Escherichia coli O157:H7 str. EC4192 , whole genome [asmbl_id: NC_000000].5349693, GC%: 50.24%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(108621..109559) PHAGE_Acanth_1: hypothetical protein ATCV1_Z295L; PP_00123; phage(gi155371242) 8e-06 Click
2109793..109880 tRNA 0.0 Click
3complement(110030..110872) PHAGE_Aeromo_vB_AsaM_56: putative methylase; PP_00124; phage(gi422937523) 7e-12 Click
4complement(111066..113270) PHAGE_Salmon_SPN3UB: RecE; PP_00125; phage(gi423262421) 4e-41 Click
5complement(113363..113551) hypothetical protein CE10_1438 [Escherichia coli O7:K1 str. CE10] gi|386623804|ref|YP_006143532.1|; PP_00126 6e-24 Click
6complement(113548..113742) putative cell division inhibition protein [Escherichia coli O7:K1 str. CE10] gi|386623805|ref|YP_006143533.1|; PP_00127 4e-23 Click
7113747..113926 PHAGE_Stx2_c_II: exonuclease; PP_00128; phage(gi302393128) 9e-29 Click
8113898..114299 PHAGE_Entero_HK630: Bet protein; PP_00129; phage(gi428782823) 2e-33 Click
9complement(114612..114725) hypothetical; PP_00130 0.0 Click
10115454..115573 hypothetical; PP_00131 0.0 Click
11115599..115835 PHAGE_Stx2_c_86: DNA N-6-adenine methyltransferase Dam; PP_00132; phage(gi116222066) 9e-32 Click
12complement(115895..116065) PHAGE_Entero_lambda: NinF protein; PP_00133; phage(gi9626302) 5e-27 Click
13116318..116596 PHAGE_Entero_2008: hypothetical protein YYZ_gp30; PP_00134; phage(gi209427755) 5e-51 Click
14116766..116903 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip131; PP_00135; phage(gi20065926) 1e-19 Click
15complement(117031..117327) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_00136; phage(gi116222045) 3e-52 Click
16complement(117382..117531) PHAGE_Entero_lambda: host-killing protein; PP_00137; phage(gi9626283) 8e-17 Click
17117943..118197 hypothetical protein ECO26_2658 [Escherichia coli O26:H11 str. 11368] gi|260855747|ref|YP_003229638.1|; PP_00138 6e-40 Click
18118194..118421 PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; PP_00139; phage(gi169257161) 5e-16 Click
19118414..118725 PHAGE_Entero_mEp213: hypothetical protein; PP_00140; phage(gi428782634) 9e-21 Click
20119073..119630 PHAGE_Escher_TL_2011c: hypothetical protein; PP_00141; phage(gi418487081) 6e-28 Click
21120076..120447 PHAGE_Stx2_c_I: Ant protein; PP_00142; phage(gi20065954) 4e-67 Click
22complement(120539..120832) PHAGE_Entero_HK630: Bor protein; PP_00143; phage(gi428782854) 6e-50 Click
23complement(121124..121534) PHAGE_Entero_HK629: putative envelope protein; PP_00144; phage(gi428782079) 2e-74 Click
24121820..122026 PHAGE_Entero_HK630: hypothetical protein; PP_00145; phage(gi428782856) 1e-32 Click
25complement(122238..122462) PROPHAGE_Escher_EDL933: IS629 transposase; PP_00146; phage(gi15802480) 1e-22 Click
26122497..122679 adhesin-like autotransporter [Escherichia coli O157:H7 str. TW14359] gi|254794598|ref|YP_003079435.1|; PP_00147 7e-23 Click
27122765..123829 hemolysin activator protein [Escherichia coli O157:H7 str. TW14359] gi|254792391|ref|YP_003077228.1|; PP_00148 0.0 Click
28124070..124585 hypothetical protein Z1641 [Escherichia coli O157:H7 str. EDL933] gi|15801127|ref|NP_287144.1|; PP_00149 5e-98 Click
29124582..126750 PHAGE_Porcin_virus: Pol1; PP_00150; phage(gi19387582) 1e-08 Click

Region 2, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1410314..410808 PROPHAGE_Escher_MG1655: maturation protease for hydrogenase 2; PP_00443; phage(gi16130893) 2e-86 Click
2410801..411289 hydrogenase 2-specific chaperone [Escherichia coli O157:H7 str. TW14359] gi|254794949|ref|YP_003079786.1|; PP_00444 7e-90 Click
3411282..411422 hydrogenase nickel incorporation protein HybF [Shigella sonnei Ss046] gi|74313536|ref|YP_311955.1|; PP_00445 3e-18 Click
4411448..411624 hydrogenase nickel incorporation protein hybF [Escherichia coli O55:H7 str. CB9615] gi|291284374|ref|YP_003501192.1|; PP_00446 3e-29 Click
5411637..411885 hydrogenase 2 accessory protein HypG [Shigella sonnei Ss046] gi|74313535|ref|YP_311954.1|; PP_00447 2e-40 Click
6complement(412008..412874) glutathione S-transferase YghU [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253772172|ref|YP_003035003.1|; PP_00448 6e-171 Click
7413079..414938 PHAGE_Ralsto_RSL1: gsp gene product; PP_00449; phage(gi189426829) 9e-27 Click
8415230..416780 PHAGE_Bathyc_BpV1: hypothetical protein; PP_00450; phage(gi313768202) 1e-06 Click
9complement(416743..417114) PHAGE_Entero_2008: phage-related tail protein; PP_00451; phage(gi209427791) 1e-58 Click
10complement(417141..417320) PHAGE_Entero_HK629: tail length tape measure protein; PP_00452; phage(gi428782027) 8e-20 Click
11complement(417437..419038) PHAGE_Entero_HK629: tail length tape measure protein; PP_00453; phage(gi428782027) 0.0 Click
12complement(419019..419408) PHAGE_Entero_HK629: tail assembly protein; PP_00454; phage(gi428782026) 4e-43 Click
13complement(419459..419890) PHAGE_Entero_HK629: minor tail protein; PP_00455; phage(gi428782025) 5e-45 Click
14complement(419904..420152) PHAGE_Entero_HK629: major tail protein; PP_00456; phage(gi428782024) 6e-18 Click
15420265..420537 PHAGE_Stx2_c_1717: putative prophage portal protein; PP_00457; phage(gi209447183) 8e-46 Click
16420540..420746 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp61; PP_00458; phage(gi209447184) 6e-26 Click
17420828..421088 PHAGE_Entero_2008: putative tail protein; PP_00459; phage(gi209427785) 2e-40 Click
18421115..421243 PHAGE_Stx2_c_1717: tail tape measure protein; PP_00460; phage(gi209447190) 4e-16 Click
19421335..421823 PHAGE_Entero_HK629: late gene regulator Q; PP_00461; phage(gi428782072) 1e-76 Click
20422254..422481 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_00462; phage(gi435439318) 7e-34 Click
21422481..422618 PHAGE_Entero_mEp237: hypothetical protein; PP_00463; phage(gi435439319) 4e-10 Click

Region 3, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11248750..1249283 PHAGE_Entero_mEp460: hypothetical protein; PP_01332; phage(gi428782365) 2e-39 Click
21249423..1249767 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; PP_01333; phage(gi20065865) 8e-59 Click
31250208..1250813 PHAGE_Entero_mEp460: hypothetical protein; PP_01334; phage(gi428782365) 4e-45 Click
41251129..1251623 PHAGE_Entero_mEp460: hypothetical protein; PP_01335; phage(gi428782365) 5e-40 Click
51251655..1251730 tRNA 0.0 Click
6complement(1251687..1252328) PHAGE_Entero_HK629: tail length tape measure protein; PP_01336; phage(gi428782027) 9e-106 Click
7complement(1252321..1252755) PHAGE_Entero_HK629: tail assembly protein; PP_01337; phage(gi428782026) 4e-81 Click
8complement(1252737..1253159) PHAGE_Entero_HK629: minor tail protein; PP_01338; phage(gi428782025) 2e-73 Click
9complement(1253175..1253915) PHAGE_Entero_HK629: major tail protein; PP_01339; phage(gi428782024) 3e-133 Click
10complement(1253923..1254318) PHAGE_Entero_HK629: minor tail protein; PP_01340; phage(gi428782023) 2e-72 Click
11complement(1254315..1254434) PHAGE_Entero_HK629: minor tail protein; PP_01341; phage(gi428782022) 1e-15 Click
12complement(1254443..1254892) PHAGE_Entero_HK629: minor tail protein; PP_01342; phage(gi428782022) 2e-72 Click
13complement(1255049..1255195) Superoxide dismutase [Escherichia coli P12b] gi|386704714|ref|YP_006168561.1|; PP_01343 8e-06 Click
14complement(1255245..1255385) hypothetical; PP_01344 0.0 Click
151255827..1256066 PHAGE_Escher_HK75: RusA-like protein; PP_01345; phage(gi356870726) 1e-16 Click
161256302..1256427 PHAGE_Escher_TL_2011c: putative late gene regulator Q; PP_01346; phage(gi418487066) 3e-11 Click
171256579..1257397 hypothetical protein ECSP_1101 [Escherichia coli O157:H7 str. TW14359] gi|254792194|ref|YP_003077031.1|; PP_01347 6e-156 Click
181257684..1257923 PHAGE_Entero_phiP27: hypothetical protein P27p23; PP_01348; phage(gi18249887) 2e-20 Click
19complement(1257987..1258127) hypothetical; PP_01349 0.0 Click
20complement(1258102..1258215) hypothetical; PP_01350 0.0 Click
211258342..1258491 AraC family transcriptional regulator [Escherichia coli O26:H11 str. 11368] gi|260854293|ref|YP_003228184.1|; PP_01351 3e-05 Click
221258851..1258982 flagellar basal-body rod protein FlgG [Dickeya zeae Ech1591] gi|251789170|ref|YP_003003891.1|; PP_01352 2e-05 Click
23complement(1259049..1259906) PHAGE_Entero_mEp213: head maturation protease; PP_01353; phage(gi428782594) 5e-104 Click
241260427..1260906 PHAGE_Stx2_c_1717: putative tail component K-like protein; PP_01354; phage(gi209447194) 3e-86 Click
251260869..1261117 PHAGE_Entero_2008: putative tail component K-like protein; PP_01355; phage(gi209427789) 2e-11 Click
26complement(1261406..1261624) plasmid maintenance protein CcdA [Escherichia coli UTI89] gi|91206301|ref|YP_538655.1|; PP_01356 5e-34 Click
27complement(1261801..1262142) w0046 [Escherichia coli O157:H7 str. EC4115] gi|209395568|ref|YP_002268416.1|; PP_01357 4e-63 Click
281262167..1262766 PHAGE_Lymant_MNPV: LdOrf-82 peptide; PP_01358; phage(gi9631049) 6e-05 Click
291262763..1263383 hypothetical protein ECH74115_B0030 [Escherichia coli O157:H7 str. EC4115] gi|209395541|ref|YP_002268414.1|; PP_01359 6e-119 Click
301263380..1263580 w0044 [Escherichia coli O157:H7 str. EC4115] gi|209395614|ref|YP_002268413.1|; PP_01360 1e-32 Click
311263988..1264965 PHAGE_Salmon_SSU5: putative replication protein RepA; PP_01361; phage(gi410491479) 2e-104 Click

Region 4, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1374264..1374446) PROPHAGE_Escher_Sakai: putative minor tail protein; PP_01477; phage(gi15832205) 2e-29 Click
21374544..1374669 PHAGE_Escher_TL_2011c: hypothetical protein; PP_01478; phage(gi418487098) 5e-17 Click
31374830..1375102 hypothetical protein ECS88_4896 [Escherichia coli S88] gi|218561457|ref|YP_002394370.1|; PP_01479 4e-08 Click
41375130..1375429 exclusion protein ren of cryptic prophage CP-933P [Escherichia coli O157:H7 str. TW14359] gi|254793182|ref|YP_003078019.1|; PP_01480 2e-40 Click
5complement(1375844..1376197) PHAGE_Entero_If1: hypothetical protein If1p09; PP_01481; phage(gi9630756) 2e-36 Click
61376252..1376935 PHAGE_Entero_mEp237: DNA replication protein O; PP_01482; phage(gi435439307) 1e-20 Click
71376942..1377682 PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_01483; phage(gi169257280) 2e-74 Click
81377712..1378041 hypothetical protein O3K_12405 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482022|ref|YP_006779171.1|; PP_01484 6e-33 Click
91378295..1378444 PHAGE_Entero_HK022: hypothetical protein HK022p35; PP_01485; phage(gi9634146) 6e-22 Click

Region 5, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11625180..1629565 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_01742; phage(gi414087138) 4e-31 Click
21629773..1640656 PHAGE_Invert_6: 443R; PP_01743; phage(gi15079154) 3e-55 Click
31640878..1641435 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; PP_01744; phage(gi116221997) 4e-50 Click
4complement(1641659..1641811) PHAGE_Salico_CGphi29: hypothetical protein; PP_01745; phage(gi472340166) 1e-08 Click
5complement(1642086..1642427) PHAGE_Entero_mEp390: prophage repressor; PP_01746; phage(gi428782701) 9e-13 Click
6complement(1643171..1643449) PHAGE_Entero_HK630: portal protein B; PP_01747; phage(gi428782791) 5e-30 Click
7complement(1643433..1643693) PHAGE_Entero_HK630: head-tail connector W; PP_01748; phage(gi428782790) 5e-29 Click
8complement(1643690..1643908) PHAGE_Entero_HK630: terminase large subunit A; PP_01749; phage(gi428782789) 2e-34 Click
91644258..1644539 hypothetical protein i02_3355 [Escherichia coli str. 'clone D i2'] gi|386630795|ref|YP_006150515.1|; PP_01750 3e-23 Click
10complement(1644657..1645280) PROPHAGE_Escher_Sakai: putative minor tail protein; PP_01751; phage(gi15832208) 6e-112 Click
11complement(1645283..1645531) PHAGE_Entero_mEp460: hypothetical protein; PP_01752; phage(gi428782323) 3e-18 Click
12complement(1645557..1645883) PHAGE_Entero_mEp460: hypothetical protein; PP_01753; phage(gi428782322) 2e-22 Click
13complement(1645971..1647011) PHAGE_Entero_mEp460: putative protease/scaffold protein; PP_01754; phage(gi428782321) 2e-143 Click
14complement(1647137..1647349) PHAGE_Entero_mEp460: Lom protein; PP_01755; phage(gi428782335) 4e-19 Click
15complement(1647420..1647875) PHAGE_Entero_mEp460: host specificity protein; PP_01756; phage(gi428782334) 7e-80 Click
161648139..1648276 hypothetical; PP_01757 0.0 Click
171648269..1648955 PHAGE_Stx2_c_1717: exonuclease; PP_01758; phage(gi209447136) 8e-87 Click
181649064..1650233 PHAGE_Pseudo_OBP: putative NrdB; PP_01759; phage(gi371671580) 4e-178 Click
191650233..1650487 PHAGE_Pseudo_OBP: putative 2Fe-2S ferredoxin; PP_01760; phage(gi371671579) 2e-25 Click
20complement(1650541..1651191) pH-inducible protein involved in stress response [Escherichia coli O55:H7 str. CB9615] gi|291283481|ref|YP_003500299.1|; PP_01761 2e-125 Click
21complement(1651272..1652462) antibiotic resistance protein [Shigella dysenteriae Sd197] gi|82777647|ref|YP_403996.1|; PP_01762 0.0 Click
221652614..1653492 PHAGE_Burkho_phi1026b: gp58; PP_01763; phage(gi38707948) 4e-07 Click

Region 6, total : 66 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11657748..1657759 attL    ACCTGCCGTTTC 0.0 Click
21662219..1663145 PROPHAGE_Escher_MG1655: predicted transposase; PP_01771; phage(gi16131287) 6e-100 Click
3complement(1663186..1663938) aldolase [Escherichia coli O55:H7 str. CB9615] gi|291283490|ref|YP_003500308.1|; PP_01772 3e-139 Click
4complement(1664006..1664845) transporter [Escherichia coli O157:H7 str. EDL933] gi|15802795|ref|NP_288822.1|; PP_01773 1e-140 Click
51665100..1665252 hypothetical; PP_01774 0.0 Click
6complement(1665389..1665865) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; PP_01775; phage(gi15832203) 2e-82 Click
71666141..1666329 PHAGE_Escher_HK639: replication protein 14; PP_01776; phage(gi356870655) 9e-11 Click
81666349..1666399 attL    CGGAGGAAATTTTAATGGAAACCGTATCTGACGCACTGAAAGCACTGAAAA 0.0 Click
91666363..1667079 hypothetical protein ECSP_1435 [Escherichia coli O157:H7 str. TW14359] gi|254792516|ref|YP_003077353.1|; PP_01777 1e-129 Click
101667139..1667393 hypothetical protein ECSP_1436 [Escherichia coli O157:H7 str. TW14359] gi|254792517|ref|YP_003077354.1|; PP_01778 2e-41 Click
111667396..1667692 PHAGE_Klebsi_phiKO2: Gp58; PP_01779; phage(gi46402144) 1e-26 Click
12complement(1667781..1667987) hypothetical protein CE10_2487 [Escherichia coli O7:K1 str. CE10] gi|386624812|ref|YP_006144540.1|; PP_01780 2e-30 Click
131668148..1668270 PHAGE_Salmon_E1: hypothetical protein VIP0051; PP_01781; phage(gi170676326) 1e-05 Click
141668257..1668694 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; PP_01782; phage(gi89152464) 1e-11 Click
151668753..1668887 PHAGE_Entero_mEp460: hypothetical protein; PP_01783; phage(gi428782344) 2e-16 Click
161668890..1669546 PHAGE_Entero_mEp460: hypothetical protein; PP_01784; phage(gi428782343) 2e-29 Click
17complement(1669788..1670063) PHAGE_Entero_HK630: terminase large subunit A; PP_01785; phage(gi428782789) 1e-38 Click
18complement(1670184..1670495) hypothetical protein G2583_1538 [Escherichia coli O55:H7 str. CB9615] gi|291282286|ref|YP_003499104.1|; PP_01786 5e-32 Click
19complement(1671319..1671480) hypothetical; PP_01787 0.0 Click
20complement(1672752..1674272) PHAGE_Entero_mEp460: host specificity protein; PP_01788; phage(gi428782334) 7e-44 Click
211674307..1674555 PHAGE_Entero_mEp460: tail assembly protein; PP_01789; phage(gi428782333) 1e-12 Click
221674605..1674730 hypothetical; PP_01790 0.0 Click
23complement(1674699..1675037) PHAGE_Entero_mEp460: Lom protein; PP_01791; phage(gi428782335) 1e-46 Click
241675142..1675267 hypothetical; PP_01792 0.0 Click
25complement(1677210..1677590) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp54; PP_01793; phage(gi302393137) 8e-67 Click
26complement(1677954..1678088) hypothetical; PP_01794 0.0 Click
27complement(1678233..1678496) PHAGE_Entero_mEp234: prophage repressor; PP_01795; phage(gi428782293) 2e-47 Click
281678474..1678668 hypothetical; PP_01796 0.0 Click
291679897..1680016 hypothetical protein G2583_0967 [Escherichia coli O55:H7 str. CB9615] gi|291281737|ref|YP_003498555.1|; PP_01797 5e-07 Click
30complement(1680110..1680298) hypothetical; PP_01798 0.0 Click
31complement(1680463..1681122) PHAGE_Salmon_1: hypothetical bacteriophage protein; PP_01799; phage(gi169257202) 4e-61 Click
321681124..1681240 hypothetical; PP_01800 0.0 Click
331681203..1681328 hypothetical; PP_01801 0.0 Click
34complement(1681350..1681466) nitrate reductase 1, cytochrome b(NR) subunit gamma [Shigella sonnei Ss046] gi|74312432|ref|YP_310851.1|; PP_01802 4e-07 Click
351682070..1682210 hypothetical protein ECSP_1474, partial [Escherichia coli O157:H7 str. TW14359] gi|254792555|ref|YP_003077392.1|; PP_01803 7e-12 Click
361682513..1683391 PHAGE_Salmon_vB_SemP_Emek: antirepressor; PP_01804; phage(gi399498814) 2e-94 Click
371683445..1684035 PHAGE_Entero_mEp460: tail fiber component; PP_01805; phage(gi428782332) 1e-72 Click
38complement(1684051..1684203) PHAGE_Entero_4795: putative tail component; PP_01806; phage(gi157166057) 4e-25 Click
391684703..1684918 PHAGE_Entero_phiV10: hypothetical protein PhiV10p52; PP_01807; phage(gi89152466) 7e-37 Click
401684920..1685138 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; PP_01808; phage(gi20065885) 4e-36 Click
411685140..1685427 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip089; PP_01809; phage(gi20065884) 1e-51 Click
421685431..1686048 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip087; PP_01810; phage(gi20065882) 4e-119 Click
43complement(1686919..1687038) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip080; PP_01811; phage(gi20065875) 2e-12 Click
441687354..1687521 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp41; PP_01812; phage(gi116222033) 9e-29 Click
451687748..1688374 PHAGE_Escher_P13374: methylase; PP_01813; phage(gi410491602) 4e-122 Click
461688334..1688546 PHAGE_Escher_TL_2011c: hypothetical protein; PP_01814; phage(gi418487078) 1e-30 Click
471688582..1688959 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; PP_01815; phage(gi116222030) 1e-63 Click
481689038..1689220 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; PP_01816; phage(gi116222029) 4e-29 Click
49complement(1689204..1690373) PHAGE_Stx2_c_86: integrase; PP_01817; phage(gi116222028) 0.0 Click
501690571..1690846 hypothetical protein ECO26_1110 [Escherichia coli O26:H11 str. 11368] gi|260854275|ref|YP_003228166.1|; PP_01818 5e-45 Click
511690812..1691369 hypothetical protein ECSP_1091 [Escherichia coli O157:H7 str. TW14359] gi|254792184|ref|YP_003077021.1|; PP_01819 2e-103 Click
521691587..1692678 PHAGE_Entero_mEp460: replication protein; PP_01820; phage(gi428782359) 9e-29 Click
531692685..1693431 PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_01821; phage(gi169257280) 8e-75 Click
541693439..1693489 attR    CGGAGGAAATTTTAATGGAAACCGTATCTGACGCACTGAAAGCACTGAAAA 0.0 Click
551693453..1693791 hypothetical protein ECSP_1094 [Escherichia coli O157:H7 str. TW14359] gi|254792187|ref|YP_003077024.1|; PP_01822 7e-36 Click
56complement(1693941..1694150) PHAGE_Stx2_c_1717: transposase; PP_01823; phage(gi209447153) 3e-06 Click
57complement(1694748..1694975) hypothetical protein ECO26_2665 [Escherichia coli O26:H11 str. 11368] gi|260855753|ref|YP_003229644.1|; PP_01824 1e-28 Click
58complement(1694960..1695178) repressor protein encoded by cryptic prophage CP-933P [Escherichia coli O157:H7 str. TW14359] gi|254793187|ref|YP_003078024.1|; PP_01825 1e-34 Click
591695824..1695955 PHAGE_Escher_P13374: hypothetical protein; PP_01826; phage(gi410491643) 4e-13 Click
60complement(1695948..1697057) PHAGE_Stx2_c_1717: transposase; PP_01827; phage(gi209447153) 3e-116 Click
61complement(1697088..1697384) PHAGE_Stx2_c_1717: transposase; PP_01828; phage(gi209447152) 1e-30 Click
62complement(1697435..1697860) PHAGE_Stx2_c_1717: truncated transposase; PP_01829; phage(gi209447151) 2e-13 Click
63complement(1698516..1699100) PHAGE_Stx2_c_1717: transposase; PP_01830; phage(gi209447153) 8e-74 Click
64complement(1699150..1699497) PHAGE_Stx2_c_1717: transposase; PP_01831; phage(gi209447152) 2e-62 Click
65complement(1699866..1700114) PHAGE_Entero_mEp460: DinI-like protein; PP_01832; phage(gi428782337) 1e-40 Click
66complement(1700176..1701273) PHAGE_Entero_mEp460: integrase; PP_01833; phage(gi428782338) 0.0 Click
671701362..1702399 tRNA-dihydrouridine synthase A [Escherichia coli O111:H- str. 11128] gi|260870808|ref|YP_003237210.1|; PP_01834 0.0 Click
681702533..1702775 phage shock protein G [Shigella sonnei Ss046] gi|161986389|ref|YP_312963.2|; PP_01835 2e-37 Click
69complement(1702941..1703924) quinone oxidoreductase [Escherichia coli O55:H7 str. CB9615] gi|291285467|ref|YP_003502285.1|; PP_01836 0.0 Click
701704007..1704759 PHAGE_Entero_P1: Ban; PP_01837; phage(gi46401697) 4e-54 Click
711708284..1708295 attR    ACCTGCCGTTTC 0.0 Click

Region 7, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12292788..2292799 attL    TATCTAAAAAAT 0.0 Click
2complement(2294408..2294722) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; PP_02464; phage(gi116221998) 4e-18 Click
3complement(2295005..2295080) tRNA 0.0 Click
4complement(2295599..2296183) exonuclease VIII, ds DNA exonuclease, 5' --_ 3' specific encoded by prophage CP-933O [Escherichia coli O157:H7 str. TW14359] gi|254792728|ref|YP_003077565.1|; PP_02465 9e-89 Click
5complement(2296180..2298657) PHAGE_Salmon_ST64B: Endodeoxyribonuclease; PP_02466; phage(gi23505474) 1e-46 Click
6complement(2298654..2298812) hypothetical; PP_02467 0.0 Click
72298677..2298753 tRNA 0.0 Click
82298825..2298986 PHAGE_Salmon_ST64B: hypothetical protein sb48; PP_02468; phage(gi23505492) 1e-18 Click
9complement(2299170..2299373) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_02469; phage(gi148609401) 3e-05 Click
102299196..2299272 tRNA 0.0 Click
112299419..2299601 PHAGE_Stx2_c_I: O protein; PP_02470; phage(gi20065919) 5e-12 Click
122299555..2300535 PHAGE_Entero_4795: putative large subunit terminase; PP_02471; phage(gi157166040) 0.0 Click
132300599..2301987 PHAGE_Stx2_c_1717: phage head maturation protease; PP_02472; phage(gi209447181) 0.0 Click
142302232..2303083 hypothetical protein G2583_3298 [Escherichia coli O55:H7 str. CB9615] gi|291283985|ref|YP_003500803.1|; PP_02473 2e-161 Click
152303183..2303389 PHAGE_Entero_P4: transcriptional regulator; PP_02474; phage(gi9627517) 3e-07 Click
162303712..2304917 PHAGE_Temper_1: integrase-like protein; PP_02475; phage(gi16271777) 8e-07 Click
172310399..2310410 attR    TATCTAAAAAAT 0.0 Click

Region 8, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2330666..2330824) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; PP_02502; phage(gi209427795) 2e-17 Click
22331272..2331751 PROPHAGE_Escher_CFT073: transposase; PP_02503; phage(gi26246249) 1e-38 Click
3complement(2331816..2332691) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp77; PP_02504; phage(gi209447200) 4e-114 Click
4complement(2332830..2333231) PHAGE_Stx2_c_1717: transposase; PP_02505; phage(gi209447179) 3e-49 Click
5complement(2333231..2334817) PROPHAGE_Escher_Sakai: putative portal protein; PP_02506; phage(gi15832215) 0.0 Click
6complement(2334817..2335023) PHAGE_Entero_mEp460: hypothetical protein; PP_02507; phage(gi428782319) 2e-14 Click
72335029..2335703 PHAGE_Stx2_c_1717: truncated transposase; PP_02508; phage(gi209447151) 3e-09 Click
82335700..2336047 PHAGE_Stx2_c_1717: transposase; PP_02509; phage(gi209447152) 4e-42 Click
92336067..2337269 PHAGE_Stx2_c_1717: transposase; PP_02510; phage(gi209447153) 9e-118 Click
10complement(2337316..2338260) DNA helicase II [Escherichia coli O55:H7 str. CB9615] gi|291284293|ref|YP_003501111.1|; PP_02511 0.0 Click
11complement(2338369..2338902) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_02512; phage(gi148609401) 4e-18 Click
12complement(2339490..2339666) hypothetical protein G2583_3634 [Escherichia coli O55:H7 str. CB9615] gi|291284295|ref|YP_003501113.1|; PP_02513 1e-24 Click
132339841..2340044 hypothetical protein i02_1157 [Escherichia coli str. 'clone D i2'] gi|386628643|ref|YP_006148363.1|; PP_02514 5e-27 Click
142340219..2341109 PROPHAGE_Escher_EDL933: putative transposase; PP_02515; phage(gi15803516) 2e-147 Click

Region 9, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12346244..2347089 PROPHAGE_Escher_EDL933: putative transposase; PP_02522; phage(gi15803522) 6e-167 Click
22347741..2349042 EHEC factor for adherence [Escherichia coli O55:H7 str. CB9615] gi|291284300|ref|YP_003501118.1|; PP_02523 0.0 Click
32349048..2349926 EHEC factor for adherence [Escherichia coli O55:H7 str. CB9615] gi|291284300|ref|YP_003501118.1|; PP_02524 3e-156 Click
42350084..2350230 PHAGE_Entero_2008: phage-related tail protein; PP_02525; phage(gi209427791) 7e-10 Click
52350335..2350880 PHAGE_Entero_2008: putative recombination protein; PP_02526; phage(gi209427757) 2e-102 Click
62350877..2351407 PHAGE_Salmon_vB_SosS_Oslo: DNA methyltransferase protein; PP_02527; phage(gi399528822) 2e-32 Click
7complement(2351391..2351726) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; PP_02528; phage(gi209427795) 2e-19 Click
82352121..2352462 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_02529; phage(gi209427766) 2e-44 Click
92352470..2352601 hypothetical; PP_02530 0.0 Click
102352598..2352729 PHAGE_Entero_2008: putative tail assembly protein; PP_02531; phage(gi209427790) 2e-17 Click
112352775..2352894 hypothetical; PP_02532 0.0 Click
12complement(2352889..2353512) PHAGE_Entero_2008: phage-related tail protein; PP_02533; phage(gi209427791) 1e-74 Click
13complement(2353655..2354491) PHAGE_Salmon_ST64B: Endodeoxyribonuclease; PP_02534; phage(gi23505474) 8e-23 Click
14complement(2354586..2355047) hypothetical protein ECO26_1359 [Escherichia coli O26:H11 str. 11368] gi|260854510|ref|YP_003228401.1|; PP_02535 1e-53 Click
15complement(2355063..2355548) PHAGE_Pseudo_YuA: hypothetical protein; PP_02536; phage(gi162135127) 1e-13 Click
16complement(2355611..2356075) exonuclease VIII, ds DNA exonuclease, 5' --_ 3' specific encoded by prophage CP-933O [Escherichia coli O157:H7 str. TW14359] gi|254792728|ref|YP_003077565.1|; PP_02537 7e-66 Click
17complement(2356116..2356913) hypothetical protein G2583_2485 [Escherichia coli O55:H7 str. CB9615] gi|291283209|ref|YP_003500027.1|; PP_02538 3e-155 Click
182357007..2357096 tRNA 0.0 Click
19complement(2357105..2357887) PHAGE_Salmon_ST64B: Integrase protein; PP_02539; phage(gi23505472) 4e-80 Click
20complement(2357889..2358008) PHAGE_Salmon_ST64B: Integrase protein; PP_02540; phage(gi23505472) 2e-07 Click

Region 10, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2505518..2506240) PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; PP_02697; phage(gi116326757) 9e-07 Click
22506339..2507238 PHAGE_Burkho_phi1026b: gp58; PP_02698; phage(gi38707948) 6e-19 Click
32507503..2507514 attL    AAACTTTTTTTG 0.0 Click
42507914..2508870 hypothetical protein ECSP_0312 [Escherichia coli O157:H7 str. TW14359] gi|254791434|ref|YP_003076271.1|; PP_02699 0.0 Click
5complement(2509003..2511336) PHAGE_Entero_P4: DNA primase; PP_02700; phage(gi9627512) 0.0 Click
6complement(2511350..2511673) PHAGE_Entero_P4: hypothetical protein P4p07; PP_02701; phage(gi9627513) 1e-35 Click
7complement(2511673..2511894) hypothetical protein G2583_0364 [Escherichia coli O55:H7 str. CB9615] gi|291281166|ref|YP_003497984.1|; PP_02702 1e-35 Click
8complement(2511891..2512448) PHAGE_Entero_P4: putative CI repressor; PP_02703; phage(gi9627516) 3e-35 Click
9complement(2512445..2512705) PHAGE_Entero_P4: transcriptional regulator; PP_02704; phage(gi9627517) 8e-25 Click
102513636..2514388 PHAGE_Entero_P4: head size determination protein sid; PP_02705; phage(gi9627518) 2e-09 Click
112514385..2514936 PHAGE_Entero_P4: amber mutation-suppressing protein; PP_02706; phage(gi9627520) 1e-11 Click
122515092..2515214 activator encoded in prophage CP-933I [Escherichia coli O55:H7 str. CB9615] gi|291281160|ref|YP_003497978.1|; PP_02707 1e-14 Click
13complement(2515624..2516190) hypothetical protein ECSP_0303 [Escherichia coli O157:H7 str. TW14359] gi|254791425|ref|YP_003076262.1|; PP_02708 3e-105 Click
14complement(2516190..2516414) hypothetical protein Z0330 [Escherichia coli O157:H7 str. EDL933] gi|15799969|ref|NP_285981.1|; PP_02709 6e-35 Click
15complement(2516390..2516779) hypothetical protein ECSP_0302 [Escherichia coli O157:H7 str. TW14359] gi|254791424|ref|YP_003076261.1|; PP_02710 3e-67 Click
16complement(2516810..2517442) hypothetical protein ECSP_0301 [Escherichia coli O157:H7 str. TW14359] gi|254791423|ref|YP_003076260.1|; PP_02711 2e-115 Click
17complement(2517435..2517851) hypothetical protein ECSP_0300 [Escherichia coli O157:H7 str. TW14359] gi|254791422|ref|YP_003076259.1|; PP_02712 1e-72 Click
18complement(2517893..2518393) hypothetical protein Z0326 [Escherichia coli O157:H7 str. EDL933] gi|15799966|ref|NP_285978.1|; PP_02713 8e-94 Click
19complement(2518470..2518592) hypothetical protein Z0325 [Escherichia coli O157:H7 str. EDL933] gi|15799965|ref|NP_285977.1|; PP_02714 7e-12 Click
202518681..2518692 attR    AAACTTTTTTTG 0.0 Click
21complement(2518952..2520136) PROPHAGE_Escher_CFT073: putative prophage integrase; PP_02715; phage(gi26250313) 2e-131 Click

Region 11, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12553746..2554285 PHAGE_Escher_TL_2011c: hypothetical protein; PP_02752; phage(gi418487095) 4e-60 Click
2complement(2554349..2554756) hypothetical protein G2583_4400 [Escherichia coli O55:H7 str. CB9615] gi|291285034|ref|YP_003501852.1|; PP_02753 1e-63 Click
3complement(2554846..2554989) hypothetical protein G2583_4399 [Escherichia coli O55:H7 str. CB9615] gi|291285033|ref|YP_003501851.1|; PP_02754 1e-20 Click
4complement(2555007..2555684) PHAGE_Entero_Sf6: putative transposase OrfB; PP_02756; phage(gi41057343) 6e-81 Click
52555721..2555849 hypothetical protein SARI_02148 [Salmonella enterica subsp. arizonae serovar 62:z4,z23:- str. RSK2980] gi|161504055|ref|YP_001571166.1|; PP_02755 4e-09 Click
62556026..2556283 PHAGE_Escher_HK639: replication protein 14; PP_02757; phage(gi356870655) 2e-11 Click
72557106..2557318 PHAGE_Escher_TL_2011c: Shiga toxin 2 subunit B; PP_02758; phage(gi418487068) 4e-22 Click
8complement(2557279..2557572) PHAGE_Escher_TL_2011c: Bor protein precursor; PP_02759; phage(gi418487071) 2e-50 Click
92557812..2557925 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; PP_02760; phage(gi20065959) 6e-17 Click
102557981..2558787 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip165; PP_02761; phage(gi20065960) 3e-151 Click
112558813..2560474 PHAGE_Escher_P13374: phage terminase large subunit; PP_02762; phage(gi410491652) 0.0 Click
122560474..2562618 PHAGE_Escher_TL_2011c: putative portal protein; PP_02763; phage(gi418487074) 0.0 Click
132562776..2563387 PHAGE_Escher_TL_2011c: hypothetical protein; PP_02764; phage(gi418487100) 5e-94 Click
142564165..2564323 hypothetical protein ECP_1165 [Escherichia coli 536] gi|110641347|ref|YP_669077.1|; PP_02765 2e-16 Click
152564404..2564949 PHAGE_Entero_HK630: terminase small subunit nu1; PP_02766; phage(gi428782788) 2e-82 Click
16complement(2565170..2566312) PHAGE_Entero_mEp213: head maturation protease; PP_02767; phage(gi428782594) 4e-98 Click

Region 12, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13179505..3179867 PHAGE_Stx2_c_II: endolysin; PP_03412; phage(gi302393165) 3e-68 Click
23179824..3179952 endolysin [Escherichia coli O55:H7 str. CB9615] gi|291282468|ref|YP_003499286.1|; PP_03413 1e-06 Click
33180059..3180205 hypothetical protein ECSP_2608 [Escherichia coli O157:H7 str. TW14359] gi|254793653|ref|YP_003078490.1|; PP_03414 2e-18 Click
43180357..3180593 PHAGE_Stx2_c_II: endopeptidase Rz; PP_03415; phage(gi302393167) 1e-17 Click
5complement(3180703..3182199) PHAGE_Stx2_c_II: putative tail fiber protein; PP_03416; phage(gi302393090) 0.0 Click
6complement(3182196..3182846) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; PP_03417; phage(gi302393089) 9e-122 Click
7complement(3182846..3183409) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; PP_03418; phage(gi302393088) 2e-104 Click
8complement(3183393..3183854) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; PP_03419; phage(gi302393087) 2e-82 Click
9complement(3183904..3184293) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; PP_03420; phage(gi302393086) 2e-66 Click
10complement(3184349..3185563) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; PP_03421; phage(gi302393085) 0.0 Click
11complement(3185587..3186003) PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; PP_03422; phage(gi302393084) 3e-73 Click
123186663..3186836 hypothetical protein G2583_4745 [Escherichia coli O55:H7 str. CB9615] gi|291285353|ref|YP_003502171.1|; PP_03423 1e-25 Click
13complement(3187200..3187385) PROPHAGE_Escher_MG1655: IS1 transposase B; PP_03424; phage(gi16131317) 1e-07 Click

Region 13, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3235728..3236846) PHAGE_Stx2_c_1717: transposase; PP_03470; phage(gi209447153) 1e-105 Click
2complement(3236882..3237028) hypothetical protein i02_0239 [Escherichia coli str. 'clone D i2'] gi|386627740|ref|YP_006147460.1|; PP_03471 1e-08 Click
3complement(3237405..3237563) transposase-like protein [Escherichia coli O55:H7 str. CB9615] gi|291284302|ref|YP_003501120.1|; PP_03472 4e-21 Click
4complement(3238232..3238591) PHAGE_Stx2_c_1717: transposase; PP_03473; phage(gi209447153) 2e-43 Click
53238676..3238801 PHAGE_Entero_4795: putative tail fiber component; PP_03474; phage(gi157166054) 5e-16 Click
63238940..3239173 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp07; PP_03475; phage(gi209447132) 4e-26 Click
7complement(3239303..3239563) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_03476; phage(gi116222045) 7e-18 Click
8complement(3239639..3239845) PHAGE_Escher_HK639: hypothetical protein; PP_03477; phage(gi356870641) 3e-07 Click
9complement(3240681..3241742) PHAGE_Lactob_Lj965: hypothetical protein Ljo_0304; PP_03478; phage(gi41179236) 4e-66 Click
10complement(3241823..3242437) PHAGE_Escher_HK639: cI; PP_03479; phage(gi356870650) 9e-44 Click
113242617..3242847 PHAGE_Escher_HK639: cro; PP_03480; phage(gi356870651) 3e-20 Click
123242917..3243456 PHAGE_Escher_HK639: cII; PP_03481; phage(gi356870652) 3e-42 Click
133243453..3244448 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip101; PP_03482; phage(gi20065896) 2e-30 Click
143244599..3245657 PHAGE_Entero_phiP27: putative DNA methylase; PP_03483; phage(gi18249888) 0.0 Click
153245750..3245908 PHAGE_Entero_HK630: Bet protein; PP_03484; phage(gi428782823) 1e-21 Click

Region 14, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13327488..3327502 attL    CAGCCATGCGATTGA 0.0 Click
23342047..3342592 PHAGE_Entero_mEp237: terminase small subunit nu1; PP_03572; phage(gi435439266) 2e-88 Click
33342567..3343157 PHAGE_Entero_mEp237: terminase large subunit A; PP_03573; phage(gi435439267) 1e-91 Click
4complement(3344001..3344255) PHAGE_Entero_2008: phage-related tail protein; PP_03574; phage(gi209427791) 1e-37 Click
53344366..3344722 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; PP_03575; phage(gi20065868) 1e-07 Click
63344771..3344983 hypothetical protein ECSP_1731 [Escherichia coli O157:H7 str. TW14359] gi|254792802|ref|YP_003077639.1|; PP_03576 4e-37 Click
73345786..3345995 hypothetical protein ECO26_2275 [Escherichia coli O26:H11 str. 11368] gi|260855375|ref|YP_003229266.1|; PP_03577 3e-32 Click
8complement(3345996..3346634) PHAGE_Escher_TL_2011c: hypothetical protein; PP_03578; phage(gi418487085) 6e-09 Click
9complement(3346646..3346879) PHAGE_Salico_CGphi29: hypothetical protein; PP_03579; phage(gi472340166) 5e-09 Click
10complement(3347091..3347429) PHAGE_Pectob_ZF40: putative cI repressor; PP_03580; phage(gi422936650) 1e-08 Click
113348169..3349218 PHAGE_Bacill_WBeta: putative site-specific recombinase; PP_03581; phage(gi85701406) 1e-07 Click
123349254..3349934 PHAGE_Entero_mEp460: host specificity protein; PP_03582; phage(gi428782334) 4e-71 Click
133350294..3350488 hypothetical protein Y75_p1113 [Escherichia coli str. K-12 substr. W3110] gi|388477223|ref|YP_489411.1|; PP_03583 3e-10 Click
14complement(3350475..3350780) PHAGE_Escher_TL_2011c: hypothetical protein; PP_03584; phage(gi418487085) 2e-06 Click
15complement(3350792..3350944) PHAGE_Salico_CGphi29: hypothetical protein; PP_03585; phage(gi472340166) 1e-08 Click
16complement(3351113..3351502) PHAGE_Entero_mEp237: hypothetical protein; PP_03586; phage(gi435439303) 3e-20 Click
173351774..3352517 PROPHAGE_Escher_CFT073: transposase; PP_03587; phage(gi26246249) 7e-92 Click
18complement(3352534..3352752) regulatory protein [Escherichia coli O26:H11 str. 11368] gi|260854392|ref|YP_003228283.1|; PP_03588 1e-31 Click
193352962..3353135 PHAGE_Salmon_SPN3UB: hypothetical protein; PP_03589; phage(gi423262397) 4e-24 Click
203353125..3354129 PHAGE_Stx2_c_1717: phage antirepressor protein; PP_03590; phage(gi209447193) 4e-177 Click
21complement(3354182..3354922) PHAGE_Stx2_c_1717: putative tail fiber protein; PP_03591; phage(gi209447198) 3e-09 Click
223354968..3355043 tRNA 0.0 Click
23complement(3355139..3355978) transcriptional regulator HdfR [Shigella dysenteriae Sd197] gi|82779054|ref|YP_405403.1|; PP_03592 6e-157 Click
243356097..3356435 hypothetical protein SSON_3933 [Shigella sonnei Ss046] gi|74314277|ref|YP_312696.1|; PP_03593 3e-61 Click
25complement(3356459..3357979) PROPHAGE_Escher_Sakai: putative ATP-dependent protease; PP_03594; phage(gi15833954) 0.0 Click
263367378..3367392 attR    CAGCCATGCGATTGA 0.0 Click

Region 15, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3459362..3462943) PHAGE_Pectob_My1: YadA domain-containing protein; PP_03695; phage(gi410491156) 1e-26 Click
23462908..3463165 PHAGE_Entero_4795: putative replication protein P; PP_03696; phage(gi157166012) 9e-37 Click
33463240..3463252 attL    GGCCTTTCTGTTA 0.0 Click
4complement(3463273..3463779) PHAGE_Entero_mEp235: integrase; PP_03697; phage(gi428781836) 8e-28 Click
5complement(3463787..3464368) PHAGE_Entero_mEp235: integrase; PP_03698; phage(gi428781836) 2e-14 Click
63464695..3464973 PHAGE_Entero_HK630: terminase large subunit A; PP_03699; phage(gi428782789) 2e-43 Click
73464970..3465836 RhsG core protein [Escherichia coli O157:H7 str. TW14359] gi|254791370|ref|YP_003076207.1|; PP_03700 5e-172 Click
83465839..3466255 hypothetical protein G2583_0248 [Escherichia coli O55:H7 str. CB9615] gi|291281057|ref|YP_003497875.1|; PP_03701 3e-70 Click
93466284..3466409 hypothetical protein G2583_0248 [Escherichia coli O55:H7 str. CB9615] gi|291281057|ref|YP_003497875.1|; PP_03702 2e-16 Click
10complement(3466412..3466558) hypothetical protein ECSP_0245 [Escherichia coli O157:H7 str. TW14359] gi|254791372|ref|YP_003076209.1|; PP_03703 1e-18 Click
113467155..3467526 PROPHAGE_Escher_MG1655: predicted transposase; PP_03704; phage(gi16131356) 7e-69 Click
123467598..3467741 hypothetical; PP_03705 0.0 Click
13complement(3467971..3468123) hypothetical protein ECSP_2922 [Escherichia coli O157:H7 str. TW14359] gi|254793948|ref|YP_003078785.1|; PP_03706 1e-20 Click
14complement(3468278..3468889) PHAGE_Entero_HK630: major tail protein V; PP_03707; phage(gi428782800) 6e-88 Click
153468935..3468947 attR    GGCCTTTCTGTTA 0.0 Click
163469009..3469152 hypothetical; PP_03708 0.0 Click
17complement(3469167..3469346) hypothetical protein G2583_1731 [Escherichia coli O55:H7 str. CB9615] gi|291282475|ref|YP_003499293.1|; PP_03709 3e-06 Click
18complement(3469343..3471466) PROPHAGE_Escher_Sakai: putative terminase large subunit; PP_03710; phage(gi15832217) 0.0 Click
19complement(3471463..3471939) PHAGE_Salmon_1: bacteriophage terminase, small subunit; PP_03711; phage(gi169257184) 3e-47 Click
203471972..3473015 PHAGE_Entero_4795: putative major head protein/prohead protease; PP_03712; phage(gi157166041) 5e-143 Click
213473060..3473281 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF57; PP_03713; phage(gi157166042) 6e-38 Click
223473314..3474372 PHAGE_Entero_4795: putative portal protein; PP_03714; phage(gi157166043) 0.0 Click

Region 16, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13557024..3557740 PHAGE_Stx2_c_1717: putative major tail subunit; PP_03829; phage(gi209447187) 2e-134 Click
2complement(3557744..3558151) hypothetical protein Vch1786_I0083 [Vibrio cholerae O1 str. 2010EL-1786] gi|360034489|ref|YP_004936252.1|; PP_03830 1e-29 Click
3complement(3558217..3558522) prophage Qin DNA packaging protein NU1-like protein [Escherichia coli str. 'clone D i2'] gi|386628804|ref|YP_006148524.1|; PP_03831 9e-42 Click
4complement(3558773..3559339) hypothetical protein ECSP_0574 [Escherichia coli O157:H7 str. TW14359] gi|254791689|ref|YP_003076526.1|; PP_03832 1e-76 Click
5complement(3559470..3559877) glutamate decarboxylase [Shigella sonnei Ss046] gi|74313937|ref|YP_312356.1|; PP_03833 3e-72 Click
63560090..3560242 PHAGE_Stx2_c_86: DNA modification methylase; PP_03834; phage(gi116222073) 3e-19 Click
73560239..3560367 hypothetical protein SSON53_11205 [Shigella sonnei 53G] gi|383178772|ref|YP_005456777.1|; PP_03835 7e-05 Click
83560444..3560872 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; PP_03836; phage(gi209427735) 7e-25 Click
93560866..3561099 hypothetical protein G2583_1536 [Escherichia coli O55:H7 str. CB9615] gi|291282284|ref|YP_003499102.1|; PP_03837 1e-37 Click
10complement(3561077..3561484) PHAGE_Escher_TL_2011c: hypothetical protein; PP_03838; phage(gi418487085) 5e-12 Click
113561775..3561960 hypothetical protein ECSP_1082 [Escherichia coli O157:H7 str. TW14359] gi|254792175|ref|YP_003077012.1|; PP_03839 3e-30 Click
12complement(3562147..3562536) PHAGE_Escher_TL_2011c: hypothetical protein; PP_03840; phage(gi418487085) 3e-07 Click
13complement(3562548..3562676) hypothetical protein ECSP_1084 [Escherichia coli O157:H7 str. TW14359] gi|254792177|ref|YP_003077014.1|; PP_03841 1e-15 Click
14complement(3562678..3562872) PHAGE_Salico_CGphi29: hypothetical protein; PP_03842; phage(gi472340166) 2e-09 Click
15complement(3563397..3563588) hypothetical protein ECO26_1107 [Escherichia coli O26:H11 str. 11368] gi|260854272|ref|YP_003228163.1|; PP_03843 4e-28 Click
16complement(3563616..3563993) PHAGE_Entero_mEp237: hypothetical protein; PP_03844; phage(gi435439303) 9e-08 Click
173564126..3564542 PHAGE_Entero_mEp237: prophage anti-repressor; PP_03845; phage(gi435439305) 2e-11 Click
183564964..3565140 PHAGE_Entero_HK629: hypothetical protein; PP_03846; phage(gi428782046) 9e-16 Click
193565137..3565325 hypothetical protein ECO26_1472 [Escherichia coli O26:H11 str. 11368] gi|260854622|ref|YP_003228513.1|; PP_03847 5e-31 Click
203565347..3565634 PHAGE_Entero_mEp213: hypothetical protein; PP_03848; phage(gi428782634) 2e-24 Click
213565761..3566324 PHAGE_Entero_mEp460: hypothetical protein; PP_03849; phage(gi428782343) 5e-41 Click
22complement(3566449..3567504) glyceraldehyde-3-phosphate dehydrogenase [Shigella sonnei Ss046] gi|74311911|ref|YP_310330.1|; PP_03850 8e-173 Click
233567846..3567959 hypothetical; PP_03851 0.0 Click
243568063..3568260 methionine sulfoxide reductase B [Shigella sonnei Ss046] gi|74311912|ref|YP_310331.1|; PP_03852 1e-32 Click
253568302..3568574 hypothetical protein CE10_2057 [Escherichia coli O7:K1 str. CE10] gi|386624400|ref|YP_006144128.1|; PP_03853 2e-45 Click
263568944..3570020 PHAGE_Acanth_mimivirus: probable zinc-type alcohol dehydrogenase-like protein; PP_03854; phage(gi311977890) 1e-10 Click

Region 17, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13602692..3604068 PHAGE_Ectoca_1: EsV-1-65; PP_03891; phage(gi13242537) 5e-11 Click
23604065..3605390 PHAGE_Ectoca_1: EsV-1-65; PP_03892; phage(gi13242537) 2e-09 Click
3complement(3605387..3606676) phosphoribosylamine--glycine ligase [Escherichia coli O55:H7 str. CB9615] gi|291285420|ref|YP_003502238.1|; PP_03893 0.0 Click
4complement(3606688..3608277) PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; PP_03894; phage(gi61806062) 4e-71 Click
53608654..3609466 PHAGE_Entero_2008: putative tail protein; PP_03895; phage(gi209427785) 8e-108 Click
63609468..3609827 PHAGE_Entero_mEp460: hypothetical protein; PP_03896; phage(gi428782365) 9e-21 Click
73610076..3611233 UDP-N-acetylenolpyruvoylglucosamine reductase [Escherichia coli O55:H7 str. CB9615] gi|291285390|ref|YP_003502208.1|; PP_03897 0.0 Click
83611262..3611690 PHAGE_Entero_2008: putative phage terminase; PP_03898; phage(gi209427774) 6e-72 Click
93611696..3612394 PHAGE_Entero_2008: putative phage terminase-like protein large subunit; PP_03899; phage(gi209427775) 8e-127 Click
103612521..3612679 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; PP_03900; phage(gi209427735) 1e-23 Click
11complement(3612641..3612766) glycine betaine transporter ATP-binding subunit [Shigella sonnei Ss046] gi|74313248|ref|YP_311667.1|; PP_03901 1e-12 Click
12complement(3613122..3613619) PHAGE_Mycoba_Myrna: gp256; PP_03902; phage(gi203454817) 5e-61 Click
13complement(3613609..3614082) PHAGE_Mycoba_Myrna: gp256; PP_03903; phage(gi203454817) 8e-59 Click
14complement(3614092..3616236) PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; PP_03904; phage(gi158079505) 0.0 Click
15complement(3616209..3616619) PHAGE_Bacill_SP10: ribonucleotide reductase stimulatory protein; PP_03905; phage(gi418489617) 7e-14 Click
16complement(3616616..3616861) PHAGE_Mycoba_Porky: gp37; PP_03906; phage(gi194303333) 3e-10 Click
17complement(3617070..3617501) hypothetical protein SDY_2865 [Shigella dysenteriae Sd197] gi|82778044|ref|YP_404393.1|; PP_03907 8e-77 Click
183617589..3618923 PHAGE_Strept_TG1: putative regulator, GntR family; PP_03908; phage(gi410491962) 2e-05 Click

Region 18, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13637103..3640855 PHAGE_Prochl_P_RSM4: YadA domain-containing structural protein; PP_03927; phage(gi326782844) 4e-19 Click
23641026..3641466 RhsG core protein [Escherichia coli O157:H7 str. TW14359] gi|254791370|ref|YP_003076207.1|; PP_03928 1e-81 Click
33641447..3641520 tRNA 0.0 Click
43641534..3641610 tRNA 0.0 Click
5complement(3641614..3642471) PHAGE_Entero_HK630: major head subunit E; PP_03929; phage(gi428782795) 2e-158 Click
6complement(3642527..3642859) PHAGE_Entero_HK630: head decoration protein D; PP_03930; phage(gi428782794) 7e-58 Click
7complement(3642869..3644188) PHAGE_Entero_HK630: head maturation protease C; PP_03931; phage(gi428782792) 0.0 Click
8complement(3644169..3645566) PHAGE_Entero_HK630: portal protein B; PP_03932; phage(gi428782791) 0.0 Click
93645823..3646356 PHAGE_Entero_HK630: terminase large subunit A; PP_03933; phage(gi428782789) 5e-41 Click
103646649..3646948 acetyltransferase, gnat family [Escherichia coli O55:H7 str. CB9615] gi|291283111|ref|YP_003499929.1|; PP_03934 4e-53 Click
11complement(3647086..3647982) PHAGE_Acanth_moumouvirus: hypothetical protein; PP_03935; phage(gi441432370) 2e-07 Click
12complement(3647942..3648247) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; PP_03936; phage(gi15832203) 7e-50 Click
13complement(3648290..3648892) PHAGE_Entero_HK630: tail length tape measure protein H; PP_03937; phage(gi428782803) 3e-31 Click
14complement(3648936..3649220) PHAGE_Entero_HK630: tail assembly protein GT; PP_03938; phage(gi428782802) 7e-32 Click
153649263..3649727 PHAGE_Stx2_c_1717: tail tape measure protein; PP_03939; phage(gi209447190) 6e-83 Click
163649720..3650034 PHAGE_Entero_HK630: minor tail protein M; PP_03940; phage(gi428782804) 3e-15 Click
17complement(3650101..3650628) PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_03941; phage(gi148609400) 3e-75 Click
18complement(3650707..3650844) PHAGE_Stx2_c_1717: transposase; PP_03943; phage(gi209447153) 7e-19 Click
193650839..3650976 hypothetical protein EC55989_4657 [Escherichia coli 55989] gi|218697863|ref|YP_002405530.1|; PP_03942 9e-12 Click
20complement(3651236..3652792) PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; PP_03944; phage(gi428782750) 3e-51 Click
21complement(3652779..3652907) PHAGE_Burkho_phiE202: gp27, phage tail protein, P2 GpE family; PP_03945; phage(gi134288776) 4e-05 Click
22complement(3652943..3653308) PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_03946; phage(gi29143760) 2e-06 Click
23complement(3653363..3653875) PROPHAGE_Salmon_Ty2: major tail tube protein; PP_03947; phage(gi29143759) 6e-36 Click
24complement(3653875..3655059) PHAGE_Erwini_ENT90: tail sheath protein; PP_03948; phage(gi431810939) 7e-101 Click
253655039..3655170 hypothetical; PP_03949 0.0 Click
263655217..3655540 PHAGE_Entero_2: P2 gpD-like tail protein; PP_03950; phage(gi169936019) 2e-18 Click
273655897..3656079 PHAGE_Salmon_ST64B: hypothetical protein sb48; PP_03951; phage(gi23505492) 2e-22 Click
28complement(3656207..3656752) PHAGE_Entero_HK630: major tail protein V; PP_03952; phage(gi428782800) 1e-72 Click
29complement(3656812..3657078) PHAGE_Entero_HK630: major head subunit E; PP_03953; phage(gi428782795) 2e-20 Click
30complement(3657136..3657483) PHAGE_Entero_HK630: head decoration protein D; PP_03954; phage(gi428782794) 6e-25 Click
31complement(3657520..3659025) PHAGE_Entero_HK630: head maturation protease C; PP_03955; phage(gi428782792) 4e-108 Click
32complement(3659015..3660607) PHAGE_Entero_HK630: portal protein B; PP_03956; phage(gi428782791) 0.0 Click
33complement(3660604..3660810) PHAGE_Entero_HK630: head-tail connector W; PP_03957; phage(gi428782790) 1e-11 Click
34complement(3660794..3662347) PHAGE_Entero_HK630: terminase large subunit A; PP_03958; phage(gi428782789) 0.0 Click
35complement(3662439..3662723) PHAGE_Entero_HK630: terminase large subunit A; PP_03959; phage(gi428782789) 2e-27 Click
36complement(3662695..3662937) PHAGE_Entero_HK630: terminase small subunit nu1; PP_03960; phage(gi428782788) 2e-13 Click
37complement(3663305..3663424) hypothetical protein ECH74115_B0040 [Escherichia coli O157:H7 str. EC4115] gi|209395600|ref|YP_002268423.1|; PP_03961 9e-15 Click
38complement(3663618..3664190) resolvase [Escherichia coli O157:H7 str. EC4115] gi|209395611|ref|YP_002268421.1|; PP_03962 9e-102 Click
39complement(3664174..3664377) hypothetical protein ECSP_1330 [Escherichia coli O157:H7 str. TW14359] gi|254792413|ref|YP_003077250.1|; PP_03963 1e-28 Click
40complement(3664374..3664649) hypothetical protein ECO26_1362 [Escherichia coli O26:H11 str. 11368] gi|260854513|ref|YP_003228404.1|; PP_03964 2e-44 Click
413665021..3665096 tRNA 0.0 Click
42complement(3665189..3665962) PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_03965; phage(gi414086954) 6e-38 Click
433666052..3666186 hypothetical; PP_03966 0.0 Click
44complement(3666183..3666593) PHAGE_Erwini_phiEaH2: hypothetical protein; PP_03967; phage(gi431810676) 7e-09 Click
45complement(3666609..3667292) hypothetical protein G2583_2517 [Escherichia coli O55:H7 str. CB9615] gi|291283235|ref|YP_003500053.1|; PP_03968 3e-133 Click
463667358..3667576 PROPHAGE_Escher_Sakai: putative tail assembly protein; PP_03969; phage(gi15832199) 4e-12 Click

Region 19, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13688748..3689956 PHAGE_Clostr_phiCD38_2: hypothetical protein; PP_03999; phage(gi333798122) 9e-11 Click
23690208..3690336 tellurium resistance protein TerW [Escherichia coli O26:H11 str. 11368] gi|260854455|ref|YP_003228346.1|; PP_04000 7e-07 Click
33690296..3690442 tellurium resistance protein TerW [Escherichia coli O26:H11 str. 11368] gi|260854455|ref|YP_003228346.1|; PP_04001 4e-17 Click
43690703..3691032 hypothetical protein ECO26_1300 [Escherichia coli O26:H11 str. 11368] gi|260854454|ref|YP_003228345.1|; PP_04002 4e-59 Click
53690998..3691360 PHAGE_Stx2_c_1717: transposase; PP_04003; phage(gi209447152) 2e-11 Click
63691442..3692299 PHAGE_Stx2_c_1717: transposase; PP_04004; phage(gi209447153) 3e-30 Click
7complement(3692303..3692968) PHAGE_Stx2_c_1717: transposase; PP_04005; phage(gi209447153) 3e-49 Click
8complement(3693143..3693985) PHAGE_Prochl_P_SSM7: PRGA-formyltransferase; PP_04006; phage(gi326784531) 1e-17 Click
9complement(3694035..3694433) PHAGE_Sphing_PAU: gp60; PP_04007; phage(gi435844563) 4e-05 Click
103694567..3695511 PHAGE_Acanth_1: hypothetical protein ATCV1_Z612R; PP_04008; phage(gi155371559) 1e-11 Click
113695603..3696616 PHAGE_Feldma_virus: putative sensor histidine kinase; PP_04009; phage(gi197322366) 1e-07 Click
123696818..3697726 PHAGE_Sphing_PAU: gp187; PP_04010; phage(gi435844690) 7e-15 Click
13complement(3697870..3698283) global DNA-binding transcriptional dual regulator H-NS [Shigella sonnei Ss046] gi|74312426|ref|YP_310845.1|; PP_04011 4e-70 Click
14complement(3698374..3698502) hypothetical protein i02_1533 [Escherichia coli str. 'clone D i2'] gi|386629014|ref|YP_006148734.1|; PP_04012 7e-15 Click
153698886..3699503 PHAGE_Pseudo_OBP: putative thymidine kinase; PP_04013; phage(gi371671618) 2e-53 Click

Region 20, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13755880..3755891 attL    GTTATTTTCAGG 0.0 Click
23764898..3765779 PHAGE_Burkho_phi1026b: gp58; PP_04073; phage(gi38707948) 8e-08 Click
33765857..3766645 hypothetical protein Z2176 [Escherichia coli O157:H7 str. EDL933] gi|15801609|ref|NP_287626.1|; PP_04074 2e-151 Click
43766748..3766972 hypothetical protein Z2175 [Escherichia coli O157:H7 str. EDL933] gi|15801608|ref|NP_287625.1|; PP_04075 9e-37 Click
5complement(3767083..3767205) hypothetical protein CE10_1757 [Escherichia coli O7:K1 str. CE10] gi|386624108|ref|YP_006143836.1|; PP_04076 2e-13 Click
63767255..3768238 arabinose transporter [Shigella flexneri 2a str. 301] gi|24112938|ref|NP_707448.1|; PP_04077 1e-168 Click
73768295..3768426 PHAGE_Stx2_c_II: putative transposase; PP_04078; phage(gi302393161) 5e-19 Click
83768404..3768607 PHAGE_Erwini_phiEt88: crossover junction endodeoxyribonuclease; PP_04079; phage(gi327198621) 3e-13 Click
93768604..3769425 PHAGE_Entero_HK225: late gene regulator Q; PP_04080; phage(gi428782441) 5e-92 Click
103769652..3769849 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp55; PP_04081; phage(gi148609437) 8e-09 Click
113770000..3771100 PHAGE_Entero_cdtI: putative DNA methylase; PP_04082; phage(gi148609438) 9e-167 Click
12complement(3771058..3771285) PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_04083; phage(gi148609400) 3e-10 Click
13complement(3771590..3772192) hypothetical protein ECSP_0829 [Escherichia coli O157:H7 str. TW14359] gi|254791927|ref|YP_003076764.1|; PP_04084 4e-115 Click
143772435..3772602 PHAGE_Entero_HK630: hypothetical protein; PP_04085; phage(gi428782816) 7e-29 Click
153772998..3773009 attR    GTTATTTTCAGG 0.0 Click
163773137..3773907 PHAGE_Entero_HK106: integrase; PP_04086; phage(gi428783305) 9e-143 Click

Region 21, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3797353..3798057) PHAGE_Vibrio_KVP40: PnuC; PP_04111; phage(gi34419448) 2e-28 Click
2complement(3798110..3799153) quinolinate synthetase [Escherichia coli O157:H7 str. TW14359] gi|254791900|ref|YP_003076737.1|; PP_04112 0.0 Click
33799458..3800435 PHAGE_Stx2_c_1717: phage head maturation protease; PP_04113; phage(gi209447181) 2e-106 Click
43800480..3800701 PHAGE_Entero_2008: hypothetical protein YYZ_gp53; PP_04114; phage(gi209427801) 5e-35 Click
53800707..3803085 PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; PP_04115; phage(gi302861197) 0.0 Click
63803233..3803415 PHAGE_Escher_P13374: hypothetical protein; PP_04116; phage(gi410491643) 3e-18 Click
73803453..3803722 PHAGE_Stx1_converting: hypothetical protein Stx1_gp76; PP_04117; phage(gi302861198) 1e-26 Click
8complement(3803809..3803925) hypothetical; PP_04118 0.0 Click
9complement(3803956..3804204) phage protein [Escherichia coli SE15] gi|387829945|ref|YP_003349882.1|; PP_04119 4e-42 Click
10complement(3804398..3804619) hypothetical protein i02_2331 [Escherichia coli str. 'clone D i2'] gi|386629795|ref|YP_006149515.1|; PP_04120 1e-36 Click
11complement(3804753..3813128) PHAGE_Stx1_converting: hypothetical protein Stx1_gp23; PP_04121; phage(gi302861144) 0.0 Click
12complement(3813198..3814463) PHAGE_Stx1_converting: hypothetical protein Stx1_gp22; PP_04122; phage(gi302861143) 0.0 Click
13complement(3814474..3814767) PHAGE_Escher_TL_2011c: hypothetical protein; PP_04123; phage(gi418487118) 2e-32 Click
14complement(3814777..3815223) PHAGE_Stx1_converting: hypothetical protein Stx1_gp20; PP_04124; phage(gi302861141) 9e-78 Click
15complement(3815226..3815882) PHAGE_Stx1_converting: hypothetical protein Stx1_gp19; PP_04125; phage(gi302861140) 8e-121 Click
16complement(3815977..3816354) PHAGE_Stx1_converting: hypothetical protein Stx1_gp18; PP_04126; phage(gi302861139) 4e-67 Click
17complement(3816435..3816575) PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_04127; phage(gi410491667) 1e-21 Click
18complement(3816806..3817540) PHAGE_Stx1_converting: outer membrane protein Lom precursor; PP_04128; phage(gi302861138) 8e-139 Click
19complement(3817631..3818248) PHAGE_Stx1_converting: hypothetical protein Stx1_gp16; PP_04129; phage(gi302861137) 4e-122 Click
20complement(3818254..3818532) PHAGE_Stx1_converting: hypothetical protein Stx1_gp15; PP_04130; phage(gi302861136) 1e-50 Click
21complement(3818547..3819761) PHAGE_Stx1_converting: hypothetical protein Stx1_gp14; PP_04131; phage(gi302861135) 0.0 Click
22complement(3819812..3821437) PHAGE_Stx1_converting: hypothetical protein Stx1_gp13; PP_04132; phage(gi302861134) 0.0 Click
23complement(3821552..3821665) hypothetical; PP_04133 0.0 Click
24complement(3821732..3821974) PHAGE_Stx1_converting: hypothetical protein Stx1_gp12; PP_04135; phage(gi302861133) 3e-42 Click
253822074..3823321 PHAGE_Entero_mEp460: host specificity protein; PP_04134; phage(gi428782334) 0.0 Click
26complement(3823394..3824152) PHAGE_Plankt_PaV_LD: ABC transporter; PP_04136; phage(gi371496158) 2e-31 Click
27complement(3824160..3824492) PHAGE_Stx2_c_1717: transposase; PP_04137; phage(gi209447153) 2e-19 Click
28complement(3824584..3825159) D,D-heptose 1,7-bisphosphate phosphatase [Shigella sonnei Ss046] gi|74310821|ref|YP_309240.1|; PP_04138 1e-107 Click
293825347..3826378 PHAGE_Plankt_PaV_LD: ABC transporter; PP_04139; phage(gi371496158) 6e-38 Click

Region 22, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14235827..4236171 PHAGE_Entero_2008: putative tail protein; PP_04531; phage(gi209427787) 3e-45 Click
24236131..4236943 PHAGE_Entero_mEp460: host specificity protein; PP_04532; phage(gi428782334) 1e-142 Click
34237054..4237749 PHAGE_Entero_mEp460: Rz lysis protein; PP_04533; phage(gi428782373) 8e-76 Click
44237737..4237889 PHAGE_Entero_mEp460: hypothetical protein; PP_04534; phage(gi428782374) 1e-21 Click
54238564..4239055 PHAGE_Entero_mEp460: terminase small subunit; PP_04535; phage(gi428782317) 5e-74 Click
64239055..4239465 PHAGE_Entero_mEp460: terminase large subunit; PP_04536; phage(gi428782318) 6e-74 Click
74239536..4241158 PHAGE_Entero_mEp460: terminase large subunit; PP_04537; phage(gi428782318) 0.0 Click
84241155..4241367 PHAGE_Entero_mEp460: hypothetical protein; PP_04538; phage(gi428782319) 8e-35 Click
94241367..4242419 PHAGE_Entero_mEp460: portal protein; PP_04539; phage(gi428782320) 0.0 Click
104242514..4242876 PHAGE_Entero_mEp460: portal protein; PP_04540; phage(gi428782320) 3e-66 Click
114242890..4244848 PHAGE_Entero_mEp460: putative protease/scaffold protein; PP_04541; phage(gi428782321) 0.0 Click
124244935..4245258 PHAGE_Entero_mEp460: hypothetical protein; PP_04542; phage(gi428782322) 1e-54 Click
134245251..4245526 PHAGE_Entero_mEp460: hypothetical protein; PP_04543; phage(gi428782323) 4e-47 Click
144245538..4246116 PHAGE_Entero_mEp460: minor tail protein; PP_04544; phage(gi428782324) 2e-103 Click
154246113..4246514 PHAGE_Entero_mEp460: minor tail protein; PP_04545; phage(gi428782325) 1e-72 Click
164246525..4247268 PHAGE_Entero_mEp460: major tail protein; PP_04546; phage(gi428782326) 4e-137 Click
174247329..4247715 PHAGE_Entero_mEp460: minor tail protein; PP_04547; phage(gi428782327) 1e-64 Click
184247778..4248053 PHAGE_Entero_mEp460: tail assembly protein; PP_04548; phage(gi428782328) 5e-48 Click
194248025..4251090 PHAGE_Entero_mEp460: tail length tape measure protein; PP_04549; phage(gi428782329) 0.0 Click
204251090..4251419 PHAGE_Entero_mEp460: minor tail protein; PP_04550; phage(gi428782330) 2e-61 Click
214251429..4251821 PHAGE_Entero_mEp460: minor tail protein; PP_04551; phage(gi428782331) 2e-52 Click
22complement(4252557..4253270) PHAGE_Entero_mEp234: prophage repressor; PP_04552; phage(gi428782293) 3e-133 Click
234253371..4253571 PHAGE_Entero_HK544: Cro protein; PP_04553; phage(gi428783258) 7e-32 Click
244253846..4253983 PHAGE_Entero_lambda: cII protein; PP_04554; phage(gi9626294) 1e-18 Click
25complement(4254132..4254248) PROPHAGE_Escher_MG1655: predicted transposase; PP_04555; phage(gi16131356) 5e-14 Click

Region 23, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14415942..4415956 attL    TATATATTTTTATTG 0.0 Click
2complement(4425409..4425831) PHAGE_Entero_2008: putative integrase; PP_04714; phage(gi209427727) 2e-48 Click
3complement(4425942..4427186) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; PP_04715; phage(gi169257272) 7e-92 Click
4complement(4427176..4427493) PROPHAGE_Xantho_33913: ISxac3 transposase; PP_04716; phage(gi21231087) 1e-05 Click
5complement(4427587..4428381) phosphomannomutase [Escherichia coli O157:H7 str. TW14359] gi|254793832|ref|YP_003078669.1|; PP_04717 4e-133 Click
64428407..4428565 hypothetical protein i02_2373 [Escherichia coli str. 'clone D i2'] gi|386629837|ref|YP_006149557.1|; PP_04718 7e-20 Click
7complement(4428574..4430010) PHAGE_Acanth_1: hypothetical protein ATCV1_Z752L; PP_04719; phage(gi155371699) 2e-14 Click
8complement(4430013..4431236) glycosyl transferase [Escherichia coli O157:H7 str. TW14359] gi|254793834|ref|YP_003078671.1|; PP_04720 0.0 Click
9complement(4431233..4431712) GDP-mannose mannosyl hydrolase [Shigella flexneri 5 str. 8401] gi|110806018|ref|YP_689538.1|; PP_04721 7e-89 Click
10complement(4431715..4432680) PHAGE_Prochl_P_SSM2: nucleotide-sugar epimerase; PP_04722; phage(gi61806129) 5e-88 Click
11complement(4432683..4433804) PHAGE_Synech_S_SKS1: GDP-D-mannose 4,6-dehydratase; PP_04723; phage(gi472340900) 4e-133 Click
12complement(4433833..4434381) colanic acid biosynthesis acetyltransferase WcaF [Escherichia coli O157:H7 str. TW14359] gi|254793838|ref|YP_003078675.1|; PP_04724 3e-103 Click
13complement(4434397..4435143) glycosyl transferase [Escherichia coli O157:H7 str. TW14359] gi|254793839|ref|YP_003078676.1|; PP_04725 2e-141 Click
14complement(4435154..4436371) colanic acid biosynthesis protein [Escherichia coli O157:H7 str. TW14359] gi|254793840|ref|YP_003078677.1|; PP_04726 0.0 Click
15complement(4436346..4437563) glycosyl transferase [Escherichia coli O157:H7 str. TW14359] gi|254793841|ref|YP_003078678.1|; PP_04727 0.0 Click
16complement(4437560..4438048) colanic acid biosynthesis acetyltransferase WcaB [Shigella sonnei Ss046] gi|74312583|ref|YP_311002.1|; PP_04728 5e-90 Click
17complement(4438051..4438890) PHAGE_Megavi_lba: putative glycosyltransferase; PP_04729; phage(gi448825509) 6e-15 Click
18complement(4438983..4441145) tyrosine kinase [Escherichia coli O157:H7 str. TW14359] gi|254793844|ref|YP_003078681.1|; PP_04730 0.0 Click
19complement(4441148..4441591) tyrosine phosphatase [Shigella sonnei Ss046] gi|74312586|ref|YP_311005.1|; PP_04731 4e-81 Click
20complement(4441597..4442643) polysaccharide export protein [Shigella sonnei Ss046] gi|74312587|ref|YP_311006.1|; PP_04732 0.0 Click
214443395..4444978 transport protein [Escherichia coli O55:H7 str. CB9615] gi|291283303|ref|YP_003500121.1|; PP_04733 0.0 Click
224445053..4445391 PHAGE_Entero_N15: gp49; PP_04734; phage(gi9630516) 3e-08 Click
234445381..4445671 PHAGE_Pseudo_phiKZ: ORF114; PP_04735; phage(gi29135050) 2e-11 Click
24complement(4445724..4447577) assembly protein [Escherichia coli O157:H7 str. TW14359] gi|254793850|ref|YP_003078687.1|; PP_04736 0.0 Click
25complement(4447599..4448180) PHAGE_Halovi_HF1: similar to dCTP deaminases; PP_04737; phage(gi32453882) 3e-18 Click
26complement(4448272..4448913) PHAGE_Acanth_moumouvirus: uridine kinase; PP_04738; phage(gi441432275) 3e-33 Click
274449231..4449764 sensor protein [Escherichia coli O157:H7 str. EDL933] gi|15804978|ref|NP_288575.1|; PP_04739 2e-81 Click
284449754..4452549 PHAGE_Pseudo_YuA: hypothetical protein; PP_04740; phage(gi162135126) 2e-05 Click
29complement(4452650..4453498) 3-methyl-adenine DNA glycosylase II [Escherichia coli O157:H7 str. TW14359] gi|254793853|ref|YP_003078690.1|; PP_04741 7e-164 Click
304453632..4454984 PHAGE_Cafete_BV_PW1: putative DnaK/Hsp70; PP_04742; phage(gi310831393) 2e-10 Click
31complement(4454997..4456937) hypothetical protein ECSP_2827 [Escherichia coli O157:H7 str. TW14359] gi|254793855|ref|YP_003078692.1|; PP_04743 0.0 Click
32complement(4456934..4457695) hypothetical protein ECSP_2828 [Escherichia coli O157:H7 str. TW14359] gi|254793856|ref|YP_003078693.1|; PP_04744 1e-140 Click
33complement(4457692..4458351) hypothetical protein ECSP_2829 [Escherichia coli O157:H7 str. TW14359] gi|254793857|ref|YP_003078694.1|; PP_04745 3e-122 Click
344459566..4460813 multidrug efflux system subunit MdtA [Escherichia coli O157:H7 str. TW14359] gi|254793859|ref|YP_003078696.1|; PP_04746 0.0 Click
354460813..4463935 multidrug efflux system subunit MdtB [Escherichia coli O157:H7 str. TW14359] gi|254793860|ref|YP_003078697.1|; PP_04747 0.0 Click
364463936..4467013 multidrug efflux system subunit MdtC [Escherichia coli O157:H7 str. TW14359] gi|254793861|ref|YP_003078698.1|; PP_04748 0.0 Click
374467014..4468429 multidrug efflux system protein MdtE [Escherichia coli O157:H7 str. TW14359] gi|254793862|ref|YP_003078699.1|; PP_04749 0.0 Click
384468426..4469829 PHAGE_Ectoca_1: EsV-1-65; PP_04750; phage(gi13242537) 2e-13 Click
394469826..4470548 DNA-binding transcriptional regulator BaeR [Escherichia coli O157:H7 str. TW14359] gi|254793864|ref|YP_003078701.1|; PP_04751 4e-134 Click
404470739..4471071 hypothetical protein ECSP_2837 [Escherichia coli O157:H7 str. TW14359] gi|254793865|ref|YP_003078702.1|; PP_04752 4e-55 Click
414471218..4472579 hypothetical protein SSON_2134 [Shigella sonnei Ss046] gi|74312606|ref|YP_311025.1|; PP_04753 0.0 Click
42complement(4472853..4473107) PHAGE_Yersin_413C: Ogr; PP_04754; phage(gi30065732) 2e-45 Click
43complement(4473153..4474316) PHAGE_Yersin_413C: gpD; PP_04755; phage(gi30065731) 0.0 Click
44complement(4474316..4474795) PHAGE_Yersin_413C: gpU; PP_04756; phage(gi30065730) 4e-85 Click
45complement(4474810..4477257) PHAGE_Yersin_413C: gpT; PP_04757; phage(gi30065729) 0.0 Click
46complement(4477250..4477405) PHAGE_Yersin_413C: gpE+E'; PP_04758; phage(gi30065728) 9e-24 Click
47complement(4477402..4477677) PHAGE_Yersin_413C: gpE; PP_04759; phage(gi30065727) 3e-44 Click
48complement(4477734..4478252) PHAGE_Yersin_413C: FII; PP_04760; phage(gi30065726) 6e-93 Click
49complement(4478265..4479455) PHAGE_Yersin_413C: gpFI; PP_04761; phage(gi30065725) 0.0 Click
50complement(4479515..4480108) PHAGE_Entero_2: DNA-invertase; PP_04762; phage(gi169936026) 9e-88 Click
514480159..4480443 PHAGE_Stx2_c_1717: putative tail assembly chaperone; PP_04763; phage(gi209447188) 4e-49 Click
524481287..4481775 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; PP_04764; phage(gi209447169) 2e-68 Click
534481753..4482538 PHAGE_Stx2_c_1717: NinI protein; PP_04765; phage(gi209447164) 2e-110 Click
54complement(4482547..4483767) PHAGE_Lactob_AQ113: phosphoadenosine phosphosulfate reductase; PP_04766; phage(gi446730264) 5e-57 Click
554484876..4484890 attR    TATATATTTTTATTG 0.0 Click

Region 24, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14861019..4861030 attL    CCTTGTGGTTTT 0.0 Click
24868009..4868704 PHAGE_Entero_2008: hypothetical protein YYZ_gp72; PP_05154; phage(gi209427795) 7e-08 Click
3complement(4868739..4868951) plasmid maintenance protein CcdB [Escherichia coli O157:H7 str. EC4115] gi|209395551|ref|YP_002268420.1|; PP_05156 1e-32 Click
44869102..4869227 hypothetical protein ECSP_1443 [Escherichia coli O157:H7 str. TW14359] gi|254792524|ref|YP_003077361.1|; PP_05155 9e-05 Click
5complement(4869930..4870607) tetracycline repressor protein, class A [Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633] gi|194733819|ref|YP_002112913.1|; PP_05157 4e-123 Click
64870686..4871192 PHAGE_Helico_2: membrane transporter; PP_05158; phage(gi370702969) 1e-04 Click
7complement(4871258..4871461) hypothetical; PP_05159 0.0 Click
8complement(4871769..4872590) PHAGE_Entero_2008: phage-related tail protein; PP_05160; phage(gi209427791) 8e-45 Click
94872642..4872758 PHAGE_Entero_2008: hypothetical protein YYZ_gp09; PP_05161; phage(gi209427735) 2e-09 Click
104872913..4873038 hypothetical protein ECO26_1517 [Escherichia coli O26:H11 str. 11368] gi|260854667|ref|YP_003228558.1|; PP_05162 5e-05 Click
114873073..4873444 PHAGE_Entero_2008: putative antirepressor; PP_05163; phage(gi209427770) 2e-67 Click
124873444..4874232 PHAGE_Stx1_converting: hypothetical protein Stx1_gp80; PP_05164; phage(gi302861202) 6e-05 Click
13complement(4874346..4875488) PHAGE_Entero_mEp235: integrase; PP_05165; phage(gi428781836) 5e-61 Click
144875818..4876801 PHAGE_Salmon_vB_SemP_Emek: DNA replication protein; PP_05166; phage(gi399498840) 1e-13 Click
15complement(4877281..4877433) hypothetical protein ECH74115_B0044 [Escherichia coli O157:H7 str. EC4115] gi|209395538|ref|YP_002268426.1|; PP_05167 1e-21 Click
164877389..4878555 PHAGE_Entero_N15: plasmid partition protein SopA; PP_05168; phage(gi9630492) 9e-168 Click
174878555..4879526 PHAGE_Yersin_PY54: partitioning protein SpyB; PP_05169; phage(gi33770536) 9e-91 Click
184883788..4883799 attR    CCTTGTGGTTTT 0.0 Click

Region 25, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14883710..4883721 attL    CTTTTTCCTGCC 0.0 Click
24897811..4898281 PHAGE_Entero_mEp460: hypothetical protein; PP_05195; phage(gi428782365) 6e-38 Click
34898298..4898374 tRNA 0.0 Click
44898417..4898492 tRNA 0.0 Click
5complement(4898912..4899871) systemic factor protein A [Escherichia coli O26:H11 str. 11368] gi|260854026|ref|YP_003227917.1|; PP_05196 0.0 Click
64900345..4901034 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_05197; phage(gi169257244) 3e-81 Click
74901151..4901402 PHAGE_Escher_P13374: lysis protein, lysozyme; PP_05198; phage(gi410491646) 9e-48 Click
84901359..4901487 endolysin [Escherichia coli O55:H7 str. CB9615] gi|291282468|ref|YP_003499286.1|; PP_05199 2e-11 Click
94901562..4901699 hypothetical protein ECS88_1358 [Escherichia coli S88] gi|218558211|ref|YP_002391124.1|; PP_05200 4e-19 Click
104901701..4901982 PHAGE_Escher_TL_2011c: hypothetical protein; PP_05201; phage(gi418487099) 1e-24 Click
11complement(4901979..4902101) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp79; PP_05202; phage(gi209447202) 1e-08 Click
124902333..4902794 PHAGE_Entero_mEp460: minor tail protein; PP_05203; phage(gi428782331) 3e-78 Click
134902869..4903609 PHAGE_Entero_mEp460: tail fiber component; PP_05204; phage(gi428782332) 8e-136 Click
144904324..4904521 PHAGE_Entero_mEp460: host specificity protein; PP_05205; phage(gi428782334) 1e-23 Click
154904509..4904712 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_05206; phage(gi209427766) 2e-30 Click
164904969..4905481 PHAGE_Stx2_c_II: putative antirepressor-like protein; PP_05207; phage(gi302393152) 2e-59 Click
17complement(4905913..4906515) PHAGE_Entero_HK106: tail fiber assembly protein; PP_05208; phage(gi428783304) 1e-95 Click
18complement(4906515..4907834) PHAGE_Salmon_RE_2010: tail fiber protein; PP_05209; phage(gi418489713) 2e-108 Click
19complement(4907831..4908442) PHAGE_Yersin_413C: gpI; PP_05210; phage(gi30065721) 3e-82 Click
20complement(4908435..4909343) PHAGE_Yersin_413C: gpJ; PP_05211; phage(gi30065720) 3e-166 Click
21complement(4909348..4909695) PHAGE_Yersin_413C: gpW; PP_05212; phage(gi30065719) 2e-59 Click
22complement(4909692..4910327) PHAGE_Yersin_413C: gpV; PP_05213; phage(gi30065718) 1e-116 Click
23complement(4910394..4910846) PHAGE_Yersin_413C: gpS; PP_05214; phage(gi30065717) 1e-77 Click
24complement(4910839..4911306) PHAGE_Yersin_413C: gpR; PP_05215; phage(gi30065716) 2e-83 Click
25complement(4911269..4911427) PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_05216; phage(gi431810968) 2e-10 Click
26complement(4911414..4911839) PHAGE_Yersin_413C: LysB; PP_05217; phage(gi30065715) 4e-68 Click
27complement(4911827..4912252) PHAGE_Yersin_413C: LysA; PP_05218; phage(gi30065714) 1e-67 Click
28complement(4912267..4912764) PHAGE_Yersin_413C: gpK; PP_05219; phage(gi30065713) 3e-94 Click
29complement(4912764..4913045) PHAGE_Yersin_413C: gpY; PP_05220; phage(gi30065712) 3e-46 Click
30complement(4913049..4913252) PHAGE_Yersin_413C: gpX; PP_05221; phage(gi30065711) 2e-32 Click
31complement(4913252..4913725) PHAGE_Yersin_413C: gpL; PP_05222; phage(gi30065710) 2e-85 Click
32complement(4913861..4914559) PHAGE_Yersin_413C: gpM; PP_05223; phage(gi30065709) 2e-126 Click
33complement(4914608..4915681) PHAGE_Yersin_413C: gpN; PP_05224; phage(gi30065708) 0.0 Click
34complement(4915740..4915985) PHAGE_Yersin_413C: gpO; PP_05225; phage(gi30065707) 3e-39 Click
35complement(4916002..4916505) PHAGE_Yersin_413C: gpO; PP_05226; phage(gi30065707) 3e-89 Click
364916770..4918542 PHAGE_Yersin_413C: gpP; PP_05227; phage(gi30065706) 0.0 Click
374918588..4919577 PHAGE_Yersin_413C: gpQ; PP_05228; phage(gi30065705) 0.0 Click
38complement(4919616..4919777) hypothetical protein ECSP_2869 [Escherichia coli O157:H7 str. TW14359] gi|254793897|ref|YP_003078734.1|; PP_05229 1e-21 Click
39complement(4919895..4921862) PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; PP_05230; phage(gi9631364) 7e-09 Click
40complement(4922362..4923111) virulence factor [Escherichia coli O157:H7 str. TW14359] gi|254793900|ref|YP_003078737.1|; PP_05231 4e-139 Click
41complement(4923675..4925957) PHAGE_Yersin_413C: gpA; PP_05232; phage(gi30065742) 0.0 Click
42complement(4925947..4926222) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; PP_05233; phage(gi30065741) 1e-46 Click
43complement(4926219..4926443) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; PP_05234; phage(gi30065740) 9e-35 Click
44complement(4926446..4926745) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; PP_05235; phage(gi30065739) 8e-49 Click
45complement(4926745..4926969) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; PP_05236; phage(gi30065738) 1e-32 Click
46complement(4927033..4927533) PHAGE_Yersin_413C: gpB; PP_05237; phage(gi30065737) 8e-94 Click
47complement(4927530..4927700) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; PP_05238; phage(gi30065736) 1e-26 Click
48complement(4927711..4927896) PHAGE_Yersin_413C: Cox; PP_05239; phage(gi30065735) 1e-12 Click
494928523..4929536 PHAGE_Yersin_413C: Int; PP_05240; phage(gi30065733) 1e-91 Click
50complement(4929801..4930061) hypothetical protein SSON_2135 [Shigella sonnei Ss046] gi|74312607|ref|YP_311026.1|; PP_05241 5e-43 Click
514930524..4931423 phosphatidylglycerol kinase, metal-dependent [Escherichia coli W] gi|386609485|ref|YP_006124971.1|; PP_05242 2e-170 Click
52complement(4931505..4932239) galactitol utilization operon repressor [Escherichia coli O157:H7 str. TW14359] gi|254793913|ref|YP_003078750.1|; PP_05243 2e-129 Click
53complement(4932384..4933424) PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; PP_05244; phage(gi326781942) 8e-11 Click
544943325..4943336 attR    CTTTTTCCTGCC 0.0 Click

Region 26, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14996920..4996931 attL    CTCGCAAATTTT 0.0 Click
2complement(5006677..5007336) PHAGE_Camelp_virus: CMLV006; PP_05322; phage(gi18640240) 3e-12 Click
3complement(5007744..5008322) PHAGE_Salmon_ST64B: Integrase protein; PP_05323; phage(gi23505472) 1e-53 Click
4complement(5008358..5008633) PHAGE_Salmon_ST64B: Integrase protein; PP_05324; phage(gi23505472) 5e-13 Click
5complement(5009045..5009338) PHAGE_Entero_2008: phage-related tail protein; PP_05325; phage(gi209427791) 1e-18 Click
65009357..5009560 PHAGE_Entero_2008: putative DNAse; PP_05326; phage(gi209427773) 1e-34 Click
75009817..5010110 hypothetical protein ECSP_1720 [Escherichia coli O157:H7 str. TW14359] gi|254792791|ref|YP_003077628.1|; PP_05327 3e-39 Click
85010146..5010307 PHAGE_Salmon_vB_SosS_Oslo: endopeptidase; PP_05328; phage(gi399528835) 7e-18 Click
95010331..5010555 hypothetical protein ECO26_1493 [Escherichia coli O26:H11 str. 11368] gi|260854643|ref|YP_003228534.1|; PP_05329 2e-35 Click
105010703..5010825 hypothetical protein ECSP_1456 [Escherichia coli O157:H7 str. TW14359] gi|254792537|ref|YP_003077374.1|; PP_05330 8e-16 Click
115010912..5011052 hypothetical protein ECS88_0566 [Escherichia coli S88] gi|218557476|ref|YP_002390389.1|; PP_05331 2e-18 Click
12complement(5011182..5011307) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_05332; phage(gi209427772) 7e-08 Click
13complement(5011304..5013202) trifunctional transcriptional regulator/proline [Escherichia coli str. 'clone D i2'] gi|386628540|ref|YP_006148260.1|; PP_05333 0.0 Click
145013257..5013466 hypothetical protein ECBD_2579 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773955|ref|YP_003036786.1|; PP_05334 2e-31 Click
155013498..5013635 hypothetical protein ECNA114_1087 [Escherichia coli NA114] gi|386618604|ref|YP_006138184.1|; PP_05335 1e-18 Click
165013643..5015133 PHAGE_Aeromo_8t: hypothetical protein 44RRORF234c; PP_05336; phage(gi37651715) 1e-16 Click
175016989..5017000 attR    CTCGCAAATTTT 0.0 Click

Region 27, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15174138..5174150 attL    AAAAAAGAAAAGC 0.0 Click
25187993..5188526 PHAGE_Entero_mEp460: hypothetical protein; PP_05508; phage(gi428782339) 2e-100 Click
35188723..5188896 PHAGE_Entero_mEp460: hypothetical protein; PP_05509; phage(gi428782340) 4e-26 Click
4complement(5188944..5189237) PHAGE_Entero_mEp460: hypothetical protein; PP_05510; phage(gi428782341) 7e-51 Click
5complement(5189262..5189378) PHAGE_Entero_mEp460: putative exonuclease; PP_05511; phage(gi428782342) 2e-16 Click
6complement(5189570..5189767) PHAGE_Entero_mEp460: hypothetical protein; PP_05512; phage(gi428782343) 1e-13 Click
7complement(5189914..5190063) PHAGE_Pectob_ZF40: putative methylase; PP_05513; phage(gi422936660) 2e-17 Click
8complement(5190103..5190342) PHAGE_Salmon_vB_SosS_Oslo: putative DNA methyltransferase; PP_05514; phage(gi399528794) 3e-35 Click
9complement(5190384..5190713) PHAGE_Escher_P13374: hypothetical protein; PP_05515; phage(gi410491610) 4e-38 Click
10complement(5190725..5191261) PHAGE_Entero_mEp460: hypothetical protein; PP_05516; phage(gi428782349) 8e-99 Click
11complement(5191389..5191775) PHAGE_Entero_mEp460: hypothetical protein; PP_05517; phage(gi428782350) 7e-66 Click
125191818..5192051 bacteriophage protein [Escherichia coli O55:H7 str. CB9615] gi|291283793|ref|YP_003500611.1|; PP_05518 4e-38 Click
135192051..5192845 PHAGE_Entero_mEp213: tail fiber; PP_05519; phage(gi428782611) 3e-82 Click
145192845..5193438 PHAGE_Entero_HK106: tail fiber assembly protein; PP_05520; phage(gi428783304) 4e-64 Click
155193548..5193730 PHAGE_Stx2_c_I: endopeptidase; PP_05521; phage(gi20065955) 3e-22 Click
165193708..5193781 tRNA 0.0 Click
17complement(5193786..5193944) PHAGE_Entero_HK633: hypothetical protein; PP_05522; phage(gi428782546) 7e-16 Click
185193943..5195100 PROPHAGE_Escher_Sakai: putative prophage Sf6-like integrase; PP_05523; phage(gi15832485) 0.0 Click
195195120..5195132 attR    AAAAAAGAAAAGC 0.0 Click
20complement(5195275..5196411) PHAGE_Salmon_vB_SemP_Emek: injection protein; PP_05524; phage(gi399498803) 3e-51 Click
21complement(5196421..5197101) PHAGE_Sodali_phiSG1: phage DNA transfer protein; PP_05525; phage(gi89886000) 2e-75 Click
22complement(5197088..5197555) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; PP_05526; phage(gi89885999) 2e-64 Click
23complement(5197555..5198085) PHAGE_Entero_Sf6: gene 9 protein; PP_05527; phage(gi41057287) 9e-92 Click
245198107..5198802 hypothetical protein G2583_2890 [Escherichia coli O55:H7 str. CB9615] gi|291283593|ref|YP_003500411.1|; PP_05528 6e-132 Click
25complement(5199472..5200884) hypothetical protein ECSP_3306 [Escherichia coli O157:H7 str. TW14359] gi|254794320|ref|YP_003079157.1|; PP_05529 0.0 Click
26complement(5201071..5201247) hypothetical protein G2583_2892 [Escherichia coli O55:H7 str. CB9615] gi|291283595|ref|YP_003500413.1|; PP_05530 2e-25 Click
275201550..5202176 PHAGE_Staphy_StB27: integrase; PP_05531; phage(gi431809677) 3e-10 Click

Region 28, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15317900..5318064 PHAGE_Entero_P1: InsA; PP_05649; phage(gi46401643) 3e-07 Click
25318226..5318366 hypothetical protein ECH74115_B0105 [Escherichia coli O157:H7 str. EC4115] gi|209395579|ref|YP_002268481.1|; PP_05650 2e-19 Click
3complement(5318529..5322431) PROPHAGE_Shigel_301: serine protease; PP_05651; phage(gi24114232) 0.0 Click
45322625..5322701 tRNA 0.0 Click
5complement(5322644..5322784) PHAGE_Stx2_c_II: putative tail fiber protein; PP_05652; phage(gi302393091) 7e-08 Click
65322853..5323254 PHAGE_Entero_HK630: hypothetical protein; PP_05653; phage(gi428782842) 2e-73 Click
75323416..5324018 PHAGE_Stx2_c_86: DNA-binding protein Roi; PP_05654; phage(gi116222069) 3e-99 Click
8complement(5325188..5325442) PHAGE_Entero_HK630: minor tail protein L; PP_05655; phage(gi428782805) 1e-09 Click
95325428..5325544 hypothetical protein ECED1_2086 [Escherichia coli ED1a] gi|218689817|ref|YP_002398029.1|; PP_05656 1e-14 Click
105325593..5325712 PHAGE_Entero_HK140: DNA replication protein P; PP_05657; phage(gi428781992) 1e-14 Click
11complement(5325693..5326091) PHAGE_Entero_HK630: minor tail protein U; PP_05658; phage(gi428782799) 6e-57 Click
12complement(5326088..5326621) PHAGE_Entero_HK630: minor tail protein Z; PP_05659; phage(gi428782798) 2e-65 Click
13complement(5326636..5326884) PHAGE_Entero_HK630: head-tail connector Fii; PP_05660; phage(gi428782797) 3e-14 Click
14complement(5327175..5327750) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; PP_05661; phage(gi209427795) 3e-21 Click
155328045..5328296 PHAGE_Stx2_c_1717: truncated transposase; PP_05662; phage(gi209447151) 3e-16 Click
165328497..5331037 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_05663; phage(gi414087138) 3e-17 Click
17complement(5328498..5328582) tRNA 0.0 Click
185331034..5333454 PHAGE_Prochl_P_SSM7: YadA domain-containing structural protein; PP_05664; phage(gi326784580) 2e-11 Click
195333458..5335620 PHAGE_Bacill_SPBc2: ABC transporter; PP_05665; phage(gi9630145) 2e-40 Click