Shigella sonnei 53G gss53G.assembly.100, whole genome shotgun [asmbl_id: NC_000000].5185984, GC%: 50.74%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1..255) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_0002; phage(gi21231087) 4e-06 Click
2265..284 attL    CTTCTGATGCCATTCTATTT 0.0 Click
3271..399 hypothetical protein; SS53G_0003 0.0 Click
4complement(451..726) rac prophage; predicted protein; SS53G_0004 0.0 Click
5complement(811..942) hypothetical protein; SS53G_0005 0.0 Click
6complement(1198..1547) PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; SS53G_0006; phage(gi418487059) 2e-14 Click
71548..2020 PROPHAGE_Escher_CFT073: transposase insF; SS53G_0007; phage(gi26249410) 6e-88 Click
8complement(2082..2399) PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; SS53G_0008; phage(gi418487059) 4e-15 Click
9complement(2488..2721) transposase family protein; SS53G_0009 0.0 Click
102731..2750 attR    CTTCTGATGCCATTCTATTT 0.0 Click
11complement(2798..2953) PHAGE_Salico_CGphi29: hypothetical protein; SS53G_0010; phage(gi472340166) 2e-09 Click
12complement(3369..3518) hypothetical protein; SS53G_0011 0.0 Click
133642..3653 attL    TTTATTGTTGTC 0.0 Click
14complement(3991..5022) PROPHAGE_Escher_EDL933: putative transposase; SS53G_0012; phage(gi15803522) 6e-146 Click
15complement(5167..5322) PHAGE_Salico_CGphi29: hypothetical protein; SS53G_0013; phage(gi472340166) 2e-09 Click
16complement(5628..5795) PHAGE_Entero_mEp237: prophage repressor; SS53G_0014; phage(gi435439304) 1e-07 Click
176383..6805 PHAGE_Entero_mEp237: CII protein; SS53G_0015; phage(gi435439306) 6e-08 Click
186818..8017 PHAGE_Salmon_SPN3UB: PrpO; SS53G_0016; phage(gi423262427) 2e-20 Click
198024..8770 PHAGE_Gifsy_2: bacteriophage DNA replication protein; SS53G_0017; phage(gi169257280) 1e-78 Click
208785..9201 hypothetical protein; SS53G_0018 0.0 Click
21complement(9198..9845) PROPHAGE_Escher_CFT073: transposase insF; SS53G_0019; phage(gi26249410) 2e-123 Click
22complement(9905..10366) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_0020; phage(gi16131317) 9e-78 Click
23complement(10377..10559) PHAGE_Entero_P1: InsA; SS53G_0021; phage(gi46401643) 2e-06 Click
2410779..10955 hypothetical protein; SS53G_0022 0.0 Click
2511268..11633 PHAGE_Entero_HK225: HNH endonuclease; SS53G_0023; phage(gi428782431) 2e-35 Click
2611630..12295 hypothetical protein; SS53G_0024 0.0 Click
2712385..12660 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp44; SS53G_0025; phage(gi116222036) 6e-15 Click
28complement(13504..13881) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_0026; phage(gi16131317) 2e-62 Click
29complement(13892..14104) putative transposase; SS53G_0027 0.0 Click
3014257..14394 hypothetical protein; SS53G_0028 0.0 Click
3114466..15065 PHAGE_Entero_mEp237: hypothetical protein; SS53G_0029; phage(gi435439315) 5e-53 Click
3215065..15355 PHAGE_Entero_mEp237: hypothetical protein; SS53G_0030; phage(gi435439317) 6e-25 Click
3315352..16014 PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; SS53G_0031; phage(gi399528832) 2e-05 Click
3416095..16171 tRNA 0.0 Click
3516173..16249 tRNA 0.0 Click
3616252..16327 tRNA 0.0 Click
3716331..16404 tRNA 0.0 Click
38complement(16628..16929) PROPHAGE_Escher_CFT073: transposase insF; SS53G_0036; phage(gi26249410) 2e-54 Click
39complement(16930..17372) PROPHAGE_Escher_CFT073: transposase insF; SS53G_0037; phage(gi26249410) 1e-83 Click
40complement(17422..17709) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_0038; phage(gi21231087) 1e-06 Click
4117895..18101 PHAGE_Escher_P13374: lysis protein, holin; SS53G_0039; phage(gi410491645) 4e-27 Click
4218101..18598 PHAGE_Stx2_c_1717: phage-related lysozyme; SS53G_0040; phage(gi209447172) 3e-92 Click
4318595..19015 PHAGE_Entero_HK620: endopeptidase; SS53G_0041; phage(gi13559860) 5e-67 Click
4419016..19514 PROPHAGE_Escher_CFT073: transposase insF; SS53G_0042; phage(gi26249410) 8e-94 Click
4520243..20806 PHAGE_Entero_phiP27: hypothetical protein P27p57; SS53G_0043; phage(gi18249921) 1e-86 Click
46complement(21007..21864) chelated iron transport system membrane protein yfeD; SS53G_0044 0.0 Click
47complement(21861..22373) chelated iron transport system membrane protein yfeC; SS53G_0045 0.0 Click
48complement(22385..22717) chelated iron transport system membrane yfeC domain protein; SS53G_0046 0.0 Click
49complement(22714..23541) PHAGE_Plankt_PaV_LD: ABC transporter; SS53G_0047; phage(gi371496158) 5e-13 Click
5030942..30953 attR    TTTATTGTTGTC 0.0 Click

Region 2, total : 72 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1163474..163486 attL    CAGATACAACAAA 0.0 Click
2complement(172386..172604) PHAGE_Entero_Mu: Gin; SS53G_0211; phage(gi9633542) 1e-27 Click
3173975..174700 invasion plasmid antigen domain protein; SS53G_0212 0.0 Click
4174724..175140 60 kDa antigen domain protein; SS53G_0213 0.0 Click
5complement(175319..175882) PHAGE_Entero_phiP27: hypothetical protein P27p57; SS53G_0214; phage(gi18249921) 4e-80 Click
6complement(176585..177484) PHAGE_Entero_Mu: Mom; SS53G_0215; phage(gi9633544) 3e-105 Click
7complement(178194..178448) PHAGE_Escher_TL_2011c: hypothetical protein; SS53G_0216; phage(gi418487098) 4e-08 Click
8complement(178484..178666) PHAGE_Escher_P13374: hypothetical protein; SS53G_0217; phage(gi410491643) 1e-12 Click
9complement(178811..179341) PHAGE_Entero_4795: hypothetical protein YjhS; SS53G_0218; phage(gi157166028) 2e-71 Click
10complement(179338..179889) PHAGE_Entero_4795: hypothetical protein YjhS; SS53G_0219; phage(gi157166028) 2e-49 Click
11complement(179907..180863) PHAGE_Escher_TL_2011c: hypothetical protein; SS53G_0220; phage(gi418487095) 6e-82 Click
12complement(180949..181521) PHAGE_Entero_Mu: Gin; SS53G_0221; phage(gi9633542) 1e-74 Click
13182012..182533 PHAGE_Entero_Mu: tail fiber assembly protein; SS53G_0222; phage(gi19584573) 9e-20 Click
14complement(182597..183445) PHAGE_Entero_Mu: tail fiber; SS53G_0223; phage(gi9633540) 9e-41 Click
15complement(183445..184005) PHAGE_Entero_Mu: hypothetical protein Mup48; SS53G_0224; phage(gi9633539) 2e-45 Click
16complement(183996..184799) PHAGE_Entero_Mu: hypothetical protein Mup47; SS53G_0225; phage(gi9633538) 6e-68 Click
17complement(184799..185077) PHAGE_Entero_Mu: hypothetical protein Mup47; SS53G_0226; phage(gi9633538) 2e-26 Click
18complement(185262..185513) PHAGE_Entero_Mu: hypothetical protein Mup46; SS53G_0227; phage(gi9633537) 3e-28 Click
19complement(185506..186117) PHAGE_Entero_Mu: putative baseplate assembly protein; SS53G_0228; phage(gi9633536) 5e-53 Click
20complement(186110..187234) PHAGE_Entero_Mu: putative tail protein; SS53G_0229; phage(gi9633535) 2e-96 Click
21complement(187218..188576) PHAGE_Entero_Mu: putative DNA circulation protein; SS53G_0230; phage(gi9633534) 2e-69 Click
22complement(188563..189105) PHAGE_Entero_Mu: putative tape measure protein; SS53G_0231; phage(gi9633533) 2e-22 Click
23complement(189102..189359) hypothetical protein; SS53G_0232 0.0 Click
24complement(189356..190618) PHAGE_Entero_Mu: putative tape measure protein; SS53G_0233; phage(gi9633533) 5e-77 Click
25complement(190622..190768) PHAGE_Escher_D108: hypothetical protein; SS53G_0234; phage(gi281199686) 2e-10 Click
26complement(190746..191180) PHAGE_Entero_Mu: hypothetical protein Mup41; SS53G_0235; phage(gi9633532) 5e-24 Click
27complement(191239..191604) PHAGE_Entero_Mu: hypothetical protein Mup40; SS53G_0236; phage(gi9633531) 1e-25 Click
28complement(191613..192425) PHAGE_Entero_Mu: major tail subunit; SS53G_0237; phage(gi9633530) 1e-86 Click
29complement(192527..193114) PHAGE_Entero_Mu: major tail subunit; SS53G_0238; phage(gi9633530) 2e-22 Click
30complement(193114..193392) PHAGE_Entero_Mu: hypothetical protein Mup38; SS53G_0239; phage(gi9633529) 5e-09 Click
31complement(193396..193959) PHAGE_Entero_Mu: hypothetical protein Mup37; SS53G_0240; phage(gi9633528) 1e-34 Click
32complement(193956..194375) PHAGE_Entero_Mu: hypothetical protein Mup36; SS53G_0241; phage(gi9633527) 2e-28 Click
33complement(194372..194485) hypothetical protein; SS53G_0242 0.0 Click
34complement(194769..195692) PHAGE_Entero_Mu: major head subunit; SS53G_0243; phage(gi9633525) 3e-121 Click
35complement(195716..196840) PHAGE_Entero_Mu: putative protease protein; SS53G_0244; phage(gi9633523) 8e-78 Click
36complement(197018..197491) PHAGE_Entero_Mu: putative virion morphogenesis protein; SS53G_0245; phage(gi9633522) 2e-40 Click
37complement(197613..198944) PHAGE_Entero_Mu: virion morphogenesis late F orf; SS53G_0246; phage(gi9633521) 1e-154 Click
38complement(198928..200517) PHAGE_Entero_Mu: hypothetical protein Mup29; SS53G_0247; phage(gi9633520) 1e-170 Click
39complement(200517..202181) PHAGE_Entero_Mu: putative portal protein; SS53G_0248; phage(gi9633519) 0.0 Click
40complement(202181..202330) hypothetical protein; SS53G_0249 0.0 Click
41complement(202440..203021) PHAGE_Entero_Mu: hypothetical protein Mup27; SS53G_0250; phage(gi9633518) 1e-54 Click
42complement(203024..203314) PHAGE_Entero_Mu: hypothetical protein Mup26; SS53G_0251; phage(gi9633517) 3e-27 Click
43complement(203311..203613) PHAGE_Entero_Mu: hypothetical protein Mup25; SS53G_0252; phage(gi9633516) 4e-10 Click
44complement(203832..204050) PHAGE_Entero_SfV: putative Rz1 lytic protein; SS53G_0253; phage(gi19549039) 5e-08 Click
45complement(204034..204432) PHAGE_Entero_SfV: putative Rz lytic protein; SS53G_0254; phage(gi19549038) 8e-06 Click
46complement(204497..204997) PHAGE_Xantho_CP1: hypothetical protein; SS53G_0255; phage(gi431811023) 2e-26 Click
47complement(205069..205491) PHAGE_Entero_Mu: putative transcription regulator; SS53G_0256; phage(gi9633511) 4e-24 Click
48complement(205560..205955) PHAGE_Entero_Mu: hypothetical protein Mup16; SS53G_0257; phage(gi9633506) 7e-15 Click
49206137..206547 hypothetical protein; SS53G_0258 0.0 Click
50complement(206509..206817) hypothetical protein; SS53G_0259 0.0 Click
51complement(206833..207183) hypothetical protein; SS53G_0260 0.0 Click
52complement(207180..207470) hypothetical protein; SS53G_0261 0.0 Click
53complement(207506..208057) PHAGE_Lister_B054: gp65; SS53G_0262; phage(gi157325349) 5e-05 Click
54complement(208061..208576) PHAGE_Entero_Mu: hypothetical protein Mup12; SS53G_0263; phage(gi9633502) 1e-49 Click
55complement(208576..209109) PHAGE_Entero_Mu: hypothetical protein Mup11; SS53G_0264; phage(gi9633501) 2e-68 Click
56complement(209255..209785) PHAGE_Entero_Mu: Gam; SS53G_0265; phage(gi9633500) 5e-52 Click
57complement(209797..210090) hypothetical protein; SS53G_0266 0.0 Click
58complement(210095..210232) hypothetical protein; SS53G_0267 0.0 Click
59complement(210647..210901) hypothetical protein; SS53G_0268 0.0 Click
60complement(210914..211141) hypothetical protein; SS53G_0269 0.0 Click
61complement(211138..212079) PHAGE_Entero_Mu: DNA transposition protein; SS53G_0270; phage(gi9633513) 1e-72 Click
62complement(212153..214243) PROPHAGE_Escher_Sakai: phage transposase; SS53G_0271; phage(gi15834199) 0.0 Click
63214684..215214 hypothetical protein; SS53G_0272 0.0 Click
64complement(215387..216070) PHAGE_Entero_phiP27: putative tail fiber protein; SS53G_0273; phage(gi18249920) 1e-65 Click
65complement(216130..216588) PHAGE_Stx2_c_1717: transposase; SS53G_0274; phage(gi209447153) 2e-70 Click
66complement(216638..216985) PHAGE_Stx2_c_1717: transposase; SS53G_0275; phage(gi209447152) 4e-61 Click
67complement(217224..217937) PROPHAGE_Escher_CFT073: transposase insF; SS53G_0276; phage(gi26249410) 8e-136 Click
68complement(218092..218379) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_0277; phage(gi21231087) 1e-06 Click
69218395..218523 hypothetical protein; SS53G_0278 0.0 Click
70complement(218974..220101) PROPHAGE_Shewan_MR-1: IS110 family transposase; SS53G_0279; phage(gi24375433) 9e-10 Click
71complement(220475..220861) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SS53G_0280; phage(gi157166067) 6e-70 Click
72complement(221005..221358) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SS53G_0281; phage(gi157166067) 1e-36 Click
73complement(221358..221684) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; SS53G_0282; phage(gi157166066) 1e-55 Click
74226849..226861 attR    CAGATACAACAAA 0.0 Click

Region 3, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1233910..234230 integrase, catalytic region; SS53G_0294 0.0 Click
2complement(234522..234809) toxin relE; SS53G_0295 0.0 Click
3complement(234806..234925) hypothetical protein; SS53G_0296 0.0 Click
4complement(235129..235320) hypothetical protein; SS53G_0297 0.0 Click
5complement(236020..236775) incFII family plasmid replication initiator RepA; SS53G_0298 0.0 Click
6complement(237168..237338) replication regulatory protein repA2; SS53G_0299 0.0 Click
7237555..237566 attL    TAATGTGATTTA 0.0 Click
8complement(237668..237922) yihA; SS53G_0300 0.0 Click
9complement(237900..238016) hypothetical protein; SS53G_0301 0.0 Click
10238049..238261 putative transposase; SS53G_0302 0.0 Click
11238272..238775 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_0303; phage(gi16131317) 3e-95 Click
12complement(238769..239035) yihA domain protein; SS53G_0304 0.0 Click
13complement(239074..239283) hemolysin expression-modulating protein; SS53G_0305 0.0 Click
14complement(239329..239790) PHAGE_Cyanop_S_SSM4: endonuclease; SS53G_0306; phage(gi472343315) 1e-08 Click
15complement(240375..240935) fertility inhibition protein; SS53G_0307 0.0 Click
16complement(240990..241286) traX domain protein; SS53G_0308 0.0 Click
17complement(241757..245830) PHAGE_Acinet_ZZ1: Dda DNA helicase; SS53G_0309; phage(gi392973012) 4e-05 Click
18complement(245827..246378) traI domain protein; SS53G_0310 0.0 Click
19247103..247330 plasmid maintenance protein; SS53G_0311 0.0 Click
20247330..247728 PIN domain protein; SS53G_0312 0.0 Click
21complement(247737..247937) traD domain protein; SS53G_0313 0.0 Click
22complement(247940..249877) PHAGE_Cyprin_3: unnamed protein product; SS53G_0314; phage(gi131840088) 1e-06 Click
23complement(249927..250073) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_0315; phage(gi16131317) 4e-19 Click
24complement(250100..250813) PROPHAGE_Escher_CFT073: transposase insF; SS53G_0316; phage(gi26249410) 9e-137 Click
25complement(250954..251256) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_0317; phage(gi21231087) 9e-10 Click
26251310..251321 attL    AGGCTACCTCAG 0.0 Click
27complement(251313..251660) PHAGE_Pseudo_YuA: hypothetical protein; SS53G_0318; phage(gi162135127) 5e-12 Click
28complement(252221..252937) PROPHAGE_Escher_MG1655: IS186 transposase; SS53G_0319; phage(gi90111427) 3e-131 Click
29253029..253232 maturase-related domain protein; SS53G_0320 0.0 Click
30253335..253649 maturase-related domain protein; SS53G_0321 0.0 Click
31complement(253743..254045) PHAGE_Stx2_c_1717: truncated transposase; SS53G_0322; phage(gi209447151) 2e-09 Click
32255108..255629 transposase for insertion sequence element IS21 domain protein; SS53G_0323 0.0 Click
33255629..256411 PHAGE_Bacill_phIS3501: phage replication protein DnaC; SS53G_0324; phage(gi422934308) 4e-08 Click
34256453..256605 PROPHAGE_Escher_CFT073: transposase insC; SS53G_0325; phage(gi26250372) 5e-12 Click
35256634..256819 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_0326; phage(gi17546153) 6e-22 Click
36256777..257682 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_0327; phage(gi16130763) 6e-179 Click
37257817..258080 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; SS53G_0328; phage(gi24111655) 3e-45 Click
38258065..258247 fimG domain protein; SS53G_0329 0.0 Click
39258351..259175 protein fimH; SS53G_0330 0.0 Click
40complement(259164..259802) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_0331; phage(gi16132099) 1e-119 Click
41complement(260111..260509) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_0332; phage(gi16132099) 4e-47 Click
42272203..272214 attR    AGGCTACCTCAG 0.0 Click
43274900..274911 attR    TAATGTGATTTA 0.0 Click

Region 4, total : 57 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(369751..370782) PROPHAGE_Escher_EDL933: putative transposase; SS53G_0461; phage(gi15803522) 6e-146 Click
2complement(370883..371347) PHAGE_Bacill_36: baseplate hub protein; SS53G_0462; phage(gi156564128) 2e-08 Click
3complement(371425..372174) PHAGE_Plankt_PaV_LD: ABC transporter; SS53G_0463; phage(gi371496158) 6e-09 Click
4complement(372174..372725) PHAGE_Mollus_1: MC066L; SS53G_0464; phage(gi19744909) 1e-20 Click
5complement(372788..373768) hemin transport system permease protein hmuU; SS53G_0465 0.0 Click
6373827..373851 attL    AAAGAAAAAAGGCCGCAGAGCGGCC 0.0 Click
7complement(373961..374461) PHAGE_Liberi_SC2: hypothetical protein; SS53G_0466; phage(gi423262534) 4e-11 Click
8complement(374499..374759) hypothetical protein; SS53G_0467 0.0 Click
9complement(375001..375939) PHAGE_Yersin_413C: Int; SS53G_0468; phage(gi30065733) 3e-79 Click
10complement(376028..376180) PHAGE_Yersin_413C: gpC; SS53G_0469; phage(gi30065734) 7e-08 Click
11376728..377066 hypothetical protein; SS53G_0470 0.0 Click
12377077..377364 hypothetical protein; SS53G_0471 0.0 Click
13377376..377618 hypothetical protein; SS53G_0472 0.0 Click
14377615..377728 putative membrane protein; SS53G_0473 0.0 Click
15377815..378018 hypothetical protein; SS53G_0474 0.0 Click
16378015..378260 hypothetical protein; SS53G_0475 0.0 Click
17complement(378237..378377) hypothetical protein; SS53G_0476 0.0 Click
18378402..378767 hypothetical protein; SS53G_0477 0.0 Click
19378774..381596 PHAGE_Yersin_413C: gpA; SS53G_0478; phage(gi30065742) 7e-77 Click
20381673..382446 plasmid segregation protein parM; SS53G_0479 0.0 Click
21382455..382631 partition ParA domain protein; SS53G_0480 0.0 Click
22382756..382947 hypothetical protein; SS53G_0481 0.0 Click
23383167..383532 hypothetical protein; SS53G_0482 0.0 Click
24384261..384389 hypothetical protein; SS53G_0483 0.0 Click
25complement(384458..385504) PHAGE_Erwini_ENT90: phage portal protein; SS53G_0484; phage(gi431810941) 7e-92 Click
26complement(385504..387255) PHAGE_Yersin_413C: gpP; SS53G_0485; phage(gi30065706) 6e-132 Click
27387410..388246 PHAGE_Salmon_RE_2010: capsid scaffolding protein; SS53G_0486; phage(gi418489698) 3e-45 Click
28388270..388452 PHAGE_Mannhe_phiMHaA1: major capsid protein N; SS53G_0487; phage(gi109289940) 4e-07 Click
29388449..389321 PHAGE_Yersin_413C: gpN; SS53G_0488; phage(gi30065708) 5e-60 Click
30389403..390167 PHAGE_Ralsto_phiRSA1: terminase; SS53G_0489; phage(gi145708083) 3e-35 Click
31390275..390763 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); SS53G_0490; phage(gi134288689) 2e-25 Click
32390730..390960 PHAGE_Yersin_413C: gpX; SS53G_0491; phage(gi30065711) 3e-11 Click
33390977..391255 hypothetical protein; SS53G_0492 0.0 Click
34391236..391784 PHAGE_Mannhe_phiMHaA1: endolysin; SS53G_0493; phage(gi109289945) 5e-31 Click
35391781..392254 hypothetical protein; SS53G_0494 0.0 Click
36392326..392793 PHAGE_Yersin_413C: gpR; SS53G_0495; phage(gi30065716) 1e-18 Click
37392786..393421 PHAGE_Pseudo_phiCTX: predicted tail completion; SS53G_0496; phage(gi17313233) 4e-20 Click
38393433..393999 PHAGE_Yersin_413C: gpV; SS53G_0497; phage(gi30065718) 4e-42 Click
39394134..394346 PHAGE_Pseudo_phiCTX: predicted baseplate; SS53G_0498; phage(gi17313236) 3e-08 Click
40394350..395246 PHAGE_Yersin_413C: gpJ; SS53G_0499; phage(gi30065720) 1e-84 Click
41395239..395769 PHAGE_Yersin_413C: gpI; SS53G_0500; phage(gi30065721) 7e-62 Click
42395772..397742 PHAGE_Entero_Mu: tail fiber fragment; SS53G_0501; phage(gi19584574) 0.0 Click
43397745..398278 PHAGE_Entero_Mu: tail fiber assembly protein; SS53G_0502; phage(gi19584573) 8e-99 Click
44complement(398307..398834) PHAGE_Yersin_413C: gpG; SS53G_0503; phage(gi30065723) 3e-85 Click
45complement(398836..399690) PHAGE_Entero_Mu: tail fiber; SS53G_0504; phage(gi9633540) 3e-93 Click
46399926..400513 PHAGE_Escher_D108: G region invertase; SS53G_0505; phage(gi281199698) 2e-85 Click
47complement(400549..401037) PROPHAGE_Salmon_Ty2: putative phage tail protein; SS53G_0506; phage(gi29143763) 8e-38 Click
48complement(401050..403857) PHAGE_Yersin_413C: gpT; SS53G_0507; phage(gi30065729) 2e-100 Click
49complement(403844..403999) PHAGE_Yersin_413C: gpE+E'; SS53G_0508; phage(gi30065728) 7e-07 Click
50complement(404008..404373) PROPHAGE_Salmon_Ty2: putative phage tail protein; SS53G_0509; phage(gi29143760) 2e-06 Click
51complement(404428..404940) PHAGE_Salmon_RE_2010: major tail tube protein; SS53G_0510; phage(gi418489721) 7e-35 Click
52complement(404940..406124) PHAGE_Erwini_ENT90: tail sheath protein; SS53G_0511; phage(gi431810939) 1e-99 Click
53406282..407391 PHAGE_Yersin_413C: gpD; SS53G_0512; phage(gi30065731) 5e-95 Click
54407632..407997 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_0513; phage(gi17546153) 1e-45 Click
55407955..408860 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_0514; phage(gi16130763) 6e-179 Click
56408953..410455 hypothetical protein; SS53G_0515 0.0 Click
57411149..411289 PHAGE_Escher_P13374: prophage host toxic membrane protein; SS53G_0516; phage(gi410491667) 3e-16 Click
58411554..411578 attR    AAAGAAAAAAGGCCGCAGAGCGGCC 0.0 Click
59complement(411596..411895) PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; SS53G_0517; phage(gi9630187) 4e-15 Click

Region 5, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1635956..635968 attL    CTCAAGTAGATGT 0.0 Click
2complement(637820..638197) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_0751; phage(gi16131317) 1e-69 Click
3complement(638494..639204) PROPHAGE_Escher_CFT073: transposase/IS protein; SS53G_0752; phage(gi26248359) 2e-52 Click
4complement(639204..639689) transposase for insertion sequence element IS21 domain protein; SS53G_0753 0.0 Click
5complement(639690..640801) PROPHAGE_Escher_CFT073: transposase; SS53G_0754; phage(gi26248360) 1e-34 Click
6complement(640875..641078) PHAGE_Entero_P1: InsA; SS53G_0755; phage(gi46401643) 5e-30 Click
7642308..642763 PHAGE_Cronob_phiES15: hypothetical protein; SS53G_0756; phage(gi401817579) 2e-60 Click
8642926..643216 PHAGE_Entero_mEp237: hypothetical protein; SS53G_0757; phage(gi435439317) 6e-50 Click
9643213..643575 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; SS53G_0758; phage(gi435439318) 1e-61 Click
10643798..644181 PHAGE_Entero_2008: antitermination protein Q; SS53G_0759; phage(gi209427762) 5e-56 Click
11complement(644370..645452) outer membrane porin protein LC; SS53G_0760 0.0 Click
12complement(645858..646359) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_0761; phage(gi16131317) 1e-94 Click
13complement(646599..646730) hypothetical protein; SS53G_0762 0.0 Click
14646825..647031 PHAGE_Stx2_c_II: holin; SS53G_0763; phage(gi302393164) 1e-27 Click
15647031..647528 PHAGE_Stx2_c_1717: phage-related lysozyme; SS53G_0764; phage(gi209447172) 5e-88 Click
16647525..647983 PHAGE_Entero_mEp235: lysis protein Rz; SS53G_0765; phage(gi428781868) 3e-75 Click
17648185..648682 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp49; SS53G_0766; phage(gi209447174) 4e-93 Click
18648736..648936 PHAGE_Entero_mEp234: hypothetical protein; SS53G_0767; phage(gi428782313) 4e-32 Click
19649608..649619 attL    ATACCAGGAAGG 0.0 Click
20649843..650682 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_0768; phage(gi16130763) 9e-166 Click
21651952..652497 PHAGE_Entero_HK629: terminase small subunit nu1; SS53G_0769; phage(gi428782012) 4e-97 Click
22652606..652617 attR    ATACCAGGAAGG 0.0 Click
23652652..654397 PHAGE_Entero_HK629: terminase large subunit A; SS53G_0770; phage(gi428782013) 0.0 Click
24654394..654600 PHAGE_Entero_HK629: head-tail connector; SS53G_0771; phage(gi428782014) 4e-32 Click
25654597..656198 PHAGE_Entero_HK629: portal protein; SS53G_0772; phage(gi428782015) 0.0 Click
26656179..657498 PHAGE_Entero_HK629: head maturation protease; SS53G_0773; phage(gi428782016) 0.0 Click
27657508..657840 PHAGE_Entero_HK629: head decoration protein; SS53G_0774; phage(gi428782018) 5e-57 Click
28657895..658920 PHAGE_Entero_HK629: major head subunit; SS53G_0775; phage(gi428782019) 0.0 Click
29658962..659360 PHAGE_Entero_HK629: DNA packaging protein Fi; SS53G_0776; phage(gi428782020) 2e-63 Click
30659372..659725 PHAGE_Entero_HK629: head-tail connector Fii; SS53G_0777; phage(gi428782021) 9e-64 Click
31659737..659982 PHAGE_Entero_HK629: minor tail protein; SS53G_0778; phage(gi428782022) 1e-35 Click
32660075..660314 PHAGE_Entero_HK629: minor tail protein; SS53G_0779; phage(gi428782022) 5e-40 Click
33660311..660706 PHAGE_Entero_HK629: minor tail protein; SS53G_0780; phage(gi428782023) 5e-70 Click
34660735..661454 PHAGE_Entero_HK629: major tail protein; SS53G_0781; phage(gi428782024) 3e-131 Click
35661470..661892 PHAGE_Entero_HK629: minor tail protein; SS53G_0782; phage(gi428782025) 2e-73 Click
36661874..662308 PHAGE_Entero_HK629: tail assembly protein; SS53G_0783; phage(gi428782026) 4e-81 Click
37662301..664862 PHAGE_Entero_HK629: tail length tape measure protein; SS53G_0784; phage(gi428782027) 0.0 Click
38664859..665104 PHAGE_Entero_HK629: minor tail protein; SS53G_0785; phage(gi428782028) 3e-32 Click
39665187..665885 PHAGE_Entero_HK629: minor tail protein; SS53G_0786; phage(gi428782029) 3e-133 Click
40666163..666633 PHAGE_Entero_HK629: tail component protein; SS53G_0787; phage(gi428782030) 2e-87 Click
41666630..667202 PHAGE_Entero_HK629: tail component protein; SS53G_0788; phage(gi428782031) 2e-99 Click
42667263..670760 PHAGE_Entero_HK629: tail fiber; SS53G_0789; phage(gi428782032) 0.0 Click
43670831..671313 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; SS53G_0790; phage(gi148609401) 2e-88 Click
44complement(671348..671521) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; SS53G_0791; phage(gi157166059) 2e-29 Click
45complement(671909..672658) PHAGE_Entero_lambda: hypothetical protein lambdap90; SS53G_0792; phage(gi9626267) 2e-56 Click
46672682..672816 hypothetical protein; SS53G_0793 0.0 Click
47672777..674495 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; SS53G_0794; phage(gi16129506) 3e-160 Click
48674507..674635 PHAGE_Entero_HK629: tail fiber assembly protein; SS53G_0795; phage(gi428782036) 3e-15 Click
49674664..675011 PHAGE_Entero_HK629: tail fiber assembly protein; SS53G_0796; phage(gi428782036) 3e-55 Click
50675816..676070 PHAGE_Entero_P1: InsA; SS53G_0797; phage(gi46401643) 2e-43 Click
51676138..676515 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_0798; phage(gi16131317) 5e-70 Click
52complement(677330..677500) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFB protein; SS53G_0799; phage(gi17546154) 1e-17 Click
53complement(677992..679149) PROPHAGE_Escher_MG1655: CPS-53 (KpLE1) prophage; predicted prophage CPS-53 integrase; SS53G_0800; phage(gi16130281) 0.0 Click
54682536..682548 attR    CTCAAGTAGATGT 0.0 Click

Region 6, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1781697..781712 attL    CCGATCATCGAACTGA 0.0 Click
2793604..794554 PHAGE_Staphy_JD007: glycerophosphoryl diester phosphodiesterase; SS53G_0926; phage(gi428783010) 2e-05 Click
3complement(794596..794802) hypothetical protein; SS53G_0927 0.0 Click
4795017..795643 protein inaA; SS53G_0928 0.0 Click
5complement(795720..795974) PHAGE_Pseudo_OBP: putative 2Fe-2S ferredoxin; SS53G_0929; phage(gi371671579) 3e-25 Click
6complement(795974..797104) PHAGE_Salmon_SSU5: putative ribonucleotide-diphosphate reductase, beta subunit; SS53G_0930; phage(gi410491489) 4e-125 Click
7complement(797338..799623) PHAGE_Salmon_SSU5: putative ribonucleotide-diphosphate reductase, alpha subunit; SS53G_0931; phage(gi410491488) 0.0 Click
8complement(801238..802143) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_0932; phage(gi16130763) 6e-179 Click
9complement(802101..802466) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_0933; phage(gi17546153) 1e-45 Click
10802477..805407 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; SS53G_0934; phage(gi414087138) 2e-10 Click
11complement(805535..806257) PHAGE_Microm_12T: hypothetical protein; SS53G_0935; phage(gi472342811) 2e-08 Click
12806404..809031 PHAGE_Lactoc_949: putative DNA gyrase subunit A-topoisomerase; SS53G_0936; phage(gi327197938) 9e-74 Click
13807577..807592 attR    CCGATCATCGAACTGA 0.0 Click

Region 7, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1928933..929427 PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; SS53G_1064; phage(gi163932195) 7e-05 Click
2929420..930346 PHAGE_Plankt_PaV_LD: ABC transporter; SS53G_1065; phage(gi371496158) 1e-24 Click
3930351..931082 inner membrane ABC transporter permease protein yehW; SS53G_1066 0.0 Click
4complement(931230..931877) HTH-type transcriptional regulator mlrA; SS53G_1067 0.0 Click
5931894..931914 attL    CACGCGCGTAACGTGACAGGG 0.0 Click
6complement(931952..933655) PHAGE_Entero_phiP27: putative integrase; SS53G_1068; phage(gi18249865) 4e-131 Click
7complement(933796..934098) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_1069; phage(gi21231087) 9e-10 Click
8934508..934861 PHAGE_Entero_phiP27: putative tail fiber protein; SS53G_1070; phage(gi18249920) 4e-06 Click
9935057..935275 PHAGE_Entero_phiP27: hypothetical protein P27p57; SS53G_1071; phage(gi18249921) 7e-27 Click
10935276..935434 PHAGE_Entero_phiP27: hypothetical protein P27p57; SS53G_1072; phage(gi18249921) 3e-15 Click
11complement(935614..937257) PHAGE_Ostreo_OlV1: hypothetical protein; SS53G_1073; phage(gi313843974) 1e-06 Click
12complement(937572..937745) hypothetical protein; SS53G_1074 0.0 Click
13938296..938565 PHAGE_Entero_HK630: tail fiber assembly protein; SS53G_1075; phage(gi428782810) 8e-22 Click
14938692..939141 transposase family protein; SS53G_1076 0.0 Click
15939123..939827 PROPHAGE_Shewan_MR-1: IS110 family transposase; SS53G_1077; phage(gi24375433) 5e-10 Click
16940277..940576 PHAGE_Entero_P1: InsA; SS53G_1078; phage(gi46401643) 2e-45 Click
17940596..940973 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_1079; phage(gi16131317) 3e-69 Click
18complement(940984..941232) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; SS53G_1080; phage(gi148609412) 3e-40 Click
19941458..941478 attR    CACGCGCGTAACGTGACAGGG 0.0 Click
20941747..943432 PHAGE_Entero_2008: putative 2-component sensor protein YehU; SS53G_1081; phage(gi209427798) 0.0 Click

Region 8, total : 65 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11189146..1189859 PROPHAGE_Escher_CFT073: transposase insF; SS53G_1352; phage(gi26249410) 8e-136 Click
21190057..1190305 hypothetical protein; SS53G_1353 0.0 Click
31190479..1191249 PHAGE_Entero_01: Phage conserved protein; SS53G_1354; phage(gi38707841) 2e-92 Click
4complement(1191282..1192802) PHAGE_Burkho_Bcep22: Bcep22gp06; SS53G_1355; phage(gi158997721) 2e-29 Click
51192893..1193612 PHAGE_Parame_NY2A: hypothetical protein NY2A_B554R; SS53G_1356; phage(gi157952858) 2e-13 Click
61193630..1193642 attL    TCCGACCGGAGGC 0.0 Click
7complement(1193652..1193996) thioesterase superfamily protein; SS53G_1357 0.0 Click
8complement(1194155..1194694) intracellular septation protein A; SS53G_1358 0.0 Click
9complement(1194724..1195467) hypothetical protein; SS53G_1359 0.0 Click
101195824..1196462 outer membrane protein W; SS53G_1360 0.0 Click
11complement(1196495..1196608) PHAGE_Pectob_ZF40: putative integrase; SS53G_1361; phage(gi422936668) 3e-07 Click
121196685..1196696 attL    CGGGCTTTTTTA 0.0 Click
13complement(1196707..1196826) hypothetical protein; SS53G_1362 0.0 Click
14complement(1197014..1197922) PROPHAGE_Escher_CFT073: transposase insF; SS53G_1363; phage(gi26249410) 5e-159 Click
15complement(1198344..1198634) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_1365; phage(gi21231087) 8e-07 Click
161198659..1198698 attL    TATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCA 0.0 Click
17complement(1198864..1199076) hypothetical protein; SS53G_1366 0.0 Click
18complement(1199135..1199638) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_1367; phage(gi16131317) 3e-95 Click
19complement(1199649..1199861) putative transposase; SS53G_1368 0.0 Click
20complement(1199960..1200298) hypothetical protein; SS53G_1369 0.0 Click
211200414..1200716 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_1370; phage(gi21231087) 9e-10 Click
221200857..1201570 PROPHAGE_Escher_CFT073: transposase insF; SS53G_1371; phage(gi26249410) 3e-135 Click
231201582..1201812 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SS53G_1372; phage(gi399498823) 2e-14 Click
241201823..1201990 PHAGE_Salmon_c341: Truncated P22 EaA protein; SS53G_1373; phage(gi255252704) 5e-16 Click
251202098..1202331 PHAGE_Entero_N15: gp45; SS53G_1374; phage(gi9630511) 7e-11 Click
261202998..1203258 hypothetical protein; SS53G_1375 0.0 Click
271203605..1204231 PHAGE_Entero_mEp460: hypothetical protein; SS53G_1376; phage(gi428782365) 7e-52 Click
281204322..1204663 PHAGE_Entero_mEp390: hypothetical protein; SS53G_1377; phage(gi428782709) 3e-33 Click
291204664..1205044 PHAGE_Escher_HK75: RusA-like protein; SS53G_1378; phage(gi356870726) 1e-35 Click
301205041..1205802 PHAGE_Entero_HK225: late gene regulator Q; SS53G_1379; phage(gi428782441) 1e-72 Click
311206086..1206283 PHAGE_Entero_phiP27: hypothetical protein P27p23; SS53G_1380; phage(gi18249887) 2e-31 Click
321206434..1207492 PHAGE_Entero_phiP27: putative DNA methylase; SS53G_1381; phage(gi18249888) 0.0 Click
331207533..1207608 tRNA 0.0 Click
341207616..1207692 tRNA 0.0 Click
351207706..1207782 tRNA 0.0 Click
361208757..1209470 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; SS53G_1385; phage(gi209427766) 2e-117 Click
371209449..1210609 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; SS53G_1386; phage(gi116221995) 0.0 Click
381210759..1210974 PHAGE_Stx2_c_II: holin; SS53G_1387; phage(gi302393164) 4e-35 Click
39complement(1211233..1211364) hypothetical protein; SS53G_1388 0.0 Click
401211515..1211685 hypothetical protein; SS53G_1389 0.0 Click
41complement(1211726..1212439) PROPHAGE_Escher_CFT073: transposase insF; SS53G_1390; phage(gi26249410) 1e-135 Click
42complement(1212580..1212705) putative transposase; SS53G_1391 0.0 Click
43complement(1212660..1212881) transposase family protein; SS53G_1392 0.0 Click
441212906..1212945 attR    TATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCA 0.0 Click
45complement(1212938..1213492) PROPHAGE_Escher_CFT073: transposase/IS protein; SS53G_1393; phage(gi26248359) 6e-35 Click
46complement(1213492..1214664) PROPHAGE_Escher_CFT073: transposase; SS53G_1394; phage(gi26248360) 1e-33 Click
471214855..1215430 PHAGE_Entero_HK630: minor tail protein Z; SS53G_1395; phage(gi428782798) 6e-58 Click
481215454..1215822 PHAGE_Entero_HK630: minor tail protein U; SS53G_1396; phage(gi428782799) 8e-54 Click
491215830..1216582 PHAGE_Entero_HK630: major tail protein V; SS53G_1397; phage(gi428782800) 4e-111 Click
501216596..1217027 PHAGE_Entero_HK630: minor tail protein G; SS53G_1398; phage(gi428782801) 8e-46 Click
511217078..1217467 PHAGE_Entero_HK630: tail assembly protein GT; SS53G_1399; phage(gi428782802) 3e-42 Click
521217448..1220021 PHAGE_Entero_HK630: tail length tape measure protein H; SS53G_1400; phage(gi428782803) 0.0 Click
531220018..1220347 PHAGE_Entero_HK630: minor tail protein M; SS53G_1401; phage(gi428782804) 5e-46 Click
541220347..1221045 PHAGE_Entero_HK630: minor tail protein L; SS53G_1402; phage(gi428782805) 1e-107 Click
551221056..1221799 PHAGE_Entero_4795: putative tail fiber component; SS53G_1403; phage(gi157166055) 2e-149 Click
561221796..1222377 PHAGE_Stx2_c_1717: putative tail component; SS53G_1404; phage(gi209447195) 2e-103 Click
571222719..1222922 PHAGE_Entero_4795: putative tail component; SS53G_1405; phage(gi157166057) 3e-31 Click
581222992..1224635 PHAGE_Entero_HK630: tail fiber J; SS53G_1406; phage(gi428782808) 0.0 Click
591224641..1226170 PHAGE_Entero_HK630: tail fiber J; SS53G_1407; phage(gi428782808) 2e-168 Click
601226238..1226534 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; SS53G_1408; phage(gi148609401) 5e-36 Click
611226510..1226836 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; SS53G_1409; phage(gi148609401) 8e-57 Click
621226962..1226973 attR    CGGGCTTTTTTA 0.0 Click
631227279..1227291 attR    TCCGACCGGAGGC 0.0 Click
64complement(1227462..1228196) PHAGE_Celeri_P12053L: putative phage tail fiber protein; SS53G_1410; phage(gi399528893) 1e-11 Click
651228154..1228366 hypothetical protein; SS53G_1411 0.0 Click
661228327..1229613 PHAGE_Yersin_413C: gpH; SS53G_1412; phage(gi30065722) 2e-121 Click
671229617..1229763 PHAGE_Escher_D108: tail fiber protein; SS53G_1413; phage(gi281199694) 1e-20 Click
681229766..1230299 PHAGE_Escher_D108: tail fiber assembly protein; SS53G_1414; phage(gi281199696) 6e-86 Click
69complement(1230328..1230855) PHAGE_Escher_D108: probable tail fiber assembly protein; SS53G_1415; phage(gi281199695) 8e-82 Click
70complement(1230857..1231699) PHAGE_Entero_phiP27: putative tail fiber protein; SS53G_1416; phage(gi18249918) 5e-39 Click
71complement(1232624..1232797) hypothetical protein; SS53G_1417 0.0 Click
721233693..1233875 putative transposase; SS53G_1418 0.0 Click
731233886..1234389 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_1419; phage(gi16131317) 3e-95 Click
741234509..1234679 PHAGE_Entero_phiP27: hypothetical protein P27p57; SS53G_1420; phage(gi18249921) 3e-10 Click

Region 9, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1325714..1326427) PROPHAGE_Escher_CFT073: transposase insF; SS53G_1529; phage(gi26249410) 8e-136 Click
21326549..1326618 attL    TGTTGTCGCCATTGTTCGATTAACGCGTATTTTTCAGCGACTCCTGTGCAAAATACGCTGTTGCTTTTTT 0.0 Click
3complement(1326582..1326869) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_1530; phage(gi21231087) 1e-06 Click
41326917..1326934 attL    AAACTCAGGCTACCTCAC 0.0 Click
5complement(1327026..1327910) putative pump domain protein; SS53G_1531 0.0 Click
6complement(1328067..1329512) aminobenzoyl-glutamate utilization protein B; SS53G_1532 0.0 Click
7complement(1329512..1330822) aminobenzoyl-glutamate utilization protein A; SS53G_1533 0.0 Click
81330998..1331906 PHAGE_Burkho_phi1026b: gp58; SS53G_1534; phage(gi38707948) 1e-08 Click
91332236..1332799 smr domain protein; SS53G_1535 0.0 Click
10complement(1332820..1334112) PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; SS53G_1536; phage(gi399529005) 3e-06 Click
111334307..1335290 corA-like Mg2+ transporter family protein; SS53G_1537 0.0 Click
121335768..1337141 PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; SS53G_1538; phage(gi310831360) 2e-46 Click
13complement(1337270..1338205) PHAGE_Parame_FR483: hypothetical protein FR483_N404R; SS53G_1539; phage(gi155370502) 3e-08 Click
14complement(1338257..1338712) PHAGE_Entero_4795: putative integrase; SS53G_1540; phage(gi157165986) 9e-41 Click
15complement(1338791..1339504) PROPHAGE_Escher_CFT073: transposase insF; SS53G_1541; phage(gi26249410) 2e-135 Click
16complement(1339645..1339947) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_1542; phage(gi21231087) 9e-10 Click
171339995..1340012 attR    AAACTCAGGCTACCTCAC 0.0 Click
18complement(1340004..1340759) PHAGE_Salmon_1: putative bacteriophage integrase; integrase; phage domain protein; SS53G_1543(gi169257156) 1e-43 Click
19complement(1340761..1340976) hypothetical protein; SS53G_1544 0.0 Click
20complement(1341315..1342292) PHAGE_Cronob_phiES15: hypothetical protein; SS53G_1545; phage(gi401817570) 4e-163 Click
21complement(1342298..1342411) PHAGE_Cronob_phiES15: hypothetical protein; SS53G_1546; phage(gi401817570) 3e-07 Click
221342447..1342620 hypothetical protein; SS53G_1547 0.0 Click
23complement(1342645..1343358) PROPHAGE_Escher_CFT073: transposase insF; SS53G_1548; phage(gi26249410) 2e-135 Click
241343480..1343549 attR    TGTTGTCGCCATTGTTCGATTAACGCGTATTTTTCAGCGACTCCTGTGCAAAATACGCTGTTGCTTTTTT 0.0 Click
25complement(1343513..1343800) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_1549; phage(gi21231087) 1e-06 Click
26complement(1343888..1344247) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_1550; phage(gi16131317) 7e-63 Click
27complement(1344286..1344585) PHAGE_Entero_P1: InsA; SS53G_1551; phage(gi46401643) 2e-45 Click
28complement(1344614..1345138) amino acid permease-associated region domain protein; SS53G_1552 0.0 Click
29complement(1345192..1345800) PROPHAGE_Escher_EDL933: putative transposase; SS53G_1553; phage(gi15803522) 3e-76 Click
30complement(1346007..1346225) PROPHAGE_Escher_CFT073: putative transposase; SS53G_1554; phage(gi26246170) 9e-11 Click

Region 10, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1699571..1700899) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_1936; phage(gi16132099) 0.0 Click
21700917..1700982 attL    GTGAGCGTTTCCGGATTCTTACACAGCCACTGGATCGGTCAACTGATCCTTAACTGATCGGCATTA 0.0 Click
3complement(1701010..1701300) hypothetical protein; SS53G_1937 0.0 Click
4complement(1701290..1701727) polyketide cyclase / dehydrase and lipid transport family protein; SS53G_1938 0.0 Click
51701898..1702380 ssrA-binding protein; SS53G_1939 0.0 Click
61702595..1702956 tRNA 0.0 Click
7complement(1703155..1703532) PHAGE_Entero_phiP27: hypothetical protein P27p57; SS53G_1940; phage(gi18249921) 5e-51 Click
8complement(1703728..1703886) hypothetical protein; SS53G_1941 0.0 Click
9complement(1703856..1704995) PHAGE_Entero_phiP27: putative tail fiber protein; SS53G_1942; phage(gi18249920) 5e-93 Click
10complement(1705019..1705390) PHAGE_Entero_phiP27: putative tail fiber assembly protein; SS53G_1943; phage(gi18249919) 2e-55 Click
11complement(1705567..1706607) PHAGE_Entero_phiP27: putative tail fiber protein; SS53G_1944; phage(gi18249918) 3e-161 Click
12complement(1706594..1707184) PHAGE_Entero_phiP27: hypothetical protein P27p53; SS53G_1945; phage(gi18249917) 2e-114 Click
13complement(1707184..1707342) PHAGE_Entero_phiP27: hypothetical protein P27p52; SS53G_1946; phage(gi18249916) 6e-22 Click
141707737..1708036 PHAGE_Entero_P1: InsA; SS53G_1947; phage(gi46401643) 7e-45 Click
151708056..1708433 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_1948; phage(gi16131317) 5e-70 Click
16complement(1709035..1709265) PHAGE_Entero_phiP27: hypothetical protein P27p51; SS53G_1949; phage(gi18249915) 2e-37 Click
17complement(1709451..1709984) PHAGE_Entero_phiP27: putative baseplate assembly protein; SS53G_1950; phage(gi18249914) 3e-94 Click
18complement(1709962..1711038) PHAGE_Entero_phiP27: putative tail protein; SS53G_1951; phage(gi18249913) 0.0 Click
19complement(1711035..1712426) PHAGE_Entero_phiP27: hypothetical protein P27p48; SS53G_1952; phage(gi18249912) 0.0 Click
20complement(1712473..1712670) hypothetical protein; SS53G_1953 0.0 Click
21complement(1712870..1713373) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_1954; phage(gi16131317) 3e-95 Click
22complement(1713384..1713596) putative transposase; SS53G_1955 0.0 Click
23complement(1713799..1715748) PHAGE_Entero_phiP27: putative tail protein; SS53G_1956; phage(gi18249911) 0.0 Click
24complement(1715763..1716110) PHAGE_Entero_phiP27: hypothetical protein P27p46; SS53G_1957; phage(gi18249910) 2e-32 Click
25complement(1716166..1716522) PHAGE_Entero_phiP27: hypothetical protein P27p45; SS53G_1958; phage(gi18249909) 3e-65 Click
26complement(1716522..1718018) PHAGE_Entero_phiP27: putative sheath protein; SS53G_1959; phage(gi18249908) 0.0 Click
27complement(1718081..1718794) PROPHAGE_Escher_CFT073: transposase insF; SS53G_1960; phage(gi26249410) 9e-137 Click
28complement(1718949..1719236) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_1961; phage(gi21231087) 1e-06 Click
29complement(1719298..1719660) PHAGE_Entero_phiP27: putative prohead protease; SS53G_1962; phage(gi18249903) 4e-60 Click
30complement(1719764..1721110) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_1963; phage(gi16132099) 0.0 Click
311721111..1721176 attR    GTGAGCGTTTCCGGATTCTTACACAGCCACTGGATCGGTCAACTGATCCTTAACTGATCGGCATTA 0.0 Click
32complement(1721214..1721951) outer membrane assembly lipoprotein YfiO; SS53G_1964 0.0 Click
331722164..1723066 ribosomal large subunit pseudouridine synthase D; SS53G_1965 0.0 Click
341723063..1723794 hypothetical protein; SS53G_1966 0.0 Click
351724026..1726497 PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease ATP-binding subunit clpA; SS53G_1967; phage(gi414087147) 1e-74 Click

Region 11, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1780999..1782126) PHAGE_Vibrio_VHML: ORF37; SS53G_2039; phage(gi27311204) 4e-06 Click
2complement(1782139..1782360) PROPHAGE_Escher_CFT073: transposase insF; SS53G_2040; phage(gi26249410) 3e-35 Click
31782366..1782424 attL    GCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCA 0.0 Click
4complement(1782481..1783272) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_2041; phage(gi16130763) 2e-156 Click
5complement(1783277..1783708) PHAGE_Stx2_c_1717: truncated transposase; SS53G_2042; phage(gi209447151) 9e-05 Click
6complement(1783907..1784065) PROPHAGE_Escher_CFT073: transposase insC; SS53G_2043; phage(gi26250372) 1e-10 Click
7complement(1785175..1785447) PHAGE_Entero_P1: InsA; SS53G_2044; phage(gi46401643) 4e-18 Click
81785783..1786016 PROPHAGE_Escher_CFT073: transposase/IS protein; SS53G_2045; phage(gi26248359) 2e-29 Click
9complement(1786068..1786208) N-acetylmuramoyl-L-alanine amidase family domain protein; SS53G_2046 0.0 Click
10complement(1786327..1786578) sugar phosphate transport -like protein; SS53G_2047 0.0 Click
111787084..1787383 PHAGE_Entero_P1: InsA; SS53G_2048; phage(gi46401643) 2e-45 Click
121787403..1787780 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_2049; phage(gi16131317) 5e-70 Click
131787862..1788371 PHAGE_Stx2_c_1717: transposase; SS53G_2050; phage(gi209447153) 2e-11 Click
14complement(1788410..1788595) PROPHAGE_Escher_CFT073: transposase/IS protein; SS53G_2051; phage(gi26248359) 6e-09 Click
15complement(1788596..1789176) PROPHAGE_Escher_CFT073: transposase; SS53G_2052; phage(gi26248360) 1e-11 Click
16complement(1789226..1789705) PROPHAGE_Escher_CFT073: transposase; SS53G_2053; phage(gi26248360) 2e-13 Click
171789746..1789865 hypothetical protein; SS53G_2054 0.0 Click
181789858..1790112 PHAGE_Stx2_c_1717: transposase; SS53G_2055; phage(gi209447153) 3e-10 Click
191790981..1792618 PHAGE_Ostreo_OlV1: hypothetical protein; SS53G_2056; phage(gi313843974) 1e-06 Click
201792934..1793095 yacA; SS53G_2057 0.0 Click
211793776..1793937 ospG domain protein; SS53G_2058 0.0 Click
22complement(1794005..1794133) plasmid mobilization protein; SS53G_2059 0.0 Click
231794623..1795402 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2060; phage(gi16132099) 1e-142 Click
241795457..1795969 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2061; phage(gi16132099) 4e-67 Click
251808254..1808312 attR    GCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCA 0.0 Click

Region 12, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11971678..1971694 attL    TCGCGCCGCATCCGGCA 0.0 Click
21978833..1979645 PHAGE_Strept_Sfi11: putative minor tail protein; SS53G_2265; phage(gi9635024) 9e-06 Click
31979794..1980468 MOSC domain protein; SS53G_2266 0.0 Click
4complement(1980574..1981947) PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; SS53G_2267; phage(gi197322490) 1e-08 Click
5complement(1981944..1982642) PHAGE_Feldma_virus: putative sensor histidine kinase; SS53G_2268; phage(gi197322366) 4e-09 Click
61982792..1983292 LTXXQ motif family protein; SS53G_2269 0.0 Click
7complement(1983477..1983623) PHAGE_Yersin_413C: Int; SS53G_2270; phage(gi30065733) 2e-21 Click
8complement(1983774..1984274) PHAGE_Yersin_413C: Int; SS53G_2271; phage(gi30065733) 2e-87 Click
91984954..1985226 PHAGE_Yersin_413C: Cox; SS53G_2272; phage(gi30065735) 9e-48 Click
101985405..1985896 PHAGE_Yersin_413C: gpB; SS53G_2273; phage(gi30065737) 3e-92 Click
111985960..1986184 PHAGE_Yersin_413C: hypothetical protein L-413Cp34; SS53G_2274; phage(gi30065738) 1e-33 Click
121986184..1986483 PHAGE_Yersin_413C: hypothetical protein L-413Cp35; SS53G_2275; phage(gi30065739) 8e-49 Click
131986486..1986710 PHAGE_Yersin_413C: hypothetical protein L-413Cp36; SS53G_2276; phage(gi30065740) 1e-35 Click
141986707..1986982 PHAGE_Yersin_413C: hypothetical protein L-413Cp37; SS53G_2277; phage(gi30065741) 1e-46 Click
151986972..1989269 PHAGE_Yersin_413C: gpA; SS53G_2278; phage(gi30065742) 0.0 Click
16complement(1990407..1990886) hypothetical protein; SS53G_2279 0.0 Click
17complement(1991089..1992231) PHAGE_Klebsi_KP27: hypothetical protein; SS53G_2280; phage(gi448260717) 6e-09 Click
18complement(1992668..1993429) PHAGE_Yersin_413C: gpQ; SS53G_2281; phage(gi30065705) 5e-127 Click
19complement(1993635..1995407) PHAGE_Yersin_413C: gpP; SS53G_2282; phage(gi30065706) 0.0 Click
201995581..1996435 PHAGE_Yersin_413C: gpO; SS53G_2283; phage(gi30065707) 1e-160 Click
211996494..1997042 PHAGE_Yersin_413C: gpN; SS53G_2284; phage(gi30065708) 1e-96 Click
221997042..1997566 PHAGE_Yersin_413C: gpN; SS53G_2285; phage(gi30065708) 1e-93 Click
231997615..1998313 PHAGE_Yersin_413C: gpM; SS53G_2286; phage(gi30065709) 7e-128 Click
241998413..1998922 PHAGE_Yersin_413C: gpL; SS53G_2287; phage(gi30065710) 8e-92 Click
251999006..1999125 PHAGE_Yersin_413C: gpX; SS53G_2288; phage(gi30065711) 2e-15 Click
261999164..1999409 PHAGE_Yersin_413C: gpY; SS53G_2289; phage(gi30065712) 7e-40 Click
271999409..1999906 PHAGE_Yersin_413C: gpK; SS53G_2290; phage(gi30065713) 1e-93 Click
281999921..2000346 PHAGE_Yersin_413C: LysA; SS53G_2291; phage(gi30065714) 1e-68 Click
292000334..2000759 PHAGE_Yersin_413C: LysB; SS53G_2292; phage(gi30065715) 8e-72 Click
302000731..2000904 PHAGE_Erwini_ENT90: putative host lysis-related protein; SS53G_2293; phage(gi431810968) 4e-12 Click
312000867..2001334 PHAGE_Yersin_413C: gpR; SS53G_2294; phage(gi30065716) 2e-83 Click
322001539..2001778 PHAGE_Yersin_413C: gpS; SS53G_2295; phage(gi30065717) 4e-39 Click
332001845..2002480 PHAGE_Yersin_413C: gpV; SS53G_2296; phage(gi30065718) 8e-118 Click
342002477..2002824 PHAGE_Yersin_413C: gpW; SS53G_2297; phage(gi30065719) 3e-59 Click
352002829..2003737 PHAGE_Yersin_413C: gpJ; SS53G_2298; phage(gi30065720) 1e-166 Click
362003730..2004260 PHAGE_Yersin_413C: gpI; SS53G_2299; phage(gi30065721) 2e-95 Click
372004271..2005203 PHAGE_Yersin_413C: gpH; SS53G_2300; phage(gi30065722) 4e-98 Click
382005254..2006588 PHAGE_Salmon_SSU5: putative phage tail fiber protein; SS53G_2301; phage(gi410491431) 2e-62 Click
392006592..2006738 PHAGE_Yersin_413C: gpG; SS53G_2302; phage(gi30065723) 1e-07 Click
402006774..2007118 PHAGE_Yersin_413C: gpG; SS53G_2303; phage(gi30065723) 4e-48 Click
41complement(2007233..2008651) hypothetical protein; SS53G_2304 0.0 Click
42complement(2008905..2009042) hypothetical protein; SS53G_2305 0.0 Click
432009062..2010252 PHAGE_Yersin_413C: gpFI; SS53G_2306; phage(gi30065725) 0.0 Click
442010265..2010783 PHAGE_Yersin_413C: FII; SS53G_2307; phage(gi30065726) 6e-93 Click
452010840..2011115 PHAGE_Yersin_413C: gpE; SS53G_2308; phage(gi30065727) 1e-43 Click
462011544..2013706 PHAGE_Yersin_413C: gpT; SS53G_2309; phage(gi30065729) 0.0 Click
472013739..2014200 PHAGE_Yersin_413C: gpU; SS53G_2310; phage(gi30065730) 2e-82 Click
482014200..2015363 PHAGE_Yersin_413C: gpD; SS53G_2311; phage(gi30065731) 0.0 Click
49complement(2015702..2017048) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2312; phage(gi16132099) 0.0 Click
502019521..2019537 attR    TCGCGCCGCATCCGGCA 0.0 Click

Region 13, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1992668..1993429) PHAGE_Yersin_413C: gpQ; SS53G_2281; phage(gi30065705) 5e-127 Click
2complement(1993635..1995407) PHAGE_Yersin_413C: gpP; SS53G_2282; phage(gi30065706) 0.0 Click
31995581..1996435 PHAGE_Yersin_413C: gpO; SS53G_2283; phage(gi30065707) 1e-160 Click
41996494..1997042 PHAGE_Yersin_413C: gpN; SS53G_2284; phage(gi30065708) 1e-96 Click
51997042..1997566 PHAGE_Yersin_413C: gpN; SS53G_2285; phage(gi30065708) 1e-93 Click
61997615..1998313 PHAGE_Yersin_413C: gpM; SS53G_2286; phage(gi30065709) 7e-128 Click
71998413..1998922 PHAGE_Yersin_413C: gpL; SS53G_2287; phage(gi30065710) 8e-92 Click
81999006..1999125 PHAGE_Yersin_413C: gpX; SS53G_2288; phage(gi30065711) 2e-15 Click
91999164..1999409 PHAGE_Yersin_413C: gpY; SS53G_2289; phage(gi30065712) 7e-40 Click
101999409..1999906 PHAGE_Yersin_413C: gpK; SS53G_2290; phage(gi30065713) 1e-93 Click
111999921..2000346 PHAGE_Yersin_413C: LysA; SS53G_2291; phage(gi30065714) 1e-68 Click
122000334..2000759 PHAGE_Yersin_413C: LysB; SS53G_2292; phage(gi30065715) 8e-72 Click
132000731..2000904 PHAGE_Erwini_ENT90: putative host lysis-related protein; SS53G_2293; phage(gi431810968) 4e-12 Click
142000867..2001334 PHAGE_Yersin_413C: gpR; SS53G_2294; phage(gi30065716) 2e-83 Click
152001539..2001778 PHAGE_Yersin_413C: gpS; SS53G_2295; phage(gi30065717) 4e-39 Click
162001845..2002480 PHAGE_Yersin_413C: gpV; SS53G_2296; phage(gi30065718) 8e-118 Click
172002477..2002824 PHAGE_Yersin_413C: gpW; SS53G_2297; phage(gi30065719) 3e-59 Click
182002829..2003737 PHAGE_Yersin_413C: gpJ; SS53G_2298; phage(gi30065720) 1e-166 Click
192003730..2004260 PHAGE_Yersin_413C: gpI; SS53G_2299; phage(gi30065721) 2e-95 Click
202004271..2005203 PHAGE_Yersin_413C: gpH; SS53G_2300; phage(gi30065722) 4e-98 Click
212005254..2006588 PHAGE_Salmon_SSU5: putative phage tail fiber protein; SS53G_2301; phage(gi410491431) 2e-62 Click
222006592..2006738 PHAGE_Yersin_413C: gpG; SS53G_2302; phage(gi30065723) 1e-07 Click
232006774..2007118 PHAGE_Yersin_413C: gpG; SS53G_2303; phage(gi30065723) 4e-48 Click
24complement(2007233..2008651) hypothetical protein; SS53G_2304 0.0 Click
25complement(2008905..2009042) hypothetical protein; SS53G_2305 0.0 Click
262009062..2010252 PHAGE_Yersin_413C: gpFI; SS53G_2306; phage(gi30065725) 0.0 Click
272010265..2010783 PHAGE_Yersin_413C: FII; SS53G_2307; phage(gi30065726) 6e-93 Click
282010840..2011115 PHAGE_Yersin_413C: gpE; SS53G_2308; phage(gi30065727) 1e-43 Click
292011544..2013706 PHAGE_Yersin_413C: gpT; SS53G_2309; phage(gi30065729) 0.0 Click
302013739..2014200 PHAGE_Yersin_413C: gpU; SS53G_2310; phage(gi30065730) 2e-82 Click
312014200..2015363 PHAGE_Yersin_413C: gpD; SS53G_2311; phage(gi30065731) 0.0 Click
32complement(2015702..2017048) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2312; phage(gi16132099) 0.0 Click

Region 14, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12160508..2160520 attL    TTATCATTTTTTA 0.0 Click
2complement(2169875..2170036) PROPHAGE_Shewan_MR-1: IS110 family transposase; SS53G_2469; phage(gi24375433) 2e-05 Click
32170128..2170340 putative transposase; SS53G_2470 0.0 Click
42170351..2170478 PHAGE_Entero_P1: InsB; SS53G_2471; phage(gi46401642) 1e-16 Click
5complement(2170479..2171084) PROPHAGE_Escher_EDL933: putative transposase; SS53G_2472; phage(gi15803522) 2e-78 Click
6complement(2171273..2171488) PROPHAGE_Escher_CFT073: putative transposase; SS53G_2473; phage(gi26246170) 2e-16 Click
7complement(2171682..2171819) PROPHAGE_Escher_CFT073: transposase; SS53G_2474; phage(gi26248352) 5e-19 Click
8complement(2172238..2172849) PROPHAGE_Escher_CFT073: transposase; SS53G_2475; phage(gi26248352) 2e-107 Click
9complement(2172992..2173597) PROPHAGE_Escher_EDL933: putative transposase; SS53G_2476; phage(gi15803522) 2e-78 Click
10complement(2173786..2174001) PROPHAGE_Escher_CFT073: putative transposase; SS53G_2477; phage(gi26246170) 2e-16 Click
11complement(2174125..2174317) PHAGE_Entero_P1: InsB; SS53G_2478; phage(gi46401642) 2e-31 Click
12complement(2174328..2174519) putative transposase; SS53G_2479 0.0 Click
132174621..2174851 PROPHAGE_Escher_CFT073: transposase insC; SS53G_2480; phage(gi26250372) 1e-34 Click
142174943..2175848 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_2481; phage(gi16130763) 4e-174 Click
152175883..2175958 tRNA 0.0 Click
162175961..2176038 tRNA 0.0 Click
172176041..2176116 tRNA 0.0 Click
182176120..2176194 tRNA 0.0 Click
192176372..2176668 hypothetical protein; SS53G_2486 0.0 Click
202177095..2177307 putative transposase; SS53G_2487 0.0 Click
212177318..2177872 PHAGE_Entero_P1: InsB; SS53G_2488; phage(gi46401642) 2e-89 Click
222177872..2178084 putative transposase; SS53G_2489 0.0 Click
232178095..2178556 PHAGE_Entero_P1: InsB; SS53G_2490; phage(gi46401642) 6e-80 Click
242181868..2181880 attR    TTATCATTTTTTA 0.0 Click

Region 15, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2282612..2283676) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; SS53G_2612; phage(gi163932195) 1e-05 Click
2complement(2283669..2284871) PHAGE_Plankt_PaV_LD: ABC transporter; SS53G_2613; phage(gi371496158) 3e-24 Click
3complement(2285227..2285679) PHAGE_Mycoba_Myrna: gp256; SS53G_2614; phage(gi203454817) 5e-55 Click
4complement(2285652..2286185) PHAGE_Mycoba_Myrna: gp256; SS53G_2615; phage(gi203454817) 3e-62 Click
5complement(2286195..2288339) PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; SS53G_2616; phage(gi158079505) 0.0 Click
6complement(2288312..2288503) PHAGE_Bacill_phiAGATE: putative ribonucleotide reductase class Ib, NrdI; SS53G_2617; phage(gi448260994) 5e-07 Click
7complement(2288540..2288722) nrdI Flavodoxin like family protein; SS53G_2618 0.0 Click
8complement(2288719..2288904) PHAGE_Rhodoc_REQ2: hypothetical protein; SS53G_2619; phage(gi372449877) 4e-06 Click
9complement(2289211..2289540) hypothetical protein; SS53G_2620 0.0 Click
102289713..2290036 hypothetical protein; SS53G_2621 0.0 Click
11complement(2290073..2290444) hypothetical protein; SS53G_2622 0.0 Click
12complement(2290931..2291107) PROPHAGE_Escher_CFT073: transposase; SS53G_2623; phage(gi26248352) 1e-26 Click
13complement(2291526..2292137) PROPHAGE_Escher_CFT073: transposase; SS53G_2624; phage(gi26248352) 7e-108 Click
142292700..2292843 DNA-binding protein stpA; SS53G_2625 0.0 Click
152292843..2293055 DNA-binding protein stpA; SS53G_2626 0.0 Click
16complement(2293101..2294132) PROPHAGE_Escher_EDL933: putative transposase; SS53G_2627; phage(gi15803522) 6e-146 Click

Region 16, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12305543..2305659 PHAGE_Entero_P1: InsA; SS53G_2640; phage(gi46401643) 5e-17 Click
22305579..2305658 attL    GCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATG 0.0 Click
32305737..2306240 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_2641; phage(gi16131317) 3e-95 Click
42306319..2306618 PHAGE_Entero_P1: InsA; SS53G_2642; phage(gi46401643) 2e-45 Click
52306638..2306907 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_2643; phage(gi16131317) 2e-48 Click
62307075..2307150 tRNA 0.0 Click
7complement(2307476..2307979) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_2645; phage(gi16131317) 3e-95 Click
8complement(2307990..2308202) putative transposase; SS53G_2646 0.0 Click
92308682..2310160 hypothetical protein; SS53G_2647 0.0 Click
10complement(2310390..2310626) hypothetical protein; SS53G_2648 0.0 Click
112310887..2311006 hypothetical protein; SS53G_2649 0.0 Click
122310975..2312450 PHAGE_Parame_AR158: hypothetical protein AR158_C652L; SS53G_2650; phage(gi157953842) 9e-11 Click
132312526..2312891 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_2651; phage(gi17546153) 1e-45 Click
142312849..2313754 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_2652; phage(gi16130763) 1e-172 Click
152313870..2315261 PHAGE_Entero_phiP27: putative helicase; SS53G_2653; phage(gi18249883) 0.0 Click
162315273..2315515 PHAGE_Entero_phiP27: hypothetical protein P27p20; SS53G_2654; phage(gi18249884) 1e-36 Click
172315515..2315886 PHAGE_Escher_HK75: RusA-like protein; SS53G_2655; phage(gi356870726) 2e-38 Click
182316047..2316262 PHAGE_Escher_TL_2011c: putative late gene regulator Q; SS53G_2656; phage(gi418487066) 7e-29 Click
192316653..2317306 PHAGE_Escher_TL_2011c: hypothetical protein; SS53G_2657; phage(gi418487090) 1e-42 Click
202317494..2317570 tRNA 0.0 Click
212317572..2317648 tRNA 0.0 Click
222317651..2317726 tRNA 0.0 Click
232317730..2317804 tRNA 0.0 Click
242317982..2318278 hypothetical protein; SS53G_2662 0.0 Click
252318485..2318700 PHAGE_Escher_TL_2011c: lysis protein S; SS53G_2663; phage(gi418487069) 2e-29 Click
262318700..2318868 PHAGE_Stx2_c_1717: phage-related lysozyme; SS53G_2664; phage(gi209447172) 5e-27 Click
27complement(2320142..2320603) PROPHAGE_Escher_CFT073: transposase/IS protein; SS53G_2665; phage(gi26248359) 1e-07 Click
282330328..2330407 attR    GCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATG 0.0 Click

Region 17, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12313865..2313876 attL    GCTGCATGACAA 0.0 Click
2complement(2325419..2326765) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2673; phage(gi16132099) 0.0 Click
3complement(2326953..2327156) ATP synthase delta chain domain protein; SS53G_2674 0.0 Click
4complement(2327218..2327489) methyltransferase gidB domain protein; SS53G_2675 0.0 Click
52327569..2328915 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2676; phage(gi16132099) 0.0 Click
6complement(2328993..2329901) PROPHAGE_Shewan_MR-1: IS110 family transposase; SS53G_2677; phage(gi24375433) 7e-10 Click
7complement(2329898..2330167) transposase IS111A/IS1328/IS1533; SS53G_2678 0.0 Click
82330263..2330475 putative transposase; SS53G_2679 0.0 Click
92330486..2330989 PHAGE_Entero_P1: InsB; SS53G_2680; phage(gi46401642) 1e-92 Click
10complement(2331020..2331473) PHAGE_Entero_P1: InsB; SS53G_2681; phage(gi46401642) 3e-82 Click
11complement(2331484..2331693) putative transposase; SS53G_2682 0.0 Click
12complement(2331724..2332077) PHAGE_Entero_P1: InsB; SS53G_2683; phage(gi46401642) 6e-65 Click
13complement(2332097..2332396) PHAGE_Entero_P1: InsA; SS53G_2684; phage(gi46401643) 2e-45 Click
14complement(2332483..2333388) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_2685; phage(gi16130763) 6e-179 Click
15complement(2333346..2333711) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_2686; phage(gi17546153) 1e-45 Click
162333990..2334277 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_2687; phage(gi21231087) 8e-07 Click
172334432..2335124 PROPHAGE_Escher_CFT073: transposase insF; SS53G_2688; phage(gi26249410) 6e-133 Click
18complement(2335125..2335939) PROPHAGE_Escher_CFT073: transposase insF; SS53G_2689; phage(gi26249410) 4e-158 Click
19complement(2335976..2336278) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_2690; phage(gi21231087) 9e-10 Click
20complement(2336375..2336752) PHAGE_Entero_P1: InsB; SS53G_2691; phage(gi46401642) 2e-69 Click
21complement(2336772..2337071) PHAGE_Entero_P1: InsA; SS53G_2692; phage(gi46401643) 2e-45 Click
222337382..2337393 attR    GCTGCATGACAA 0.0 Click
232337435..2337638 hypothetical protein; SS53G_2693 0.0 Click
242337648..2338802 glycosyl hydrolases family 31 family protein; SS53G_2694 0.0 Click
252338866..2339264 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2695; phage(gi16132099) 3e-45 Click
262339285..2339641 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2696; phage(gi16132099) 2e-56 Click
272339788..2340210 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2697; phage(gi16132099) 2e-76 Click

Region 18, total : 41 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12524136..2524969 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2881; phage(gi16132099) 1e-153 Click
22525059..2525496 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2882; phage(gi16132099) 2e-73 Click
32525498..2525954 hypothetical protein; SS53G_0001 0.0 Click
42526405..2526881 PHAGE_Entero_HK630: cell lysis protein Rz; SS53G_2883; phage(gi428782852) 4e-73 Click
52527080..2527274 PHAGE_Salmon_ST64B: hypothetical protein sb56; SS53G_2884; phage(gi23505500) 1e-29 Click
62527396..2527890 PHAGE_Salmon_ST64B: terminase small subunit; SS53G_2885; phage(gi23505446) 8e-84 Click
72527887..2529620 PHAGE_Salmon_ST64B: Terminase large subunit; SS53G_2886; phage(gi23505447) 0.0 Click
82529632..2529814 PHAGE_Salmon_ST64B: putative integral membrane protein; SS53G_2887; phage(gi23505448) 7e-29 Click
92529993..2530970 PHAGE_Salmon_ST64B: Portal Protein; SS53G_2888; phage(gi23505449) 6e-172 Click
10complement(2531115..2531459) PHAGE_Stx2_c_1717: phage-related lysozyme; SS53G_2891; phage(gi209447172) 6e-60 Click
112531573..2531709 PROPHAGE_Escher_CFT073: transposase insC; SS53G_2892; phage(gi26250372) 1e-18 Click
12complement(2531710..2532368) PHAGE_Salmon_ST64B: putative antirepressor; SS53G_2893; phage(gi23505485) 3e-49 Click
13complement(2533037..2533240) PHAGE_Cronob_phiES15: hypothetical protein; SS53G_2894; phage(gi401817573) 4e-07 Click
14complement(2533221..2533376) putative transposase; SS53G_2895 0.0 Click
15complement(2533363..2533524) putative transposase; SS53G_2896 0.0 Click
162533525..2533652 hypothetical protein; SS53G_2897 0.0 Click
17complement(2533639..2533863) K88 fimbrial protein A; SS53G_2898 0.0 Click
18complement(2534129..2534273) hypothetical protein; SS53G_2899 0.0 Click
192534337..2534451 ATP synthase C chain domain protein; SS53G_2900 0.0 Click
202534452..2534607 ATP synthase subunit alpha domain protein; SS53G_2901 0.0 Click
21complement(2534608..2534746) inner membrane ygbE domain protein; SS53G_2902 0.0 Click
222534804..2535149 hypothetical protein; SS53G_2903 0.0 Click
23complement(2535150..2535366) transposase for insertion sequence element IS21 domain protein; SS53G_2889 0.0 Click
24complement(2535440..2535844) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SS53G_2890; phage(gi157166067) 4e-69 Click
25complement(2535845..2536041) PHAGE_Erwini_phiEt88: hypothetical protein; SS53G_2904; phage(gi327198620) 6e-22 Click
26complement(2536041..2536412) PHAGE_Pectob_ZF40: hypothetical protein; SS53G_2905; phage(gi422936663) 5e-28 Click
27complement(2536678..2536836) hypothetical protein; SS53G_2906 0.0 Click
28complement(2537598..2538164) hypothetical protein; SS53G_2907 0.0 Click
29complement(2538432..2538788) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; SS53G_2908; phage(gi20065868) 2e-08 Click
30complement(2538846..2539268) hypothetical protein; SS53G_2909 0.0 Click
31complement(2539283..2540029) PHAGE_Gifsy_2: bacteriophage DNA replication protein; SS53G_2910; phage(gi169257280) 1e-79 Click
32complement(2540499..2540840) PHAGE_Escher_TL_2011b: hypothetical protein; SS53G_2911; phage(gi418487646) 3e-39 Click
33complement(2540918..2541223) PHAGE_Pectob_ZF40: putative cII repressor; SS53G_2912; phage(gi422936652) 2e-05 Click
34complement(2541323..2541550) PHAGE_Pectob_ZF40: putative cro anti-repressor; SS53G_2913; phage(gi422936651) 1e-09 Click
352542236..2542384 PHAGE_Salico_CGphi29: hypothetical protein; SS53G_2914; phage(gi472340166) 2e-09 Click
362542385..2542628 transposase domain protein; SS53G_2915 0.0 Click
37complement(2543163..2543438) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; SS53G_2916; phage(gi157166066) 2e-47 Click
382544095..2544787 PHAGE_Strept_TG1: putative regulator, GntR family; SS53G_2917; phage(gi410491962) 6e-05 Click
392544810..2546237 drug resistance MFS transporter, drug:H+ antiporter-1 family protein; SS53G_2918 0.0 Click
40complement(2546203..2547186) bacterial regulatory s, lacI family protein; SS53G_2919 0.0 Click
41complement(2547199..2548128) PHAGE_Synech_S_CAM1: hypothetical protein; SS53G_2920; phage(gi472339598) 2e-05 Click

Region 19, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2550135..2551640) PHAGE_Plankt_PaV_LD: ABC transporter; SS53G_2924; phage(gi371496158) 4e-14 Click
2complement(2551648..2552067) high affinity ribose transport protein rbsD; SS53G_2925 0.0 Click
3complement(2552233..2553843) PHAGE_Parame_FR483: hypothetical protein FR483_N110R; SS53G_2926; phage(gi155370208) 1e-56 Click
4complement(2553849..2554100) PHAGE_Parame_FR483: hypothetical protein FR483_N110R; SS53G_2927; phage(gi155370208) 2e-11 Click
5complement(2554258..2555430) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2928; phage(gi16132099) 0.0 Click
6complement(2555460..2555603) PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2929; phage(gi16132099) 3e-07 Click
72555684..2556115 PHAGE_Stx2_c_1717: phage-related lysozyme; SS53G_2930; phage(gi209447172) 5e-80 Click
82556112..2556582 PHAGE_Entero_HK620: endopeptidase; SS53G_2931; phage(gi13559860) 4e-77 Click
9complement(2556671..2556847) putative membrane protein; SS53G_2932 0.0 Click
10complement(2556954..2557127) hypothetical protein; SS53G_2933 0.0 Click
112557378..2558142 PHAGE_Escher_TL_2011c: putative terminase small subunit; SS53G_2934; phage(gi418487072) 2e-16 Click
122558153..2559496 PHAGE_Psychr_pOW20_A: phage terminase large subunit; SS53G_2935; phage(gi472339822) 4e-152 Click
132559529..2559672 hypothetical protein; SS53G_2936 0.0 Click
142559709..2559873 phage-associated , HI1409 family domain protein; SS53G_2937 0.0 Click
152559880..2560962 PHAGE_Aggreg_S1249: phage-related protein HI1409; SS53G_2938; phage(gi273809569) 2e-35 Click
162561150..2561596 PHAGE_Aggreg_S1249: putative minor head protein; SS53G_2939; phage(gi273809568) 2e-11 Click
172561660..2562820 PHAGE_Aggreg_S1249: hypothetical protein; SS53G_2940; phage(gi273809565) 2e-18 Click
182562824..2563330 hypothetical protein; SS53G_2941 0.0 Click
192563401..2563619 PHAGE_Entero_P1: InsA; SS53G_2942; phage(gi46401643) 8e-39 Click
202563620..2563752 dipeptide transport system permease dppC domain protein; SS53G_2943 0.0 Click
212563956..2564097 PROPHAGE_Escher_CFT073: transposase insF; SS53G_2944; phage(gi26249410) 1e-19 Click
222564183..2564920 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2945; phage(gi16132099) 2e-129 Click
232564889..2565527 PROPHAGE_Escher_MG1655: IS4 transposase; SS53G_2946; phage(gi16132099) 1e-119 Click

Region 20, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12712737..2712748 attL    ACGGGTAATGAC 0.0 Click
2complement(2722589..2723251) PHAGE_Cronob_vB_CsaM_GAP32: putative DNA polymerase III epsilon subunit; SS53G_3126; phage(gi414087193) 4e-17 Click
3complement(2723275..2723700) hypothetical protein; SS53G_3127 0.0 Click
4complement(2724033..2724263) PHAGE_Pectob_ZF40: putative DNA polymerase; SS53G_3128; phage(gi422936677) 6e-17 Click
52724402..2724665 copper resistance CopC family protein; SS53G_3129 0.0 Click
62724779..2725651 copper resistance D family protein; SS53G_3130 0.0 Click
72725667..2726005 PHAGE_Entero_PsP3: gp28; SS53G_3131; phage(gi41057381) 6e-09 Click
8complement(2726358..2727473) PHAGE_Entero_HK106: integrase; SS53G_3132; phage(gi428783305) 9e-48 Click
92727492..2727503 attR    ACGGGTAATGAC 0.0 Click
10complement(2727510..2728013) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_3133; phage(gi16131317) 3e-95 Click
11complement(2728048..2728165) putative transposase; SS53G_3134 0.0 Click
122728170..2728191 attL    TCAGTAAGTTGGCAGCATCACC 0.0 Click
13complement(2728770..2729813) PHAGE_Cronob_phiES15: hypothetical protein; SS53G_3135; phage(gi401817570) 3e-175 Click
142729903..2730076 hypothetical protein; SS53G_3136 0.0 Click
15complement(2730101..2730475) PROPHAGE_Escher_CFT073: transposase insF; SS53G_3137; phage(gi26249410) 3e-68 Click
16complement(2730507..2730815) PROPHAGE_Escher_CFT073: transposase insF; SS53G_3138; phage(gi26249410) 2e-54 Click
172730918..2730971 attL    CATCGCTTCAATGGGAAATTGTTGTCGCCATTGTTCGATTAACGCGTATTTTTC 0.0 Click
18complement(2730956..2731258) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_3139; phage(gi21231087) 9e-10 Click
19complement(2731315..2731479) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; SS53G_3140; phage(gi116222045) 3e-09 Click
202731980..2732267 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_3141; phage(gi21231087) 1e-06 Click
212732422..2733135 PROPHAGE_Escher_CFT073: transposase insF; SS53G_3142; phage(gi26249410) 8e-136 Click
22complement(2733251..2734957) PHAGE_Ostreo_OlV1: hypothetical protein; SS53G_3143; phage(gi313843974) 1e-07 Click
23complement(2735167..2735880) PROPHAGE_Escher_CFT073: transposase insF; SS53G_3144; phage(gi26249410) 8e-136 Click
242735983..2736036 attR    CATCGCTTCAATGGGAAATTGTTGTCGCCATTGTTCGATTAACGCGTATTTTTC 0.0 Click
25complement(2736036..2736323) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_3145; phage(gi21231087) 2e-08 Click
26complement(2737160..2737502) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_3146; phage(gi16131317) 4e-62 Click
27complement(2737503..2737673) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_3147; phage(gi16131317) 3e-28 Click
28complement(2737684..2737896) putative transposase; SS53G_3148 0.0 Click
292737901..2737922 attR    TCAGTAAGTTGGCAGCATCACC 0.0 Click
302738036..2738233 PHAGE_Entero_P1: Ppp; SS53G_3149; phage(gi46401710) 9e-11 Click
312738285..2738587 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_3150; phage(gi21231087) 9e-10 Click
322738728..2739083 PROPHAGE_Escher_CFT073: transposase insF; SS53G_3151; phage(gi26249410) 3e-64 Click
332739365..2739739 PROPHAGE_Escher_CFT073: transposase insF; SS53G_3152; phage(gi26249410) 3e-68 Click
342739751..2739981 PHAGE_Entero_HK106: NinI protein; SS53G_3153; phage(gi428783338) 8e-12 Click
35complement(2739982..2740257) hypothetical protein; SS53G_3154 0.0 Click
36complement(2740278..2740400) hypothetical protein; SS53G_3155 0.0 Click
372740465..2740677 putative transposase; SS53G_3156 0.0 Click
382740688..2741191 PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_3157; phage(gi16131317) 3e-95 Click

Region 21, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12811705..2811717 attL    AGTACTAAAGCCG 0.0 Click
2complement(2811748..2812653) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_3224; phage(gi16130763) 6e-179 Click
3complement(2812611..2812976) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_3225; phage(gi17546153) 1e-45 Click
42813108..2814568 PHAGE_Synech_S_CBS1: large terminase subunit; SS53G_3226; phage(gi356870795) 6e-17 Click
52814868..2815110 hypothetical protein; SS53G_3227 0.0 Click
62815110..2816618 PHAGE_Synech_S_CBS1: lambda-like phage portal protein; SS53G_3228; phage(gi356870797) 1e-26 Click
72816572..2818410 PHAGE_Synech_S_CBS1: major capsid protein; SS53G_3229; phage(gi356870798) 1e-20 Click
82819159..2821810 PHAGE_Entero_mEp235: tail fiber; SS53G_3230; phage(gi428781835) 4e-27 Click
92831562..2831574 attR    AGTACTAAAGCCG 0.0 Click

Region 22, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12814640..2814651 attL    GTACCCGCTGCT 0.0 Click
22828054..2828419 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_3236; phage(gi17546153) 1e-45 Click
32828377..2829282 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_3237; phage(gi16130763) 4e-178 Click
42829257..2830708 PHAGE_Burkho_KS9: tail tip fiber protein gp19; SS53G_3238; phage(gi255033750) 2e-07 Click
52830671..2831609 PHAGE_Entero_HK544: tail fiber; SS53G_3239; phage(gi428783235) 8e-09 Click
6complement(2831615..2832454) PHAGE_Entero_Sf6: putative transposase OrfB; SS53G_3240; phage(gi41057343) 6e-168 Click
7complement(2832481..2832813) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SS53G_3241; phage(gi24373865) 1e-09 Click
82832915..2833131 PROPHAGE_Escher_CFT073: transposase insF; SS53G_3242; phage(gi26249410) 2e-35 Click
9complement(2833132..2833316) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SS53G_3243; phage(gi157166067) 5e-28 Click
10complement(2833401..2833520) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SS53G_3244; phage(gi157166067) 4e-08 Click
11complement(2833527..2833841) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; SS53G_3245; phage(gi157166066) 9e-50 Click
122833978..2834355 PROPHAGE_Escher_CFT073: transposase; SS53G_3246; phage(gi26249432) 1e-38 Click
132834613..2834786 putative transposase; SS53G_3247 0.0 Click
14complement(2836274..2836459) hypothetical protein; SS53G_3248 0.0 Click
152836489..2836602 hypothetical protein; SS53G_3249 0.0 Click
162836682..2836693 attR    GTACCCGCTGCT 0.0 Click
172837072..2837401 PROPHAGE_Escher_MG1655: IS3 transposase A; SS53G_3250; phage(gi226524700) 5e-35 Click

Region 23, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12933273..2933572 PROPHAGE_Escher_MG1655: IS3 transposase A; SS53G_3354; phage(gi226524700) 2e-40 Click
22933569..2934438 PROPHAGE_Escher_MG1655: IS3 transposase B; SS53G_3355; phage(gi16128284) 2e-165 Click
32934777..2935049 PHAGE_Entero_P1: InsA; SS53G_3356; phage(gi46401643) 2e-16 Click
42935246..2935463 PROPHAGE_Escher_CFT073: transposase; SS53G_3357; phage(gi26248360) 3e-35 Click
5complement(2935809..2936086) PHAGE_Entero_P1: InsB; SS53G_3111; phage(gi46401642) 2e-48 Click
62936087..2936366 PROPHAGE_Escher_CFT073: transposase; SS53G_3359; phage(gi26248360) 1e-35 Click
72936608..2937813 PROPHAGE_Escher_CFT073: transposase; SS53G_3360; phage(gi26248352) 0.0 Click
82938086..2939174 PROPHAGE_Shewan_MR-1: IS110 family transposase; SS53G_3361; phage(gi24375433) 9e-10 Click
92939672..2939887 PHAGE_Entero_P1: InsB; SS53G_3362; phage(gi46401642) 7e-11 Click
102939910..2940071 PHAGE_Stx2_c_1717: transposase; SS53G_3363; phage(gi209447153) 2e-06 Click
112940209..2940346 plasmid segregation domain protein; SS53G_3364 0.0 Click
122940376..2941407 PHAGE_Entero_P1: ParA; SS53G_3365; phage(gi46401682) 5e-158 Click
132941407..2942387 PHAGE_Entero_P1: ParB; SS53G_3366; phage(gi46401681) 4e-99 Click
142942643..2943128 PROPHAGE_Shewan_MR-1: IS110 family transposase; SS53G_3367; phage(gi24375433) 5e-24 Click
15complement(2943155..2943298) PHAGE_Stx2_c_1717: transposase; SS53G_3368; phage(gi209447153) 5e-11 Click
16complement(2943417..2943533) reverse transcriptase domain protein; SS53G_3369 0.0 Click
17complement(2943959..2944543) PHAGE_Vibrio_VHML: ORF37; SS53G_3370; phage(gi27311204) 3e-05 Click
182945172..2946344 PROPHAGE_Escher_CFT073: transposase; SS53G_3371; phage(gi26248360) 1e-34 Click
192946344..2947141 PROPHAGE_Escher_CFT073: transposase/IS protein; SS53G_3372; phage(gi26248359) 5e-57 Click
20complement(2947244..2947381) PHAGE_Stx2_c_1717: transposase; SS53G_3373; phage(gi209447153) 9e-11 Click
21complement(2947469..2947675) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SS53G_3374; phage(gi157166067) 1e-34 Click
22complement(2947636..2948358) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; SS53G_3375; phage(gi157166067) 8e-117 Click
23complement(2948355..2948630) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; SS53G_3376; phage(gi157166066) 6e-46 Click

Region 24, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3010926..3011285) PHAGE_Yersin_phiR1_RT: Phage protein; SS53G_3451; phage(gi431809014) 2e-09 Click
23011367..3011816 PHAGE_Cronob_vB_CsaM_GAP32: baseplate hub subunit and tail lysozyme; SS53G_3452; phage(gi414087152) 4e-28 Click
3complement(3011855..3012127) hypothetical protein; SS53G_3453 0.0 Click
4complement(3012178..3012555) PHAGE_Cronob_ENT39118: hypothetical protein; SS53G_3454; phage(gi431811062) 3e-14 Click
5complement(3012836..3012997) hypothetical protein; SS53G_3455 0.0 Click
6complement(3013290..3013592) PHAGE_Cronob_ENT39118: phage tail protein; SS53G_3456; phage(gi431811044) 1e-20 Click
73013848..3014150 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; SS53G_3457; phage(gi24373865) 1e-09 Click
83014337..3015014 PHAGE_Entero_Sf6: putative transposase OrfB; SS53G_3458; phage(gi41057343) 4e-137 Click
9complement(3015529..3016140) PHAGE_Plankt_PaV_LD: ABC transporter; SS53G_3459; phage(gi371496158) 2e-08 Click

Region 25, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13406355..3406369 attL    ACGCCGCATCCGGCA 0.0 Click
2complement(3407803..3408873) PHAGE_Entero_HK106: integrase; SS53G_3887; phage(gi428783305) 0.0 Click
3complement(3409154..3409690) PHAGE_Stx2_c_86: phage anti-repressor protein AntB; SS53G_3888; phage(gi116222034) 2e-82 Click
4complement(3410099..3410821) PHAGE_Entero_P1: Ant2; SS53G_3889; phage(gi46401670) 2e-29 Click
5complement(3410900..3411430) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF5; SS53G_3890; phage(gi157165990) 1e-46 Click
6complement(3411648..3412361) PROPHAGE_Escher_CFT073: transposase insF; SS53G_3891; phage(gi26249410) 8e-136 Click
7complement(3412502..3412804) PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_3892; phage(gi21231087) 9e-10 Click
83412907..3414073 PHAGE_Entero_phiP27: putative tail fiber protein; SS53G_3893; phage(gi18249920) 2e-75 Click
93414268..3414645 PHAGE_Entero_phiP27: hypothetical protein P27p57; SS53G_3894; phage(gi18249921) 1e-50 Click
10complement(3414825..3416588) PHAGE_Gifsy_1: leucine-rich repeat protein; SS53G_3895; phage(gi169257209) 3e-10 Click
11complement(3417170..3417646) hypothetical protein; SS53G_3896 0.0 Click
12complement(3417705..3418937) PHAGE_Mycoba_Myrna: gp183; SS53G_3897; phage(gi203454746) 8e-07 Click
133425395..3425409 attR    ACGCCGCATCCGGCA 0.0 Click

Region 26, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13821466..3821481 attL    CGGGCTTTCTCTTCTT 0.0 Click
2complement(3828277..3828681) PHAGE_Entero_HK629: putative envelope protein; SS53G_4332; phage(gi428782079) 2e-29 Click
3complement(3828902..3829633) HTH-type transcriptional regulator mlrA; SS53G_4333 0.0 Click
4complement(3829838..3830314) EAL domain protein; SS53G_4334 0.0 Click
5complement(3830437..3831033) sensors of blue-light using FAD family protein; SS53G_4335 0.0 Click
63831094..3831393 PHAGE_Entero_P1: InsA; SS53G_4336; phage(gi46401643) 2e-45 Click
73831413..3831790 PHAGE_Entero_P1: InsB; SS53G_4337; phage(gi46401642) 2e-69 Click
83831937..3832113 hypothetical protein; SS53G_4338 0.0 Click
93832209..3832574 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_4339; phage(gi17546153) 1e-45 Click
103832532..3833437 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_4340; phage(gi16130763) 2e-173 Click
11complement(3833601..3833936) hypothetical protein; SS53G_4341 0.0 Click
12complement(3833940..3834224) PHAGE_Lister_A511: gp97; SS53G_4342; phage(gi157325052) 8e-06 Click
133848882..3848897 attR    CGGGCTTTCTCTTCTT 0.0 Click

Region 27, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13831270..3831349 attL    GGCCATGAATGGCGTTGGATGCCGGGCAACTGCACGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAA 0.0 Click
23841793..3842212 PHAGE_Cronob_ENT39118: protein umuD; SS53G_4353; phage(gi431811072) 1e-31 Click
33842212..3842727 PHAGE_Cronob_ENT39118: DNA polymerase; SS53G_4354; phage(gi431811050) 4e-64 Click
4complement(3842722..3842892) PROPHAGE_Escher_CFT073: transposase; SS53G_4355; phage(gi26248352) 1e-25 Click
53843089..3843217 DNA replication protein; SS53G_4356 0.0 Click
6complement(3843523..3843684) PROPHAGE_Escher_CFT073: transposase; SS53G_4357; phage(gi26248352) 8e-17 Click
73843917..3844696 PHAGE_Cronob_ENT39118: DNA polymerase; SS53G_4358; phage(gi431811050) 5e-113 Click
8complement(3844742..3845272) PHAGE_Bacill_SPBc2: putative disulfide oxidoreductase; SS53G_4359; phage(gi9630148) 1e-05 Click
9complement(3845418..3846959) na+/H+ antiporter NhaB; SS53G_4360 0.0 Click
103847180..3847899 fatty acid metabolism transcriptional regulator FadR; SS53G_4361 0.0 Click
11complement(3847951..3849381) PHAGE_Thermu_TMA: SpoVR; SS53G_4362; phage(gi343960437) 1e-09 Click
123849839..3851110 FAD dependent oxidoreductase family protein; SS53G_4363 0.0 Click
133851120..3852190 alanine racemase; SS53G_4364 0.0 Click
143852294..3852443 hypothetical protein; SS53G_4365 0.0 Click
15complement(3852577..3854313) PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; SS53G_4366; phage(gi163932195) 2e-05 Click
16complement(3854408..3855322) muramoyltetrapeptide carboxypeptidase; SS53G_4367 0.0 Click
173855530..3856033 PHAGE_Entero_phiEco32: internal virion protein; SS53G_4368; phage(gi167583577) 4e-05 Click
18complement(3856035..3856769) pilZ domain protein; SS53G_4369 0.0 Click
193856970..3857191 transglycosylase associated family protein; SS53G_4370 0.0 Click
203857243..3857530 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_4371; phage(gi21231087) 1e-06 Click
213857685..3858398 PROPHAGE_Escher_CFT073: transposase insF; SS53G_4372; phage(gi26249410) 8e-136 Click
223861998..3862077 attR    GGCCATGAATGGCGTTGGATGCCGGGCAACTGCACGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAA 0.0 Click

Region 28, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13918088..3918102 attL    TGATTGCAATAAAAA 0.0 Click
23922931..3923218 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_4448; phage(gi21231087) 1e-06 Click
33923324..3923378 attL    ACCCTCAGACAGAAAACAAAGTGATGAGCGGCTAAAACTGGAGATTAAGGTGGCA 0.0 Click
43923377..3923775 PROPHAGE_Escher_CFT073: transposase insF; SS53G_4449; phage(gi26249410) 9e-74 Click
5complement(3923786..3924289) PROPHAGE_Escher_MG1655: IS1 transposase B; SS53G_4450; phage(gi16131317) 2e-94 Click
63924798..3924947 hypothetical protein; SS53G_4451 0.0 Click
73925223..3925408 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; SS53G_4452; phage(gi209447168) 4e-21 Click
8complement(3925689..3925820) putative membrane protein; SS53G_4453 0.0 Click
9complement(3926320..3926396) tRNA 0.0 Click
10complement(3926497..3926572) tRNA 0.0 Click
11complement(3926675..3927529) PHAGE_Entero_HK225: late gene regulator Q; SS53G_4456; phage(gi428782441) 5e-89 Click
12complement(3927526..3927900) PHAGE_Escher_HK75: RusA-like protein; SS53G_4457; phage(gi356870726) 5e-36 Click
13complement(3927900..3928142) PHAGE_Entero_phiP27: hypothetical protein P27p20; SS53G_4458; phage(gi18249884) 4e-37 Click
143928369..3928482 PROPHAGE_Escher_CFT073: transposase insC; SS53G_4459; phage(gi26250372) 1e-05 Click
15complement(3928492..3929289) PROPHAGE_Escher_CFT073: transposase/IS protein; SS53G_4460; phage(gi26248359) 5e-57 Click
16complement(3929289..3930461) PROPHAGE_Escher_CFT073: transposase; SS53G_4461; phage(gi26248360) 1e-34 Click
173930480..3930752 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SS53G_4462; phage(gi17546153) 4e-32 Click
183930710..3931615 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_4463; phage(gi16130763) 6e-179 Click
193931732..3932034 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_4464; phage(gi21231087) 9e-10 Click
203932127..3932181 attR    ACCCTCAGACAGAAAACAAAGTGATGAGCGGCTAAAACTGGAGATTAAGGTGGCA 0.0 Click
213932176..3932889 PROPHAGE_Escher_CFT073: transposase insF; SS53G_4465; phage(gi26249410) 8e-136 Click
223932949..3933869 PHAGE_Entero_phiP27: putative tail fiber protein; SS53G_4466; phage(gi18249920) 9e-40 Click
233934065..3934442 PHAGE_Entero_phiP27: hypothetical protein P27p57; SS53G_4467; phage(gi18249921) 1e-50 Click
24complement(3934540..3936291) PHAGE_Gifsy_1: leucine-rich repeat protein; SS53G_4468; phage(gi169257209) 2e-10 Click
25complement(3936892..3937140) PHAGE_Entero_mEp460: DinI-like protein; SS53G_4469; phage(gi428782337) 1e-41 Click
263937297..3937413 hypothetical protein; SS53G_4470 0.0 Click
27complement(3937495..3938061) isochorismatase family protein; SS53G_4471 0.0 Click
283938410..3938667 OB-fold nucleic acid binding domain protein; SS53G_4472 0.0 Click
293938628..3940142 PHAGE_Acanth_moumouvirus: asparaginyl t-RNA synthetase; SS53G_4473; phage(gi441432571) 2e-07 Click
303949815..3949829 attR    TGATTGCAATAAAAA 0.0 Click

Region 29, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14715747..4715758 attL    GTATTGCCTGGA 0.0 Click
24716632..4717111 PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; SS53G_5359; phage(gi399529005) 9e-05 Click
34717338..4718786 PHAGE_Microm_MpV1: hypothetical protein; SS53G_5360; phage(gi313768442) 1e-13 Click
4complement(4718958..4719266) inner membrane ABC transporter permease protein ydeY; SS53G_5361 0.0 Click
5complement(4719260..4720354) PHAGE_Plankt_PaV_LD: ABC transporter; SS53G_5362; phage(gi371496158) 2e-13 Click
6complement(4720403..4720795) PHAGE_Amsact_: putative ATP-binding cassette transporter; SS53G_5363; phage(gi9964444) 4e-07 Click
74720927..4721202 PHAGE_Entero_P1: InsA; SS53G_5364; phage(gi46401643) 1e-48 Click
84721224..4721622 PHAGE_Entero_P1: InsB; SS53G_5365; phage(gi46401642) 3e-63 Click
94721724..4723082 PHAGE_Microm_12T: hypothetical protein; SS53G_5366; phage(gi472342721) 1e-07 Click
104723436..4724677 PHAGE_Prochl_P_RSM4: YadA domain-containing structural protein; SS53G_5367; phage(gi326782844) 3e-05 Click
114724646..4724858 outer membrane autotransporter barrel domain protein; SS53G_5368 0.0 Click
124724942..4725670 PROPHAGE_Escher_CFT073: putative transposase; SS53G_5369; phage(gi26246170) 7e-127 Click
134725625..4725972 PROPHAGE_Escher_EDL933: putative transposase; SS53G_5370; phage(gi15803522) 3e-32 Click
144725953..4726078 outer membrane autotransporter barrel domain protein; SS53G_5371 0.0 Click
154726377..4726640 HTH-type transcriptional regulator hipB; SS53G_5372 0.0 Click
164726640..4727782 protein hipA; SS53G_5373 0.0 Click
174727830..4727961 hipA domain protein; SS53G_5374 0.0 Click
184728689..4729150 chaperone lpfB domain protein; SS53G_5375 0.0 Click
194729393..4729605 putative transposase; SS53G_5376 0.0 Click
204729616..4730119 PHAGE_Entero_P1: InsB; SS53G_5377; phage(gi46401642) 1e-92 Click
214730185..4730397 putative transposase; SS53G_5378 0.0 Click
224730408..4730911 PHAGE_Entero_P1: InsB; SS53G_5379; phage(gi46401642) 1e-92 Click
234731056..4731682 outer membrane usher fimD domain protein; SS53G_5380 0.0 Click
244731588..4731599 attR    GTATTGCCTGGA 0.0 Click
25complement(4731750..4732427) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; SS53G_5381; phage(gi16130763) 2e-132 Click

Region 30, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5171890..5173362) PHAGE_Amsact_: putative ATP-binding cassette transporter; SS53G_5866; phage(gi9964444) 1e-11 Click
2complement(5173430..5174218) transcriptional regulator modE; SS53G_5867 0.0 Click
35174347..5174496 hypothetical protein; SS53G_5868 0.0 Click
45174820..5175434 molybdate ABC transporter, periplasmic molybdate-binding protein; SS53G_5869 0.0 Click
55175434..5176123 molybdate ABC transporter, permease protein; SS53G_5870 0.0 Click
65176126..5177184 PHAGE_Plankt_PaV_LD: ABC transporter; SS53G_5871; phage(gi371496158) 4e-22 Click
7complement(5177185..5177313) hydrolase; SS53G_5872 0.0 Click
8complement(5177490..5177660) PHAGE_Entero_mEp235: integrase; SS53G_5873; phage(gi428781836) 3e-13 Click
9complement(5177743..5177859) hypothetical protein; SS53G_5874 0.0 Click
105178007..5178294 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_5875; phage(gi21231087) 1e-06 Click
115178449..5179162 PROPHAGE_Escher_CFT073: transposase insF; SS53G_5876; phage(gi26249410) 3e-135 Click
12complement(5179187..5179981) PHAGE_Entero_mEp235: integrase; SS53G_5877; phage(gi428781836) 7e-35 Click
13complement(5180331..5180465) PHAGE_Cronob_phiES15: hypothetical protein; SS53G_5878; phage(gi401817570) 2e-08 Click
14complement(5180614..5181372) PHAGE_Cronob_phiES15: hypothetical protein; SS53G_5879; phage(gi401817570) 1e-114 Click
15complement(5181432..5181728) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; SS53G_5880; phage(gi116222045) 1e-43 Click
16complement(5181706..5182026) exodeoxyribonuclease 8 domain protein; SS53G_5881 0.0 Click
175182274..5182576 PROPHAGE_Xantho_33913: ISxac3 transposase; SS53G_5882; phage(gi21231087) 9e-10 Click
185182717..5183430 PROPHAGE_Escher_CFT073: transposase insF; SS53G_5883; phage(gi26249410) 8e-136 Click
19complement(5183427..5185046) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; SS53G_5884; phage(gi169257272) 2e-39 Click
20complement(5185058..5185783) PROPHAGE_Escher_CFT073: transposase insF; SS53G_5885; phage(gi26249410) 1e-136 Click