..1263910 PHAGE_Entero_mEp235: integrase; PP_01292; phage(gi428781836) 4e-113 Click
321264571..1265896 PHAGE_Entero_4795: NleA4795 protein; PP_01293; phage(gi157166068) 0.0 Click
331266106..1266252 NleA8-2 protein [Escherichia coli O55:H7 str. CB9615] gi|291282338|ref|YP_003499156.1|; PP_01294 4e-08 Click
34complement(1266845..1267081) PROPHAGE_Escher_MG1655: predicted transposase; PP_01295; phage(gi16131356) 4e-36 Click
351267678..1267824 hypothetical protein ECSP_0245 [Escherichia coli O157:H7 str. TW14359] gi|254791372|ref|YP_003076209.1|; PP_01296 1e-18 Click
36complement(1267827..1268444) PHAGE_Cyprin_3: unnamed protein product; PP_01297; phage(gi131840095) 6e-05 Click
37complement(1268447..1269313) RhsG core protein [Escherichia coli O157:H7 str. TW14359] gi|254791370|ref|YP_003076207.1|; PP_01298 5e-172 Click
38complement(1269306..1269617) PHAGE_Entero_mEp460: terminase small subunit; PP_01299; phage(gi428782317) 2e-29 Click
391270023..1270913 hypothetical protein ECSP_0574 [Escherichia coli O157:H7 str. TW14359] gi|254791689|ref|YP_003076526.1|; PP_01300 2e-158 Click
40complement(1270917..1271633) PHAGE_Stx2_c_1717: putative major tail subunit; PP_01301; phage(gi209447187) 2e-134 Click
41complement(1271603..1272208) PHAGE_Entero_HK630: terminase large subunit A; PP_01302; phage(gi428782789) 2e-98 Click
42complement(1272183..1272728) PHAGE_Entero_HK630: terminase small subunit nu1; PP_01303; phage(gi428782788) 3e-96 Click
431272981..1273442 hypothetical protein ECSP_5002, partial [Escherichia coli O157:H7 str. TW14359] gi|254795939|ref|YP_003080776.1|; PP_01304 1e-87 Click
441273507..1273680 hypothetical protein G2583_4745 [Escherichia coli O55:H7 str. CB9615] gi|291285353|ref|YP_003502171.1|; PP_01305 1e-25 Click
45complement(1274044..1274229) PROPHAGE_Escher_MG1655: IS1 transposase B; PP_01306; phage(gi16131317) 1e-07 Click
461285052..1285071 attR    TGCCGGATGCGGCGTGAACG 0.0 Click

Region 6, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11316704..1317249 PHAGE_Synech_S_CRM01: NusG antitermination factor; PP_01341; phage(gi333798264) 2e-11 Click
21317408..1317836 50S ribosomal protein L11 [Shigella sonnei Ss046] gi|74314477|ref|YP_312896.1|; PP_01342 3e-73 Click
31317840..1318544 50S ribosomal protein L1 [Shigella sonnei Ss046] gi|74314478|ref|YP_312897.1|; PP_01343 4e-124 Click
41318836..1319333 50S ribosomal protein L10 [Shigella sonnei Ss046] gi|74314479|ref|YP_312898.1|; PP_01344 6e-84 Click
51319400..1319765 50S ribosomal protein L7/L12 [Shigella flexneri 5 str. 8401] gi|110807836|ref|YP_691356.1|; PP_01345 1e-56 Click
61320085..1323018 PHAGE_Wisean_virus: hypothetical protein; PP_01346; phage(gi339906100) 1e-11 Click
7complement(1323177..1323311) PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; PP_01347; phage(gi401817574) 8e-07 Click
81323662..1323775 hypothetical protein G2583_2475 [Escherichia coli O55:H7 str. CB9615] gi|291283200|ref|YP_003500018.1|; PP_01348 5e-08 Click
91324067..1324423 PHAGE_Entero_HK629: hypothetical protein; PP_01349; phage(gi428782046) 9e-16 Click
101324420..1324608 hypothetical protein ECO26_1472 [Escherichia coli O26:H11 str. 11368] gi|260854622|ref|YP_003228513.1|; PP_01350 5e-31 Click
111324605..1324916 PHAGE_Entero_mEp213: hypothetical protein; PP_01351; phage(gi428782634) 2e-24 Click
121325043..1325606 PHAGE_Entero_mEp460: hypothetical protein; PP_01352; phage(gi428782343) 5e-41 Click
13complement(1325759..1326046) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp61; PP_01353; phage(gi209447184) 6e-25 Click
14complement(1326126..1326299) PHAGE_Stx2_c_1717: putative prophage portal protein; PP_01354; phage(gi209447183) 4e-23 Click
15complement(1326296..1327177) PHAGE_Entero_mEp460: host specificity protein; PP_01355; phage(gi428782334) 1e-151 Click
161327415..1327648 hypothetical protein G2583_1536 [Escherichia coli O55:H7 str. CB9615] gi|291282284|ref|YP_003499102.1|; PP_01356 1e-37 Click
17complement(1327626..1328033) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01357; phage(gi418487085) 5e-12 Click
181328200..1328514 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; PP_01358; phage(gi116221998) 4e-18 Click
191328755..1329537 hypothetical protein ECSP_0574 [Escherichia coli O157:H7 str. TW14359] gi|254791689|ref|YP_003076526.1|; PP_01359 1e-147 Click
201329835..1329966 hypothetical protein G2583_0620 [Escherichia coli O55:H7 str. CB9615] gi|291281411|ref|YP_003498229.1|; PP_01360 2e-17 Click
21complement(1330522..1330893) PROPHAGE_Shewan_MR-1: ISSod13, transposase; PP_01361; phage(gi24375047) 3e-52 Click

Region 7, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11453538..1453885 PHAGE_Stx2_c_1717: transposase; PP_01482; phage(gi209447152) 2e-62 Click
21453935..1454744 PHAGE_Stx2_c_1717: transposase; PP_01483; phage(gi209447153) 5e-151 Click
31455235..1455348 hypothetical protein G2583_2428 [Escherichia coli O55:H7 str. CB9615] gi|291283153|ref|YP_003499971.1|; PP_01484 2e-12 Click
4complement(1456196..1456360) hypothetical; PP_01485 0.0 Click
5complement(1456718..1457041) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; PP_01486; phage(gi209447168) 6e-63 Click
6complement(1457855..1459294) PHAGE_Stx2_c_II: putative tail fiber protein; PP_01487; phage(gi302393090) 0.0 Click
7complement(1459291..1459941) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01488; phage(gi418487106) 2e-122 Click
8complement(1459941..1460504) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01489; phage(gi418487105) 2e-104 Click
9complement(1460488..1460949) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01490; phage(gi418487104) 2e-82 Click
10complement(1460999..1461388) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01491; phage(gi418487103) 2e-66 Click
11complement(1461444..1462658) PHAGE_Stx2_c_86: putative virion structural protein; PP_01492; phage(gi116222008) 0.0 Click
12complement(1462682..1463098) PHAGE_Escher_P13374: hypothetical protein; PP_01493; phage(gi410491654) 3e-73 Click
13complement(1463203..1463418) PHAGE_Stx2_c_II: holin; PP_01494; phage(gi302393164) 6e-35 Click
14complement(1463496..1463741) PHAGE_Escher_P13374: hypothetical protein; PP_01495; phage(gi410491644) 1e-38 Click
15complement(1463846..1464403) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; PP_01496; phage(gi116221997) 1e-49 Click
161464631..1465833 protein TraI [Escherichia coli O157:H7 str. EC4115] gi|209395617|ref|YP_002268456.1|; PP_01497 0.0 Click
171465853..1466599 PHAGE_Xantho_Cf1c: hypothetical protein Cf1cp5; PP_01498; phage(gi17975752) 2e-14 Click
181466658..1467518 hydrolase, alpha/beta fold family [Escherichia coli O157:H7 str. EC4115] gi|209395578|ref|YP_002268458.1|; PP_01499 1e-163 Click
191467621..1468181 conjugal transfer fertility inhibition protein FinO [Escherichia coli O157:H7 str. EC4115] gi|209395563|ref|YP_002268459.1|; PP_01500 6e-101 Click
20complement(1468335..1468496) hypothetical; PP_01501 0.0 Click
211468771..1469232 PHAGE_Bacill_SPBc2: putative DNase/RNase endonuclease; PP_01502; phage(gi9630131) 1e-08 Click

Region 8, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11468587..1468599 attL    CTTTTTTTAATAT 0.0 Click
21474970..1475143 PHAGE_Salmon_vB_SosS_Oslo: Arc-like DNA binding domain protein; PP_01512; phage(gi399528776) 1e-11 Click
31475133..1476137 PHAGE_Salmon_vB_SosS_Oslo: putative antirepressor protein Ant; PP_01513; phage(gi399528777) 8e-108 Click
4complement(1476149..1476850) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; PP_01514; phage(gi15832203) 5e-123 Click
51477163..1477507 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; PP_01515; phage(gi20065865) 8e-59 Click
61477948..1478490 PHAGE_Entero_mEp460: hypothetical protein; PP_01516; phage(gi428782365) 9e-36 Click
7complement(1478906..1480267) PHAGE_Gifsy_1: leucine-rich repeat protein; PP_01517; phage(gi169257209) 5e-64 Click
8complement(1480631..1481494) spermidine/putrescine ABC transporter [Escherichia coli O157:H7 str. EDL933] gi|15801300|ref|NP_287317.1|; PP_01518 1e-159 Click
9complement(1481478..1482614) PHAGE_Plankt_PaV_LD: ABC transporter; PP_01519; phage(gi371496158) 7e-27 Click
101482864..1484090 peptidase T [Shigella sonnei Ss046] gi|74311686|ref|YP_310105.1|; PP_01520 0.0 Click
11complement(1484139..1485260) YcfD protein [Escherichia coli O55:H7 str. CB9615] gi|291282146|ref|YP_003498964.1|; PP_01521 0.0 Click
12complement(1485340..1485504) hypothetical protein CE10_1210 [Escherichia coli O7:K1 str. CE10] gi|386623586|ref|YP_006143314.1|; PP_01522 3e-24 Click
131485509..1486738 PHAGE_Salmon_vB_SosS_Oslo: integrase; PP_01523; phage(gi399528791) 2e-59 Click
141495492..1495504 attR    CTTTTTTTAATAT 0.0 Click

Region 9, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11756663..1757436 PHAGE_Pseudo_OBP: putative homing nuclease; PP_01778; phage(gi371671534) 2e-38 Click
2complement(1757494..1758048) PHAGE_Entero_2: DNA-invertase; PP_01779; phage(gi169936026) 8e-89 Click
3complement(1758228..1758812) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_01780; phage(gi169257244) 1e-64 Click
4complement(1758857..1759495) RhsG core protein [Escherichia coli O157:H7 str. TW14359] gi|254791370|ref|YP_003076207.1|; PP_01781 2e-119 Click
5complement(1759677..1760393) PHAGE_Fowlpo_virus: Ankyrin repeat gene family protein; PP_01782; phage(gi9634916) 4e-15 Click
6complement(1760533..1761417) hypothetical protein ECSP_0241 [Escherichia coli O157:H7 str. TW14359] gi|254791368|ref|YP_003076205.1|; PP_01783 2e-176 Click
7complement(1761450..1761746) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_01784; phage(gi116222045) 3e-52 Click
8complement(1761801..1763045) PHAGE_Stx2_c_1717: transposase; PP_01785; phage(gi209447153) 1e-113 Click
9complement(1763076..1763372) PHAGE_Stx2_c_1717: transposase; PP_01786; phage(gi209447152) 1e-30 Click
10complement(1763423..1763785) PHAGE_Stx2_c_1717: truncated transposase; PP_01787; phage(gi209447151) 2e-10 Click
111764168..1764653 PHAGE_Stx2_c_1717: transposase; PP_01788; phage(gi209447153) 6e-25 Click

Region 10, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11768598..1768610 attL    TTGCGGAGGCTTG 0.0 Click
21779575..1779739 PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; PP_01812; phage(gi418487059) 2e-24 Click
3complement(1780202..1781083) PHAGE_Entero_N15: gp8; PP_01813; phage(gi9630472) 1e-145 Click
4complement(1781139..1781471) PHAGE_Entero_N15: gp7; PP_01814; phage(gi9630471) 4e-38 Click
5complement(1781481..1782800) PHAGE_Entero_N15: gp5; PP_01815; phage(gi9630469) 0.0 Click
6complement(1782781..1784157) PHAGE_Entero_N15: gp4; PP_01816; phage(gi9630468) 0.0 Click
71784152..1784532 hypothetical protein EC55989_1022 [Escherichia coli 55989] gi|218694448|ref|YP_002402115.1|; PP_01817 4e-68 Click
81784627..1784902 PHAGE_Salmon_ST64B: Integrase protein; PP_01818; phage(gi23505472) 5e-13 Click
91784938..1785516 PHAGE_Salmon_ST64B: Integrase protein; PP_01819; phage(gi23505472) 1e-53 Click
101785924..1786583 PHAGE_Camelp_virus: CMLV006; PP_01820; phage(gi18640240) 3e-12 Click
111797003..1797015 attR    TTGCGGAGGCTTG 0.0 Click

Region 11, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2053077..2053412) PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; PP_02080; phage(gi311992758) 3e-06 Click
2complement(2053480..2053782) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; PP_02081; phage(gi20065923) 6e-44 Click
3complement(2053850..2054092) hypothetical protein G2583_3670 [Escherichia coli O55:H7 str. CB9615] gi|291284327|ref|YP_003501145.1|; PP_02082 4e-35 Click
4complement(2054181..2054429) phage protein [Escherichia coli SE15] gi|387829945|ref|YP_003349882.1|; PP_02083 4e-42 Click
5complement(2054623..2054844) hypothetical protein i02_2331 [Escherichia coli str. 'clone D i2'] gi|386629795|ref|YP_006149515.1|; PP_02084 1e-36 Click
62054846..2055397 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_02085; phage(gi16129505) 5e-91 Click
7complement(2055441..2056013) serine acetlyltransferase of prophage CP-933T [Escherichia coli O157:H7 str. EDL933] gi|15802336|ref|NP_288362.1|; PP_02086 1e-107 Click
8complement(2056170..2056658) PHAGE_Entero_PsP3: gp25; PP_02087; phage(gi41057377) 2e-32 Click
9complement(2056671..2057372) tail fiber protein of prophage CP-933T [Escherichia coli O157:H7 str. EDL933] gi|15802338|ref|NP_288364.1|; PP_02088 7e-128 Click
10complement(2057384..2059474) PHAGE_Entero_PsP3: gp24; PP_02089; phage(gi41057376) 7e-90 Click
11complement(2059461..2059589) PHAGE_Entero_PsP3: gp23.5; PP_02090; phage(gi41057394) 8e-06 Click
12complement(2059625..2059990) PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_02091; phage(gi29143760) 2e-06 Click
13complement(2060045..2060557) PHAGE_Entero_PsP3: gp22; PP_02092; phage(gi41057374) 2e-32 Click
14complement(2060557..2061741) PHAGE_Erwini_ENT90: tail sheath protein; PP_02093; phage(gi431810939) 7e-101 Click
152061721..2061852 hypothetical; PP_02094 0.0 Click
162061899..2062222 PHAGE_Entero_PsP3: gp26; PP_02095; phage(gi41057378) 1e-14 Click
17complement(2062668..2062811) hypothetical protein ECIAI1_3761 [Escherichia coli IAI1] gi|218556155|ref|YP_002389068.1|; PP_02096 3e-20 Click
182062810..2063418 glutathione S-transferase [Escherichia coli O55:H7 str. CB9615] gi|291284963|ref|YP_003501781.1|; PP_02097 1e-110 Click
192063516..2064907 selenocysteine synthase [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253771570|ref|YP_003034401.1|; PP_02098 0.0 Click
202064904..2066748 PHAGE_Cafete_BV_PW1: putative eIF-2gamma; PP_02099; phage(gi310831469) 3e-14 Click

Region 12, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12167214..2167227 attL    GCCATTTACCCGCT 0.0 Click
2complement(2173777..2182152) PHAGE_Stx1_converting: hypothetical protein Stx1_gp23; PP_02198; phage(gi302861144) 0.0 Click
3complement(2182221..2183486) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02199; phage(gi418487119) 0.0 Click
4complement(2183497..2183790) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02200; phage(gi418487118) 2e-32 Click
5complement(2183800..2184246) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02201; phage(gi418487117) 8e-79 Click
6complement(2184249..2184905) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip042; PP_02202; phage(gi20065838) 8e-121 Click
7complement(2185000..2185377) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02203; phage(gi418487115) 1e-68 Click
8complement(2185458..2185598) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02204; phage(gi418487114) 5e-11 Click
9complement(2185829..2186563) PHAGE_Escher_TL_2011c: outer membrane protein Lom precursor; PP_02205; phage(gi418487075) 8e-139 Click
10complement(2186654..2187271) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02206; phage(gi418487113) 4e-122 Click
11complement(2187277..2187555) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; PP_02207; phage(gi302393094) 1e-50 Click
12complement(2187570..2188838) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02208; phage(gi418487112) 0.0 Click
13complement(2188835..2190460) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02209; phage(gi418487111) 0.0 Click
14complement(2190575..2190688) hypothetical; PP_02210 0.0 Click
15complement(2190755..2190943) PHAGE_Escher_TL_2011c: hypothetical protein; PP_02211; phage(gi418487110) 4e-31 Click
16complement(2191121..2192374) PROPHAGE_Escher_Sakai: putative integrase; PP_02212; phage(gi15833788) 0.0 Click
172197917..2197930 attR    GCCATTTACCCGCT 0.0 Click

Region 13, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3019258..3020163) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; PP_03008; phage(gi16130763) 6e-177 Click
2complement(3020121..3020258) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; PP_03009; phage(gi17546153) 3e-15 Click
3complement(3020325..3020486) PROPHAGE_Escher_CFT073: transposase insC; PP_03010; phage(gi26250372) 4e-24 Click
4complement(3020575..3021651) PROPHAGE_Escher_Sakai: putative portal protein; PP_03011; phage(gi15832215) 0.0 Click
5complement(3021651..3021851) PHAGE_Entero_mEp460: hypothetical protein; PP_03012; phage(gi428782319) 2e-14 Click
63022047..3022256 hypothetical protein ECO26_2275 [Escherichia coli O26:H11 str. 11368] gi|260855375|ref|YP_003229266.1|; PP_03013 3e-32 Click
7complement(3022257..3022895) PHAGE_Escher_TL_2011c: hypothetical protein; PP_03014; phage(gi418487085) 6e-09 Click
8complement(3022907..3023140) PHAGE_Salico_CGphi29: hypothetical protein; PP_03015; phage(gi472340166) 5e-09 Click
9complement(3023352..3023990) PHAGE_Pectob_ZF40: putative cI repressor; PP_03016; phage(gi422936650) 2e-18 Click
103024308..3024541 hypothetical protein ECS88_1338 [Escherichia coli S88] gi|218558197|ref|YP_002391110.1|; PP_03017 3e-35 Click
113024687..3025217 late gene regulator Q [Escherichia coli O26:H11 str. 11368] gi|260854360|ref|YP_003228251.1|; PP_03018 2e-100 Click
123025459..3025656 PHAGE_Entero_phiP27: hypothetical protein P27p23; PP_03019; phage(gi18249887) 2e-28 Click
13complement(3025876..3025989) hypothetical; PP_03020 0.0 Click
14complement(3026318..3026758) PHAGE_Entero_HK630: terminase large subunit A; PP_03021; phage(gi428782789) 8e-62 Click
15complement(3026913..3027458) PHAGE_Entero_HK630: terminase small subunit nu1; PP_03022; phage(gi428782788) 2e-82 Click
16complement(3027696..3027947) PHAGE_Entero_mEp234: hypothetical protein; PP_03023; phage(gi428782288) 2e-44 Click
17complement(3029007..3029387) PHAGE_Entero_2008: hypothetical protein YYZ_gp25; PP_03024; phage(gi209427750) 8e-67 Click
183029827..3029973 hypothetical; PP_03025 0.0 Click
19complement(3030030..3030683) PHAGE_Entero_2008: putative bacteriophage CI repressor; PP_03026; phage(gi209427751) 2e-126 Click
20complement(3031274..3031396) hypothetical; PP_03027 0.0 Click
213031635..3032456 PHAGE_Entero_2008: DNA replication protein; PP_03028; phage(gi209427753) 1e-155 Click
223032453..3033829 PHAGE_Entero_2008: Gp55-like protein; PP_03029; phage(gi209427754) 0.0 Click
233033900..3034178 PHAGE_Entero_2008: hypothetical protein YYZ_gp30; PP_03030; phage(gi209427755) 5e-51 Click
24complement(3034339..3034506) hypothetical; PP_03031 0.0 Click
25complement(3034547..3035269) PHAGE_Stx2_c_86: DNA-binding protein Roi; PP_03032; phage(gi116222069) 3e-132 Click

Region 14, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13449167..3449178 attL    TGATTTTATTAA 0.0 Click
2complement(3449239..3450240) PHAGE_Haemop_HP2: integrase; PP_03459; phage(gi17981816) 3e-105 Click
3complement(3450246..3450428) hypothetical protein ECO26_2759 [Escherichia coli O26:H11 str. 11368] gi|260855847|ref|YP_003229738.1|; PP_03460 9e-29 Click
4complement(3450623..3451273) hypothetical protein ECSP_2484 [Escherichia coli O157:H7 str. TW14359] gi|254793534|ref|YP_003078371.1|; PP_03461 4e-119 Click
5complement(3451289..3451426) phage repressor protein [Escherichia coli O26:H11 str. 11368] gi|260855849|ref|YP_003229740.1|; PP_03462 9e-18 Click
63451992..3452195 PHAGE_Haemop_HP2: orf2(S)cox; PP_03463; phage(gi17981819) 2e-09 Click
73452217..3452567 hypothetical protein ECSP_2487 [Escherichia coli O157:H7 str. TW14359] gi|254793537|ref|YP_003078374.1|; PP_03464 5e-64 Click
83452578..3452856 hypothetical protein ECSP_2488 [Escherichia coli O157:H7 str. TW14359] gi|254793538|ref|YP_003078375.1|; PP_03465 5e-45 Click
93452868..3453110 hypothetical protein ECSP_2489 [Escherichia coli O157:H7 str. TW14359] gi|254793539|ref|YP_003078376.1|; PP_03466 5e-39 Click
103453107..3453220 prophage membrane protein [Citrobacter rodentium ICC168] gi|283785691|ref|YP_003365556.1|; PP_03467 2e-11 Click
113453313..3453729 hypothetical protein ECSP_2490 [Escherichia coli O157:H7 str. TW14359] gi|254793540|ref|YP_003078377.1|; PP_03468 1e-69 Click
123453753..3453956 hypothetical protein G2583_2117 [Escherichia coli O55:H7 str. CB9615] gi|291282850|ref|YP_003499668.1|; PP_03469 3e-32 Click
133453953..3454219 hypothetical protein ECO103_1866 [Escherichia coli O103:H2 str. 12009] gi|260844027|ref|YP_003221805.1|; PP_03470 4e-45 Click
143454216..3454515 PHAGE_Entero_mEp213: hypothetical protein; PP_03471; phage(gi428782624) 9e-08 Click
153454838..3455068 hypothetical protein Z2976 [Escherichia coli O157:H7 str. EDL933] gi|15802328|ref|NP_288354.1|; PP_03472 7e-36 Click
163455141..3455506 hypothetical protein ECSP_2493 [Escherichia coli O157:H7 str. TW14359] gi|254793543|ref|YP_003078380.1|; PP_03473 4e-63 Click
173455513..3458335 PHAGE_Salmon_RE_2010: replication protein; PP_03474; phage(gi418489692) 2e-170 Click
183458412..3459371 stability/partitioning protein encoded within prophage CP-933T [Escherichia coli O157:H7 str. TW14359] gi|254793545|ref|YP_003078382.1|; PP_03475 0.0 Click
193459805..3460479 PHAGE_Stx2_c_1717: truncated transposase; PP_03476; phage(gi209447151) 3e-09 Click
203460476..3460823 PHAGE_Stx2_c_1717: transposase; PP_03477; phage(gi209447152) 4e-42 Click
213460843..3462045 PHAGE_Stx2_c_1717: transposase; PP_03478; phage(gi209447153) 9e-118 Click
22complement(3462092..3462967) DNA helicase II [Escherichia coli O55:H7 str. CB9615] gi|291284293|ref|YP_003501111.1|; PP_03479 5e-168 Click
23complement(3463145..3463678) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_03480; phage(gi148609401) 4e-18 Click
24complement(3464266..3464442) hypothetical protein G2583_3634 [Escherichia coli O55:H7 str. CB9615] gi|291284295|ref|YP_003501113.1|; PP_03481 1e-24 Click
25complement(3464752..3464871) hypothetical protein ECSP_3948 [Escherichia coli O157:H7 str. TW14359] gi|254794928|ref|YP_003079765.1|; PP_03482 5e-16 Click
263464995..3465885 PROPHAGE_Escher_EDL933: putative transposase; PP_03483; phage(gi15803516) 2e-147 Click
273473668..3473679 attR    TGATTTTATTAA 0.0 Click

Region 15, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13611242..3611257 attL    CAAAAAAAGCCCCTCA 0.0 Click
2complement(3611281..3611535) PHAGE_Yersin_413C: Ogr; PP_03618; phage(gi30065732) 2e-45 Click
3complement(3611581..3612744) PHAGE_Yersin_413C: gpD; PP_03619; phage(gi30065731) 0.0 Click
4complement(3612744..3613223) PHAGE_Yersin_413C: gpU; PP_03620; phage(gi30065730) 4e-85 Click
5complement(3613238..3615685) PHAGE_Yersin_413C: gpT; PP_03621; phage(gi30065729) 0.0 Click
6complement(3615678..3615833) PHAGE_Yersin_413C: gpE+E'; PP_03622; phage(gi30065728) 9e-24 Click
7complement(3615830..3616105) PHAGE_Yersin_413C: gpE; PP_03623; phage(gi30065727) 3e-44 Click
8complement(3616162..3616680) PHAGE_Yersin_413C: FII; PP_03624; phage(gi30065726) 6e-93 Click
9complement(3616693..3617883) PHAGE_Yersin_413C: gpFI; PP_03625; phage(gi30065725) 0.0 Click
10complement(3617943..3619121) PHAGE_Entero_2: DNA-invertase; PP_03626; phage(gi169936026) 3e-87 Click
11complement(3619360..3620265) PHAGE_Entero_HK630: tail fiber J; PP_03627; phage(gi428782808) 1e-155 Click
123620290..3620559 putative excisionase for prophage [Escherichia coli str. 'clone D i2'] gi|386628767|ref|YP_006148487.1|; PP_03628 3e-46 Click
133620528..3621646 PHAGE_Entero_mEp235: integrase; PP_03629; phage(gi428781836) 3e-52 Click
143635953..3635968 attR    CAAAAAAAGCCCCTCA 0.0 Click

Region 16, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13912974..3912986 attL    AGACCCGCAGCAA 0.0 Click
2complement(3923118..3924134) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; PP_03927; phage(gi15832203) 5e-44 Click
3complement(3924178..3924462) PROPHAGE_Escher_Sakai: putative minor tail protein; PP_03928; phage(gi15832204) 4e-52 Click
4complement(3924594..3925283) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_03929; phage(gi169257244) 3e-81 Click
53925758..3926717 systemic factor protein A [Escherichia coli O26:H11 str. 11368] gi|260854026|ref|YP_003227917.1|; PP_03930 0.0 Click
63926862..3927386 PHAGE_Entero_phiV10: hypothetical protein PhiV10p53; PP_03931; phage(gi89152467) 2e-20 Click
73927346..3927561 PHAGE_Entero_phiV10: hypothetical protein PhiV10p52; PP_03932; phage(gi89152466) 7e-37 Click
83927563..3927781 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; PP_03933; phage(gi20065885) 4e-36 Click
93927783..3928070 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip089; PP_03934; phage(gi20065884) 1e-51 Click
103928074..3928691 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip087; PP_03935; phage(gi20065882) 4e-119 Click
113929331..3929954 PHAGE_Stx2_c_86: phage anti-repressor protein AntB; PP_03936; phage(gi116222034) 2e-115 Click
123929997..3930164 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp41; PP_03937; phage(gi116222033) 9e-29 Click
133930391..3931017 PHAGE_Stx2_c_86: adenine methylase; PP_03938; phage(gi116222031) 3e-120 Click
143930977..3931189 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp50; PP_03939; phage(gi116222042) 2e-09 Click
153931225..3931602 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; PP_03940; phage(gi116222030) 1e-63 Click
163931681..3931863 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; PP_03941; phage(gi116222029) 4e-29 Click
17complement(3931847..3933016) PHAGE_Stx2_c_86: integrase; PP_03942; phage(gi116222028) 0.0 Click
183937668..3937680 attR    AGACCCGCAGCAA 0.0 Click

Region 17, total : 69 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14045888..4046100 PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p19b; PP_04077; phage(gi45862228) 9e-08 Click
2complement(4046097..4047497) PHAGE_Entero_HK630: minor tail protein L; PP_04078; phage(gi428782805) 8e-51 Click
3complement(4047497..4047826) PHAGE_Entero_HK630: minor tail protein M; PP_04079; phage(gi428782804) 1e-56 Click
4complement(4047823..4050372) PHAGE_Entero_HK630: tail length tape measure protein H; PP_04080; phage(gi428782803) 0.0 Click
5complement(4050365..4050799) PHAGE_Entero_HK630: tail assembly protein GT; PP_04081; phage(gi428782802) 4e-81 Click
6complement(4050781..4051203) PHAGE_Entero_HK630: minor tail protein G; PP_04082; phage(gi428782801) 2e-73 Click
7complement(4051219..4051959) PHAGE_Entero_HK630: major tail protein V; PP_04083; phage(gi428782800) 3e-133 Click
8complement(4051967..4052362) PHAGE_Entero_HK630: minor tail protein U; PP_04084; phage(gi428782799) 2e-72 Click
9complement(4052359..4052937) PHAGE_Entero_HK630: minor tail protein Z; PP_04085; phage(gi428782798) 6e-101 Click
10complement(4052949..4053686) PHAGE_Entero_mEp460: host specificity protein; PP_04086; phage(gi428782334) 2e-86 Click
11complement(4053747..4054259) PHAGE_Entero_mEp460: tail assembly protein; PP_04087; phage(gi428782333) 6e-87 Click
124054506..4054862 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; PP_04088; phage(gi20065868) 1e-07 Click
134054911..4055123 hypothetical protein ECSP_1731 [Escherichia coli O157:H7 str. TW14359] gi|254792802|ref|YP_003077639.1|; PP_04089 4e-37 Click
144055159..4055323 hypothetical protein ECSP_1732 [Escherichia coli O157:H7 str. TW14359] gi|254792803|ref|YP_003077640.1|; PP_04090 9e-12 Click
154055445..4055711 50S ribosomal protein L31 [Escherichia coli str. 'clone D i2'] gi|386627887|ref|YP_006147607.1|; PP_04091 8e-45 Click
164055711..4055851 50S ribosomal protein L36 [Escherichia coli str. 'clone D i2'] gi|386627886|ref|YP_006147606.1|; PP_04092 3e-19 Click
174055994..4056006 attL    GAATATTCCATTA 0.0 Click
184056889..4057479 regulator [Escherichia coli O157:H7 str. TW14359] gi|254791453|ref|YP_003076290.1|; PP_04093 8e-109 Click
194057554..4058141 common pilus [Escherichia coli W] gi|386607663|ref|YP_006123149.1|; PP_04094 1e-104 Click
204058199..4058867 hypothetical protein G2583_0384 [Escherichia coli O55:H7 str. CB9615] gi|291281185|ref|YP_003498003.1|; PP_04095 7e-122 Click
214058893..4061418 PHAGE_Acanth_moumouvirus: putative low complexity protein; PP_04096; phage(gi441432350) 8e-05 Click
224061408..4063051 receptor [Escherichia coli O55:H7 str. CB9615] gi|291281183|ref|YP_003498001.1|; PP_04097 0.0 Click
234063074..4063730 chaperone [Escherichia coli O157:H7 str. TW14359] gi|254791448|ref|YP_003076285.1|; PP_04098 5e-124 Click
24complement(4064620..4065234) hypothetical protein ECBD_3370 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253774724|ref|YP_003037555.1|; PP_04099 4e-119 Click
254065652..4066341 xanthine dehydrogenase yagT iron-sulfur-binding subunit precursor [Escherichia coli O55:H7 str. CB9615] gi|291281179|ref|YP_003497997.1|; PP_04100 3e-129 Click
264066338..4067294 oxidoreductase [Escherichia coli O157:H7 str. TW14359] gi|254791444|ref|YP_003076281.1|; PP_04101 1e-177 Click
274067291..4069489 oxidoreductase [Escherichia coli O157:H7 str. TW14359] gi|254791443|ref|YP_003076280.1|; PP_04102 0.0 Click
284069499..4070455 hypothetical protein ECSP_0320 [Escherichia coli O157:H7 str. TW14359] gi|254791442|ref|YP_003076279.1|; PP_04103 0.0 Click
29complement(4070634..4071761) transcriptional regulator [Escherichia coli O157:H7 str. TW14359] gi|254791441|ref|YP_003076278.1|; PP_04104 0.0 Click
30complement(4071903..4073039) hydrolase of the alpha/beta superfamily [Escherichia coli O55:H7 str. CB9615] gi|291281175|ref|YP_003497993.1|; PP_04105 0.0 Click
314073225..4074109 PHAGE_Burkho_phi1026b: gp58; PP_04106; phage(gi38707948) 2e-09 Click
32complement(4074388..4074537) hypothetical protein G2583_0371 [Escherichia coli O55:H7 str. CB9615] gi|291281173|ref|YP_003497991.1|; PP_04107 3e-19 Click
33complement(4074812..4075090) hypothetical protein G2583_0370 [Escherichia coli O55:H7 str. CB9615] gi|291281172|ref|YP_003497990.1|; PP_04108 2e-41 Click
34complement(4075257..4075979) PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; PP_04109; phage(gi116326757) 9e-07 Click
354076078..4076977 PHAGE_Burkho_phi1026b: gp58; PP_04110; phage(gi38707948) 6e-19 Click
364077653..4078609 hypothetical protein ECSP_0312 [Escherichia coli O157:H7 str. TW14359] gi|254791434|ref|YP_003076271.1|; PP_04111 0.0 Click
37complement(4078742..4081075) PHAGE_Entero_P4: DNA primase; PP_04112; phage(gi9627512) 0.0 Click
38complement(4081089..4081412) PHAGE_Entero_P4: hypothetical protein P4p07; PP_04113; phage(gi9627513) 1e-35 Click
39complement(4081412..4081633) hypothetical protein G2583_0364 [Escherichia coli O55:H7 str. CB9615] gi|291281166|ref|YP_003497984.1|; PP_04114 1e-35 Click
40complement(4081630..4082187) PHAGE_Entero_P4: putative CI repressor; PP_04115; phage(gi9627516) 3e-35 Click
41complement(4082184..4082444) PHAGE_Entero_P4: transcriptional regulator; PP_04116; phage(gi9627517) 8e-25 Click
424083377..4084129 PHAGE_Entero_P4: head size determination protein sid; PP_04117; phage(gi9627518) 2e-09 Click
434084126..4084677 PHAGE_Entero_P4: amber mutation-suppressing protein; PP_04118; phage(gi9627520) 1e-11 Click
444084683..4084955 PHAGE_Yersin_413C: Ogr; PP_04119; phage(gi30065732) 1e-08 Click
45complement(4085365..4085931) hypothetical protein ECSP_0303 [Escherichia coli O157:H7 str. TW14359] gi|254791425|ref|YP_003076262.1|; PP_04120 3e-105 Click
46complement(4085931..4086134) hypothetical protein Z0330 [Escherichia coli O157:H7 str. EDL933] gi|15799969|ref|NP_285981.1|; PP_04121 1e-30 Click
47complement(4086131..4086520) hypothetical protein ECSP_0302 [Escherichia coli O157:H7 str. TW14359] gi|254791424|ref|YP_003076261.1|; PP_04122 3e-67 Click
48complement(4087176..4087292) hypothetical protein G2583_0354 [Escherichia coli O55:H7 str. CB9615] gi|291281157|ref|YP_003497975.1|; PP_04123 2e-14 Click
49complement(4087634..4088251) hypothetical protein Z0326 [Escherichia coli O157:H7 str. EDL933] gi|15799966|ref|NP_285978.1|; PP_04124 5e-117 Click
50complement(4088644..4089888) PHAGE_Entero_4795: putative tail fiber component; PP_04125; phage(gi157166055) 5e-102 Click
51complement(4089885..4090121) PHAGE_Entero_HK630: portal protein B; PP_04126; phage(gi428782791) 3e-37 Click
52complement(4090118..4090324) PHAGE_Entero_HK630: head-tail connector W; PP_04127; phage(gi428782790) 1e-31 Click
53complement(4090321..4090674) PHAGE_Entero_HK630: terminase large subunit A; PP_04128; phage(gi428782789) 2e-43 Click
54complement(4091250..4091420) hypothetical protein ECO26_2665 [Escherichia coli O26:H11 str. 11368] gi|260855753|ref|YP_003229644.1|; PP_04129 1e-24 Click
55complement(4091462..4091680) repressor protein encoded by cryptic prophage CP-933P [Escherichia coli O157:H7 str. TW14359] gi|254793187|ref|YP_003078024.1|; PP_04130 1e-34 Click
564092230..4092415 hypothetical protein CE10_1445 [Escherichia coli O7:K1 str. CE10] gi|386623811|ref|YP_006143539.1|; PP_04131 3e-26 Click
574092513..4093400 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_04132; phage(gi18249881) 3e-26 Click
584093407..4094147 PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_04133; phage(gi169257280) 8e-77 Click
594094173..4094352 hypothetical protein Z6068 [Escherichia coli O157:H7 str. EDL933] gi|15801981|ref|NP_288002.1|; PP_04134 1e-25 Click
60complement(4094579..4095298) PHAGE_Stx2_c_1717: putative tail fiber component J; PP_04135; phage(gi209447196) 3e-111 Click
614095340..4095525 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_04136; phage(gi209427772) 8e-19 Click
62complement(4095655..4095795) hypothetical protein ECS88_0566 [Escherichia coli S88] gi|218557476|ref|YP_002390389.1|; PP_04137 2e-18 Click
63complement(4095882..4096004) hypothetical protein ECSP_1456 [Escherichia coli O157:H7 str. TW14359] gi|254792537|ref|YP_003077374.1|; PP_04138 8e-16 Click
64complement(4096152..4096376) hypothetical protein ECO26_1493 [Escherichia coli O26:H11 str. 11368] gi|260854643|ref|YP_003228534.1|; PP_04139 2e-35 Click
65complement(4096400..4096843) PHAGE_Escher_HK75: phage tail protein; PP_04140; phage(gi356870689) 3e-25 Click
66complement(4096867..4097151) PHAGE_Stx2_c_1717: putative tail assembly chaperone; PP_04141; phage(gi209447188) 4e-49 Click
67complement(4097756..4097977) type III secretion apparatus needle protein [Escherichia coli O55:H7 str. CB9615] gi|291285040|ref|YP_003501858.1|; PP_04142 8e-33 Click
68complement(4098013..4098420) hypothetical protein G2583_4408 [Escherichia coli O55:H7 str. CB9615] gi|291285041|ref|YP_003501859.1|; PP_04143 9e-74 Click
69complement(4098427..4099365) PHAGE_Lactob_1: putative tail fibre protein; PP_04144; phage(gi226377752) 1e-07 Click
70complement(4099386..4100510) PHAGE_Strept_Sfi11: putative minor tail protein; PP_04145; phage(gi9635024) 3e-05 Click
714102242..4102254 attR    GAATATTCCATTA 0.0 Click

Region 18, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14258563..4258574 attL    ATGGATTAATAA 0.0 Click
24263794..4264162 PHAGE_Entero_mEp460: hypothetical protein; PP_04306; phage(gi428782365) 7e-27 Click
3complement(4264113..4264244) hypothetical; PP_04307 0.0 Click
44264243..4264386 PHAGE_Entero_mEp237: terminase small subunit nu1; PP_04308; phage(gi435439266) 9e-05 Click
54264439..4264642 PHAGE_Entero_HK630: terminase large subunit A; PP_04309; phage(gi428782789) 4e-22 Click
64264734..4266287 PHAGE_Entero_HK630: terminase large subunit A; PP_04310; phage(gi428782789) 0.0 Click
74266271..4266477 PHAGE_Entero_HK630: head-tail connector W; PP_04311; phage(gi428782790) 1e-11 Click
84266474..4268066 PHAGE_Entero_HK630: portal protein B; PP_04312; phage(gi428782791) 0.0 Click
94268056..4269561 PHAGE_Entero_HK630: head maturation protease C; PP_04313; phage(gi428782792) 4e-108 Click
104269598..4269945 PHAGE_Entero_HK630: head decoration protein D; PP_04314; phage(gi428782794) 6e-25 Click
114270003..4270269 PHAGE_Entero_HK630: major head subunit E; PP_04315; phage(gi428782795) 2e-20 Click
124270329..4271138 PHAGE_Entero_HK630: major tail protein V; PP_04316; phage(gi428782800) 3e-92 Click
13complement(4271296..4271622) PHAGE_Entero_mEp213: hypothetical protein; PP_04317; phage(gi428782595) 1e-32 Click
14complement(4271710..4273665) PHAGE_Entero_mEp213: head maturation protease; PP_04318; phage(gi428782594) 0.0 Click
15complement(4273679..4273924) PROPHAGE_Escher_Sakai: putative portal protein; PP_04319; phage(gi15832215) 9e-27 Click
16complement(4274502..4276529) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip149; PP_04320; phage(gi20065944) 1e-62 Click
17complement(4276778..4277137) PHAGE_Stx2_c_1717: transposase; PP_04321; phage(gi209447153) 2e-43 Click
184277493..4278080 PHAGE_Stx2_c_1717: putative Ant antirepressor protein; PP_04322; phage(gi209447161) 9e-56 Click
194278077..4278451 PHAGE_Entero_HK022: hypothetical protein HK022p33; PP_04323; phage(gi19343382) 3e-52 Click
20complement(4279176..4279949) hypothetical protein ECSP_1096 [Escherichia coli O157:H7 str. TW14359] gi|254792189|ref|YP_003077026.1|; PP_04324 2e-149 Click
214279991..4280152 hypothetical protein ECO26_1119 [Escherichia coli O26:H11 str. 11368] gi|260854284|ref|YP_003228175.1|; PP_04325 1e-22 Click
22complement(4280166..4281215) PHAGE_Entero_HK630: tail length tape measure protein H; PP_04326; phage(gi428782803) 8e-123 Click
234281187..4282479 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; PP_04327; phage(gi302861197) 7e-180 Click
244282627..4282809 PHAGE_Escher_P13374: hypothetical protein; PP_04328; phage(gi410491643) 3e-18 Click
254282847..4283116 PHAGE_Escher_P13374: hypothetical protein; PP_04329; phage(gi410491644) 1e-26 Click
264283185..4283712 hypothetical protein ECO26_1264 [Escherichia coli O26:H11 str. 11368] gi|260854424|ref|YP_003228315.1|; PP_04330 2e-101 Click
274283867..4286227 PHAGE_Parame_AR158: hypothetical protein AR158_C191R; PP_04331; phage(gi157953382) 5e-35 Click
284286370..4286383 attL    CGTCATCAAAAATA 0.0 Click
29complement(4286389..4286565) hypothetical protein ECSP_1237 [Escherichia coli O157:H7 str. TW14359] gi|254792323|ref|YP_003077160.1|; PP_04332 5e-27 Click
30complement(4286562..4287392) PHAGE_Entero_4795: putative large subunit terminase; PP_04333; phage(gi157166040) 8e-130 Click
31complement(4287389..4287952) PHAGE_Entero_4795: putative small subunit terminase; PP_04334; phage(gi157166039) 2e-102 Click
32complement(4288308..4288457) hypothetical protein SSON53_14335 [Shigella sonnei 53G] gi|383179378|ref|YP_005457383.1|; PP_04335 3e-22 Click
33complement(4288729..4288851) hypothetical protein EC55989_0757 [Escherichia coli 55989] gi|218694192|ref|YP_002401859.1|; PP_04336 2e-15 Click
344289556..4290626 PHAGE_Entero_HK630: integrase; PP_04337; phage(gi428782814) 0.0 Click
354290761..4292044 Pectinesterase [Escherichia coli O55:H7 str. CB9615] gi|291281708|ref|YP_003498526.1|; PP_04338 0.0 Click
36complement(4292185..4294446) hypothetical protein ECSP_0824 [Escherichia coli O157:H7 str. TW14359] gi|254791922|ref|YP_003076759.1|; PP_04339 0.0 Click
37complement(4295045..4296151) PHAGE_Entero_HK630: tail fiber J; PP_04340; phage(gi428782808) 0.0 Click
38complement(4296213..4296404) PROPHAGE_Escher_Sakai: putative tail assembly protein; PP_04342; phage(gi15832200) 8e-25 Click
394296362..4296874 hypothetical protein c1463 [Escherichia coli CFT073] gi|26247332|ref|NP_753372.1|; PP_04341 1e-16 Click
40complement(4297051..4297473) hypothetical protein ECSP_4869 [Escherichia coli O157:H7 str. TW14359] gi|254795813|ref|YP_003080650.1|; PP_04343 2e-83 Click
41complement(4297539..4298387) hypothetical protein ECSP_4870 [Escherichia coli O157:H7 str. TW14359] gi|254795814|ref|YP_003080651.1|; PP_04344 1e-162 Click
424298523..4298645 hypothetical protein G2583_4616 [Escherichia coli O55:H7 str. CB9615] gi|291285233|ref|YP_003502051.1|; PP_04345 1e-06 Click
434298690..4298809 hypothetical; PP_04346 0.0 Click
44complement(4300071..4300427) PHAGE_Entero_HK630: cell lysis protein Rz; PP_04347; phage(gi428782852) 5e-59 Click
45complement(4300424..4300900) PHAGE_Escher_HK75: lysozyme; PP_04348; phage(gi356870730) 6e-85 Click
46complement(4300887..4301204) PHAGE_Salmon_ST160: Gp13; PP_04349; phage(gi318065943) 1e-39 Click
47complement(4301514..4302203) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_04350; phage(gi169257244) 4e-84 Click
48complement(4302200..4302340) PHAGE_Entero_mEp237: hypothetical protein; PP_04351; phage(gi435439319) 4e-12 Click
49complement(4302337..4302513) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_04352; phage(gi435439318) 4e-24 Click
50complement(4302534..4303196) PHAGE_Entero_HK630: tail fiber assembly protein; PP_04353; phage(gi428782810) 2e-18 Click
51complement(4303196..4303561) PHAGE_Entero_mEp213: tail fiber; PP_04354; phage(gi428782611) 3e-63 Click
524303818..4304054 PHAGE_Gifsy_2: bacteriophage excisionase; PP_04355; phage(gi169257269) 8e-17 Click
534304089..4304244 PHAGE_Gifsy_2: bacteriophage integrase; PP_04356; phage(gi169257268) 1e-09 Click
544304405..4304418 attR    CGTCATCAAAAATA 0.0 Click
554304574..4304780 PHAGE_Entero_phiP27: putative integrase; PP_04357; phage(gi18249865) 2e-19 Click
56complement(4305043..4305369) hypothetical protein ECSP_2146 [Escherichia coli O157:H7 str. TW14359] gi|254793199|ref|YP_003078036.1|; PP_04358 6e-59 Click
574305504..4305845 hypothetical protein G2583_1977 [Escherichia coli O55:H7 str. CB9615] gi|291282715|ref|YP_003499533.1|; PP_04359 4e-60 Click
584305880..4306440 PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p012; PP_04360; phage(gi9630137) 1e-08 Click
594307657..4307668 attR    ATGGATTAATAA 0.0 Click

Region 19, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14505235..4505253 attL    AACGCCTTATCCGGCCTAC 0.0 Click
24517341..4518237 PHAGE_Thermu_26: phage XerD-like integrase; PP_04568; phage(gi157265417) 9e-18 Click
34518237..4518953 HAD-superfamily hydrolase [Escherichia coli O55:H7 str. CB9615] gi|291285226|ref|YP_003502044.1|; PP_04569 4e-135 Click
44519037..4521199 PHAGE_Bacill_36: PcrA helicase; PP_04570; phage(gi156564011) 1e-119 Click
5complement(4521244..4522146) hypothetical protein G2583_4611 [Escherichia coli O55:H7 str. CB9615] gi|291285228|ref|YP_003502046.1|; PP_04571 2e-170 Click
6complement(4522229..4522993) hypothetical protein ECW_m4115 [Escherichia coli W] gi|386611189|ref|YP_006126675.1|; PP_04572 1e-143 Click
74523006..4523119 hypothetical protein STBHUCCB_p1390 [Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12] gi|378962958|ref|YP_005202754.1|; PP_04573 7e-13 Click
84523363..4524292 magnesium/nickel/cobalt transporter CorA [Shigella sonnei Ss046] gi|74314329|ref|YP_312748.1|; PP_04574 1e-152 Click
9complement(4524616..4525191) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; PP_04575; phage(gi209427795) 3e-21 Click
10complement(4525313..4525963) PHAGE_Entero_2008: putative major head protein/prohead proteinase; PP_04576; phage(gi209427776) 2e-104 Click
114527013..4527729 hypothetical protein ECSP_1435 [Escherichia coli O157:H7 str. TW14359] gi|254792516|ref|YP_003077353.1|; PP_04577 1e-129 Click
124527789..4528043 hypothetical protein ECSP_1436 [Escherichia coli O157:H7 str. TW14359] gi|254792517|ref|YP_003077354.1|; PP_04578 2e-41 Click
134528046..4528342 PHAGE_Klebsi_phiKO2: Gp58; PP_04579; phage(gi46402144) 1e-26 Click
144528332..4528649 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; PP_04580; phage(gi302393109) 2e-44 Click
154528798..4528920 PHAGE_Salmon_E1: hypothetical protein VIP0051; PP_04581; phage(gi170676326) 1e-05 Click
164528907..4529344 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; PP_04582; phage(gi209427735) 1e-08 Click
174529346..4529537 PHAGE_Salmon_ST160: hypothetical protein; PP_04583; phage(gi318065908) 5e-27 Click
184529540..4529989 PHAGE_Entero_mEp460: hypothetical protein; PP_04584; phage(gi428782343) 1e-29 Click
19complement(4530177..4530641) PHAGE_Entero_2008: putative tail protein; PP_04585; phage(gi209427785) 6e-83 Click
20complement(4530843..4531220) acetyltransferase, GNAT family [Escherichia coli O55:H7 str. CB9615] gi|291281078|ref|YP_003497896.1|; PP_04586 1e-67 Click
21complement(4531305..4531703) PHAGE_Escher_HK639: hypothetical protein; PP_04587; phage(gi356870618) 2e-07 Click
22complement(4531706..4531999) antitoxin of the YafO-YafN toxin-antitoxin system [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253774743|ref|YP_003037574.1|; PP_04588 4e-48 Click
23complement(4532051..4533106) PHAGE_Bacill_SPBc2: IMPB/MUCB/SAMB family protein; PP_04589; phage(gi9630142) 9e-15 Click
24complement(4533177..4533947) motility protein [Escherichia coli O55:H7 str. CB9615] gi|291281074|ref|YP_003497892.1|; PP_04590 1e-139 Click
254533907..4535646 type III secretion protein, FHIPEP family [Escherichia coli O55:H7 str. CB9615] gi|291281073|ref|YP_003497891.1|; PP_04591 0.0 Click
264535701..4535719 attR    AACGCCTTATCCGGCCTAC 0.0 Click
27complement(4535757..4536212) PHAGE_Entero_mEp235: integrase; PP_04592; phage(gi428781836) 2e-20 Click

Region 20, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14990651..4990662 attL    AAAACAAAAAAA 0.0 Click
2complement(4990771..4991085) PROPHAGE_Escher_Sakai: putative integrase; PP_05041; phage(gi15833788) 3e-28 Click
34991926..4992279 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; PP_05042; phage(gi24111655) 1e-42 Click
4complement(4992321..4993064) AraC family transcriptional regulator [Escherichia coli O157:H7 str. TW14359] gi|254791418|ref|YP_003076255.1|; PP_05043 4e-137 Click
5complement(4993437..4994018) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; PP_05044; phage(gi302393084) 1e-94 Click
6complement(4994176..4996320) PHAGE_Stx2_c_II: portal protein; PP_05045; phage(gi302393083) 0.0 Click
7complement(4996320..4997981) PHAGE_Stx2_c_II: terminase, large subunit; PP_05046; phage(gi302393082) 0.0 Click
8complement(4998007..4998813) PHAGE_Stx2_c_II: terminase, small subunit; PP_05047; phage(gi302393081) 3e-151 Click
9complement(4998869..4999072) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; PP_05048; phage(gi20065959) 5e-36 Click
104999222..4999515 PHAGE_Stx2_c_II: Bor protein precursor; PP_05049; phage(gi302393169) 2e-50 Click
114999916..5000080 hypothetical protein ECSP_2662 [Escherichia coli O157:H7 str. TW14359] gi|254793699|ref|YP_003078536.1|; PP_05050 3e-24 Click
125000263..5001078 PROPHAGE_Escher_CFT073: transposase; PP_05051; phage(gi26246249) 5e-92 Click
13complement(5001103..5001240) hypothetical; PP_05052 0.0 Click
145001313..5002452 PHAGE_Stx2_c_1717: antiterminator Q protein; PP_05053; phage(gi209447165) 5e-90 Click
155006857..5006868 attR    AAAACAAAAAAA 0.0 Click