Escherichia coli LT-68 gecLT68.assembly.10, whole genome shotgun [asmbl_id: NC_000000].5189427, GC%: 50.85%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5574..5687) PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; ECLT68_0005; phage(gi15800640) 3e-15 Click
26304..6676 nickel import ATP-binding protein nikE domain protein; ECLT68_0006 0.0 Click
36677..7012 nickel import ATP-binding protein nikE domain protein; ECLT68_0007 0.0 Click
4complement(7484..7756) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; ECLT68_0010; phage(gi24373865) 3e-08 Click
57904..8275 PHAGE_Stx2_c_1717: transposase; ECLT68_0011; phage(gi209447153) 4e-27 Click
68311..9306 PHAGE_Stx2_c_1717: transposase; ECLT68_0012; phage(gi209447153) 1e-121 Click
7complement(9350..9463) hypothetical protein; ECLT68_0013 0.0 Click
8complement(9553..10489) PHAGE_Entero_cdtI: putative tail tip assembly protein; ECLT68_0014; phage(gi148609400) 2e-179 Click
9complement(10558..10791) PROPHAGE_Escher_MG1655: IS4 transposase; ECLT68_0015; phage(gi16132099) 3e-36 Click
1010900..11235 PHAGE_Stx2_c_1717: truncated transposase; ECLT68_0016; phage(gi209447151) 2e-16 Click
1111235..11582 PHAGE_Stx2_c_1717: transposase; ECLT68_0017; phage(gi209447152) 4e-45 Click
1211602..12834 PHAGE_Stx2_c_1717: transposase; ECLT68_0018; phage(gi209447153) 4e-106 Click

Region 2, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
117243..17827 PROPHAGE_Escher_MG1655: IS3 transposase B; ECLT68_0021; phage(gi16128284) 9e-107 Click
2complement(18141..18272) hypothetical protein; ECLT68_0022 0.0 Click
318276..18440 PHAGE_Entero_P1: InsA; ECLT68_0023; phage(gi46401643) 2e-07 Click
418983..19543 PROPHAGE_Escher_CFT073: transposase; ECLT68_0024; phage(gi26248360) 2e-107 Click
519754..20416 PROPHAGE_Escher_CFT073: transposase/IS protein; ECLT68_0025; phage(gi26248359) 7e-119 Click
620585..21004 PHAGE_Entero_P1: InsB; ECLT68_0026; phage(gi46401642) 8e-10 Click
721141..22127 PHAGE_Entero_P1: ParA; ECLT68_0027; phage(gi46401682) 6e-109 Click
822079..22339 PHAGE_Entero_P1: ParA; ECLT68_0028; phage(gi46401682) 3e-38 Click
922339..23106 PHAGE_Entero_P1: ParB; ECLT68_0029; phage(gi46401681) 9e-71 Click
1023582..23872 PROPHAGE_Shewan_MR-1: IS110 family transposase; ECLT68_0030; phage(gi24375433) 3e-09 Click
1123952..24065 hypothetical protein; ECLT68_0031 0.0 Click
12complement(24092..24235) PHAGE_Stx2_c_1717: transposase; ECLT68_0032; phage(gi209447153) 4e-12 Click
13complement(24601..25470) PHAGE_Vibrio_VHML: ORF37; ECLT68_0033; phage(gi27311204) 4e-07 Click
14complement(26038..26169) PHAGE_Stx2_c_1717: transposase; ECLT68_0034; phage(gi209447153) 1e-10 Click
15complement(26169..26297) putative transposase; ECLT68_0035 0.0 Click
16complement(26263..26649) PHAGE_Entero_4795: putative transposase OrfB protein of IS629; ECLT68_0036; phage(gi157166067) 1e-70 Click
1726995..28368 protein traH; ECLT68_0037 0.0 Click
1828365..31205 PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; ECLT68_0038; phage(gi169257204) 2e-06 Click

Region 3, total : 68 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
192138..92152 attL    AGCGCGATGAACGGC 0.0 Click
2complement(97183..98538) PHAGE_Entero_mEp235: integrase; ECLT68_0111; phage(gi428781836) 3e-52 Click
3complement(98600..100900) PHAGE_Salmon_SPN3UB: RecE; ECLT68_0112; phage(gi423262421) 4e-101 Click
4complement(101133..101321) hypothetical protein; ECLT68_0113 0.0 Click
5complement(101318..101611) division inhibition protein dicB; ECLT68_0114 0.0 Click
6102112..102300 hypothetical protein; ECLT68_0115 0.0 Click
7complement(102490..102684) hypothetical protein; ECLT68_0116 0.0 Click
8complement(102707..102925) hypothetical protein; ECLT68_0117 0.0 Click
9complement(102955..103320) PHAGE_Salico_CGphi29: hypothetical protein; ECLT68_0118; phage(gi472340166) 2e-06 Click
10complement(103531..103782) PHAGE_Pectob_ZF40: putative cI repressor; ECLT68_0119; phage(gi422936650) 1e-06 Click
11104515..104913 PHAGE_Pectob_ZF40: putative cII repressor; ECLT68_0120; phage(gi422936652) 4e-05 Click
12105213..106055 PHAGE_Entero_phiP27: hypothetical protein P27p17; ECLT68_0121; phage(gi18249881) 3e-29 Click
13106096..106273 hypothetical protein; ECLT68_0122 0.0 Click
14complement(107589..108632) PHAGE_Cronob_phiES15: hypothetical protein; ECLT68_0123; phage(gi401817570) 8e-176 Click
15complement(108692..108988) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ECLT68_0124; phage(gi116222045) 1e-43 Click
16complement(109103..110905) PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; ECLT68_0125; phage(gi169257272) 5e-41 Click
17complement(111297..111584) PHAGE_Gifsy_1: hypothetical protein STM2630.Gifsy1; ECLT68_0126; phage(gi169257260) 3e-07 Click
18complement(111624..111794) phage regulatory protein, Rha family domain protein; ECLT68_0127 0.0 Click
19complement(111791..112147) PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; ECLT68_0128; phage(gi418487059) 5e-33 Click
20complement(112808..113026) hypothetical protein; ECLT68_0129 0.0 Click
21complement(114377..114595) hypothetical protein; ECLT68_0130 0.0 Click
22complement(114625..114762) hypothetical protein; ECLT68_0131 0.0 Click
23complement(114755..114910) PHAGE_Salico_CGphi29: hypothetical protein; ECLT68_0132; phage(gi472340166) 2e-09 Click
24complement(115112..115519) PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; ECLT68_0133; phage(gi401817574) 3e-32 Click
25115596..115823 PHAGE_Pectob_ZF40: putative cro anti-repressor; ECLT68_0134; phage(gi422936651) 1e-09 Click
26115837..116229 PHAGE_Pectob_ZF40: putative cII repressor; ECLT68_0135; phage(gi422936652) 3e-07 Click
27116307..117089 PHAGE_Escher_TL_2011b: hypothetical protein; ECLT68_0136; phage(gi418487646) 2e-46 Click
28117096..117842 PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECLT68_0137; phage(gi169257280) 1e-79 Click
29117857..118279 hypothetical protein; ECLT68_0138 0.0 Click
30118337..118693 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; ECLT68_0139; phage(gi20065868) 3e-08 Click
31118961..119527 hypothetical protein; ECLT68_0140 0.0 Click
32120191..120319 hypothetical protein; ECLT68_0141 0.0 Click
33120289..120447 hypothetical protein; ECLT68_0142 0.0 Click
34120486..121085 PHAGE_Pectob_ZF40: hypothetical protein; ECLT68_0143; phage(gi422936663) 3e-51 Click
35121085..121315 PHAGE_Pectob_ZF40: hypothetical protein; ECLT68_0144; phage(gi422936664) 3e-20 Click
36121371..121925 PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECLT68_0145; phage(gi399528832) 2e-06 Click
37122115..122191 tRNA 0.0 Click
38122193..122269 tRNA 0.0 Click
39122272..122347 tRNA 0.0 Click
40122351..122425 tRNA 0.0 Click
41122726..122932 PHAGE_Escher_P13374: lysis protein, holin; ECLT68_0150; phage(gi410491645) 4e-27 Click
42122932..123429 PHAGE_Stx2_c_1717: phage-related lysozyme; ECLT68_0151; phage(gi209447172) 6e-92 Click
43123426..123896 PHAGE_Entero_HK620: endopeptidase; ECLT68_0152; phage(gi13559860) 4e-76 Click
44complement(123985..124161) putative membrane protein; ECLT68_0153 0.0 Click
45124692..125456 PHAGE_Escher_TL_2011c: putative terminase small subunit; ECLT68_0154; phage(gi418487072) 2e-16 Click
46complement(125515..125658) hypothetical protein; ECLT68_0155 0.0 Click
47125611..126810 PHAGE_Psychr_pOW20_A: phage terminase large subunit; ECLT68_0156; phage(gi472339822) 2e-128 Click
48126810..128276 PHAGE_Pectob_ZF40: putative portal protein; ECLT68_0157; phage(gi422936682) 2e-38 Click
49128464..128910 PROPHAGE_Deinoc_R1: head morphogenesis protein, putative; ECLT68_0158; phage(gi15807765) 3e-13 Click
50128974..130134 PHAGE_Pectob_ZF40: putative head protein; ECLT68_0159; phage(gi422936684) 4e-19 Click
51130138..130644 hypothetical protein; ECLT68_0160 0.0 Click
52130656..131597 PHAGE_Vibrio_CP_T1: putative major capsid protein; ECLT68_0161; phage(gi418489228) 4e-16 Click
53131680..131859 hypothetical protein; ECLT68_0162 0.0 Click
54131825..132232 PHAGE_Pseudo_KPP12: putative structural protein; ECLT68_0163; phage(gi431811107) 3e-09 Click
55132259..132783 PHAGE_Psychr_pOW20_A: hypothetical protein; ECLT68_0164; phage(gi472339833) 1e-12 Click
56132845..133159 hypothetical protein; ECLT68_0165 0.0 Click
57133149..133697 hypothetical protein; ECLT68_0166 0.0 Click
58133701..134846 PHAGE_Aggreg_S1249: hypothetical protein; ECLT68_0167; phage(gi273809558) 1e-43 Click
59134857..135297 PHAGE_Pseudo_vB_PaeM_C2_10_Ab1: hypothetical protein; ECLT68_0168; phage(gi431809991) 4e-07 Click
60135301..135753 hypothetical protein; ECLT68_0169 0.0 Click
61135931..137010 PHAGE_Aggreg_S1249: putative tail length tape measure protein; ECLT68_0170; phage(gi273809555) 2e-13 Click
62137140..137883 PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber/lysozyme protein; ECLT68_0171; phage(gi422937553) 4e-10 Click
63138084..138533 hypothetical protein; ECLT68_0172 0.0 Click
64138537..138839 hypothetical protein; ECLT68_0173 0.0 Click
65138842..139882 PHAGE_Psychr_pOW20_A: hypothetical protein; ECLT68_0174; phage(gi472339843) 2e-20 Click
66140707..140958 PHAGE_Entero_P1: InsA; ECLT68_0175; phage(gi46401643) 7e-35 Click
67140960..141355 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_0176; phage(gi16131317) 7e-69 Click
68141486..141857 PHAGE_Entero_phiP27: putative tail fiber assembly protein; ECLT68_0177; phage(gi18249919) 2e-54 Click
69141881..143149 PHAGE_Entero_phiP27: putative tail fiber protein; ECLT68_0178; phage(gi18249920) 1e-94 Click
70143345..143722 PHAGE_Entero_phiP27: hypothetical protein P27p57; ECLT68_0179; phage(gi18249921) 1e-50 Click
71complement(143902..144816) 60 kDa antigen; ECLT68_0180 0.0 Click
72145197..145358 hypothetical protein; ECLT68_0181 0.0 Click
73146358..147014 PHAGE_Entero_HK446: NinI protein; ECLT68_0182; phage(gi428782246) 2e-55 Click
74151727..151741 attR    AGCGCGATGAACGGC 0.0 Click

Region 4, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1268194..268205 attL    CTGCTGTAAATC 0.0 Click
2275533..275832 PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; ECLT68_0316; phage(gi9630187) 4e-15 Click
3complement(276139..276279) PHAGE_Escher_P13374: prophage host toxic membrane protein; ECLT68_0317; phage(gi410491667) 3e-16 Click
4complement(276470..276730) PHAGE_Yersin_413C: Ogr; ECLT68_0318; phage(gi30065732) 7e-08 Click
5complement(276974..278476) hypothetical protein; ECLT68_0319 0.0 Click
6complement(278569..279225) PROPHAGE_Escher_MG1655: IS2 transposase TnpB; ECLT68_0320; phage(gi16130763) 1e-128 Click
7complement(279432..279797) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; ECLT68_0321; phage(gi17546153) 1e-45 Click
8complement(280038..280409) PHAGE_Yersin_413C: gpD; ECLT68_0322; phage(gi30065731) 5e-27 Click
9complement(280406..281146) PHAGE_Yersin_413C: gpD; ECLT68_0323; phage(gi30065731) 1e-61 Click
10complement(281193..281324) hypothetical protein; ECLT68_0324 0.0 Click
11281304..281661 PHAGE_Salmon_RE_2010: major tail sheath protein; ECLT68_0325; phage(gi418489720) 2e-22 Click
12287927..287938 attR    CTGCTGTAAATC 0.0 Click

Region 5, total : 44 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(509001..509993) PHAGE_Vibrio_kappa: putative integrase; ECLT68_0567; phage(gi165970235) 1e-62 Click
2510512..511033 hypothetical protein; ECLT68_0568 0.0 Click
3complement(511124..511255) hypothetical protein; ECLT68_0569 0.0 Click
4511261..511671 hypothetical protein; ECLT68_0570 0.0 Click
5complement(511678..511857) hypothetical protein; ECLT68_0571 0.0 Click
6511858..511980 hypothetical protein; ECLT68_0572 0.0 Click
7511989..512339 hypothetical protein; ECLT68_0573 0.0 Click
8512451..512597 hypothetical protein; ECLT68_0574 0.0 Click
9512857..512970 putative membrane protein; ECLT68_0575 0.0 Click
10513064..513474 hypothetical protein; ECLT68_0576 0.0 Click
11complement(513614..513835) hypothetical protein; ECLT68_0577 0.0 Click
12513813..514019 hypothetical protein; ECLT68_0578 0.0 Click
13complement(514030..514143) putative membrane protein; ECLT68_0579 0.0 Click
14514258..514404 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF3; ECLT68_0580; phage(gi157165988) 1e-15 Click
15514731..514961 hypothetical protein; ECLT68_0581 0.0 Click
16515034..515399 hypothetical protein; ECLT68_0582 0.0 Click
17515406..515852 PHAGE_Salmon_RE_2010: replication protein; ECLT68_0583; phage(gi418489692) 4e-05 Click
18515911..518226 PHAGE_Entero_2: P2 gpA-like protein; ECLT68_0584; phage(gi169936054) 4e-156 Click
19518275..518286 attL    TTAATTAATCAA 0.0 Click
20518303..518639 plasmid segregation protein parM domain protein; ECLT68_0585 0.0 Click
21complement(518910..519641) hypothetical protein; ECLT68_0586 0.0 Click
22complement(519837..521240) PHAGE_Pectob_ZF40: putative helicase; ECLT68_0587; phage(gi422936655) 2e-163 Click
23complement(521230..521346) PHAGE_Pectob_ZF40: putative replication protein; ECLT68_0588; phage(gi422936654) 8e-15 Click
24complement(521557..521967) PHAGE_Entero_mEp460: replication protein; ECLT68_0589; phage(gi428782359) 1e-57 Click
25complement(522041..522160) hypothetical protein; ECLT68_0590 0.0 Click
26complement(522275..522493) hypothetical protein; ECLT68_0591 0.0 Click
27522985..523245 PHAGE_Entero_mEp237: prophage repressor; ECLT68_0592; phage(gi435439304) 7e-13 Click
28523412..523567 PHAGE_Salico_CGphi29: hypothetical protein; ECLT68_0593; phage(gi472340166) 2e-09 Click
29523560..523697 hypothetical protein; ECLT68_0594 0.0 Click
30523727..523945 hypothetical protein; ECLT68_0595 0.0 Click
31525296..525529 hypothetical protein; ECLT68_0596 0.0 Click
32526178..526732 PHAGE_Escher_TL_2011c: phage regulatory protein, Rha family; ECLT68_0597; phage(gi418487059) 1e-42 Click
33526743..526859 hypothetical protein; ECLT68_0598 0.0 Click
34526819..527028 PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; ECLT68_0599; phage(gi169257274) 3e-06 Click
35527103..527399 PHAGE_Gifsy_2: hypothetical protein STM1010.Gifsy2; ECLT68_0600; phage(gi169257273) 2e-06 Click
36527423..529042 PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; ECLT68_0601; phage(gi169257272) 3e-40 Click
37529134..529361 hypothetical protein; ECLT68_0602 0.0 Click
38529339..529635 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ECLT68_0603; phage(gi116222045) 1e-43 Click
39529695..530738 PHAGE_Cronob_phiES15: hypothetical protein; ECLT68_0604; phage(gi401817570) 8e-176 Click
40532041..532445 PHAGE_Entero_mEp235: integrase; ECLT68_0605; phage(gi428781836) 2e-18 Click
41complement(532626..532778) hypothetical protein; ECLT68_0606 0.0 Click
42complement(532796..533134) PHAGE_Entero_PsP3: gp28; ECLT68_0607; phage(gi41057381) 3e-09 Click
43complement(533150..534022) copper resistance protein D family protein; ECLT68_0608 0.0 Click
44complement(534026..534400) copper resistance protein C; ECLT68_0609 0.0 Click
45534539..534769 PHAGE_Pectob_ZF40: putative DNA polymerase; ECLT68_0610; phage(gi422936677) 6e-17 Click
46549735..549746 attR    TTAATTAATCAA 0.0 Click

Region 6, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(564052..564429) PHAGE_Entero_phiP27: hypothetical protein P27p57; ECLT68_0642; phage(gi18249921) 1e-50 Click
2complement(564623..566035) PHAGE_Entero_phiP27: putative tail fiber protein; ECLT68_0643; phage(gi18249920) 7e-74 Click
3complement(566099..566698) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECLT68_0644; phage(gi148609401) 5e-105 Click
4566827..567207 PROPHAGE_Escher_MG1655: IS4 transposase; ECLT68_0645; phage(gi16132099) 4e-47 Click
5567516..568154 PROPHAGE_Escher_MG1655: IS4 transposase; ECLT68_0646; phage(gi16132099) 9e-119 Click
6complement(568203..571682) PHAGE_Entero_cdtI: putative tail tip assembly protein; ECLT68_0647; phage(gi148609400) 0.0 Click
7complement(571743..572285) PHAGE_Entero_mEp460: tail assembly protein; ECLT68_0648; phage(gi428782333) 1e-79 Click
8complement(572282..572583) PHAGE_Entero_mEp460: tail fiber component; ECLT68_0649; phage(gi428782332) 1e-54 Click
9572584..572767 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECLT68_0650; phage(gi24111655) 1e-31 Click
10573039..573419 PHAGE_Entero_phiP27: putative tail fiber protein; ECLT68_0651; phage(gi18249918) 1e-14 Click
11573422..573967 PHAGE_Entero_phiP27: putative tail fiber assembly protein; ECLT68_0652; phage(gi18249919) 7e-73 Click
12573991..575259 PHAGE_Entero_phiP27: putative tail fiber protein; ECLT68_0653; phage(gi18249920) 5e-94 Click
13575454..575756 PHAGE_Entero_phiP27: hypothetical protein P27p57; ECLT68_0654; phage(gi18249921) 2e-41 Click
14575757..576115 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_0655; phage(gi16131317) 2e-60 Click
15complement(576381..576609) plasmid segregation protein parM domain protein; ECLT68_0008 0.0 Click
16complement(576715..577051) hypothetical protein; ECLT68_0009 0.0 Click
17complement(577052..577223) PHAGE_Entero_P1: InsA; ECLT68_0659; phage(gi46401643) 2e-28 Click

Region 7, total : 92 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(674051..674794) PHAGE_Synech_S_CRM01: methyltransferase domain-containing protein; ECLT68_0776; phage(gi333798309) 3e-24 Click
2complement(674835..675230) hypothetical protein; ECLT68_0777 0.0 Click
3complement(675283..675630) hypothetical protein; ECLT68_0778 0.0 Click
4675721..675732 attL    ATAATTAAATTC 0.0 Click
5complement(676035..677099) PHAGE_Entero_phiP27: putative integrase; ECLT68_0779; phage(gi18249865) 0.0 Click
6complement(677096..677347) PHAGE_Entero_phiP27: putative integrase; ECLT68_0780; phage(gi18249865) 1e-41 Click
7complement(677648..677794) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF3; ECLT68_0781; phage(gi157165988) 3e-22 Click
8complement(677798..677941) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; ECLT68_0782; phage(gi157165989) 6e-15 Click
9complement(678164..678733) PHAGE_Salmon_1: hypothetical protein STM0896.2n.Fels1; ECLT68_0783; phage(gi169257162) 6e-25 Click
10complement(678816..679478) PHAGE_Entero_phiP27: hypothetical protein P27p14; ECLT68_0784; phage(gi18249878) 2e-36 Click
11complement(679522..680352) PHAGE_Entero_phiP27: putative serine protease; ECLT68_0785; phage(gi18249869) 6e-148 Click
12complement(680380..680493) hypothetical protein; ECLT68_0786 0.0 Click
13complement(680581..681294) PROPHAGE_Escher_CFT073: transposase insF; ECLT68_0787; phage(gi26249410) 9e-137 Click
14complement(681435..681737) PROPHAGE_Xantho_33913: ISxac3 transposase; ECLT68_0788; phage(gi21231087) 9e-10 Click
15complement(681864..682256) PHAGE_Salmon_1: hypothetical protein STM0898.1n.Fels1; ECLT68_0789; phage(gi169257164) 2e-40 Click
16complement(682443..682658) PHAGE_Entero_phiP27: hypothetical protein P27p07; ECLT68_0790; phage(gi18249871) 9e-11 Click
17complement(682658..683017) PHAGE_Salmon_1: hypothetical protein STM0898.3n.Fels1; ECLT68_0791; phage(gi169257166) 9e-29 Click
18complement(683021..683134) hypothetical protein; ECLT68_0792 0.0 Click
19complement(683213..683374) PHAGE_Entero_phiP27: hypothetical protein P27p08; ECLT68_0793; phage(gi18249872) 5e-22 Click
20complement(683691..684020) PHAGE_Entero_phiP27: hypothetical protein P27p10; ECLT68_0794; phage(gi18249874) 9e-35 Click
21complement(684291..685013) PHAGE_Entero_phiP27: putative lambda repressor; ECLT68_0795; phage(gi18249875) 1e-125 Click
22complement(685339..685632) PHAGE_Burkho_Bcep176: gp17; ECLT68_0796; phage(gi77864642) 6e-07 Click
23685746..686459 PHAGE_Entero_phiP27: hypothetical protein P27p14; ECLT68_0797; phage(gi18249878) 3e-102 Click
24686479..686655 hypothetical protein; ECLT68_0798 0.0 Click
25complement(686677..687006) hypothetical protein; ECLT68_0799 0.0 Click
26complement(687038..687325) hypothetical protein; ECLT68_0800 0.0 Click
27687290..688243 PHAGE_Entero_mEp460: regulatory protein Rha; ECLT68_0801; phage(gi428782357) 5e-104 Click
28688294..688473 PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0802; phage(gi428782358) 3e-13 Click
29688529..689055 PHAGE_Burkho_BcepIL02: putative DNA replication protein; ECLT68_0803; phage(gi238801636) 6e-29 Click
30689263..689586 PHAGE_Entero_phiP27: putative replication protein DnaC; ECLT68_0804; phage(gi18249882) 2e-51 Click
31689564..689881 PHAGE_Entero_phiP27: putative replication protein DnaC; ECLT68_0805; phage(gi18249882) 3e-53 Click
32690049..690210 PHAGE_Entero_phiP27: putative helicase; ECLT68_0806; phage(gi18249883) 2e-23 Click
33690343..690562 PHAGE_Entero_phiP27: hypothetical protein P27p20; ECLT68_0807; phage(gi18249884) 3e-32 Click
34690562..690936 PHAGE_Escher_HK75: RusA-like protein; ECLT68_0808; phage(gi356870726) 8e-36 Click
35690933..691754 PHAGE_Entero_HK225: late gene regulator Q; ECLT68_0809; phage(gi428782441) 1e-88 Click
36691898..691973 tRNA 0.0 Click
37complement(692349..692684) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; ECLT68_0811; phage(gi209447168) 3e-46 Click
38692930..693133 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECLT68_0812; phage(gi209427766) 2e-28 Click
39693130..693291 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; ECLT68_0813; phage(gi116221995) 6e-17 Click
40693450..693656 PHAGE_Escher_P13374: lysis protein, holin; ECLT68_0814; phage(gi410491645) 4e-33 Click
41693661..694191 PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0815; phage(gi428782371) 4e-37 Click
42694513..695046 PHAGE_Entero_mEp460: endolysin; ECLT68_0816; phage(gi428782372) 1e-98 Click
43695043..695468 PHAGE_Entero_mEp460: Rz lysis protein; ECLT68_0817; phage(gi428782373) 8e-48 Click
44695650..695880 hypothetical protein; ECLT68_0818 0.0 Click
45695855..696136 addiction module toxin, RelE/StbE family; ECLT68_0819 0.0 Click
46696313..696879 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp49; ECLT68_0820; phage(gi209447174) 2e-92 Click
47696933..697133 PHAGE_Entero_mEp234: hypothetical protein; ECLT68_0821; phage(gi428782313) 4e-32 Click
48complement(697210..697386) hypothetical protein; ECLT68_0822 0.0 Click
49697449..697631 hypothetical protein; ECLT68_0823 0.0 Click
50697783..698292 PHAGE_Entero_N15: gp1; ECLT68_0824; phage(gi9630465) 2e-18 Click
51698297..699730 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; ECLT68_0825; phage(gi169257235) 0.0 Click
52699727..700191 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; ECLT68_0826; phage(gi169257235) 4e-59 Click
53700175..700378 PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; ECLT68_0827; phage(gi169257234) 8e-14 Click
54701482..701967 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; ECLT68_0828; phage(gi169257233) 8e-73 Click
55701957..702256 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; ECLT68_0829; phage(gi169257232) 6e-31 Click
56702253..703461 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; ECLT68_0830; phage(gi169257232) 1e-136 Click
57703496..703774 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; ECLT68_0831; phage(gi169257231) 8e-28 Click
58703902..704930 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; ECLT68_0832; phage(gi169257230) 5e-173 Click
59704982..705371 PHAGE_Entero_HK630: DNA packaging protein Fi; ECLT68_0833; phage(gi428782796) 7e-18 Click
60705383..705760 PHAGE_Entero_HK630: head-tail connector Fii; ECLT68_0834; phage(gi428782797) 6e-33 Click
61705744..705995 PHAGE_Entero_mEp460: minor tail protein; ECLT68_0835; phage(gi428782324) 3e-28 Click
62705973..706332 PHAGE_Entero_mEp460: minor tail protein; ECLT68_0836; phage(gi428782324) 1e-55 Click
63706329..706614 PHAGE_Entero_mEp460: minor tail protein; ECLT68_0837; phage(gi428782325) 1e-49 Click
64complement(706615..707691) PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; ECLT68_0838; phage(gi169257235) 0.0 Click
65complement(707696..708175) PHAGE_Entero_N15: gp1; ECLT68_0839; phage(gi9630465) 2e-18 Click
66complement(708357..708539) hypothetical protein; ECLT68_0840 0.0 Click
67complement(708779..708985) PHAGE_Entero_mEp460: porin; ECLT68_0841; phage(gi428782370) 2e-29 Click
68complement(709674..709748) tRNA 0.0 Click
69complement(709752..709827) tRNA 0.0 Click
70complement(709830..709906) tRNA 0.0 Click
71complement(709908..709983) tRNA 0.0 Click
72complement(710024..711082) PHAGE_Entero_mEp460: DNA methylase; ECLT68_0846; phage(gi428782369) 0.0 Click
73711165..711302 hypothetical protein; ECLT68_0847 0.0 Click
74complement(711688..712440) PHAGE_Entero_mEp460: late gene regulator; ECLT68_0848; phage(gi428782366) 2e-145 Click
75complement(712454..713407) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0849; phage(gi428782365) 0.0 Click
76complement(713451..714260) PHAGE_Entero_mEp460: KilA-N domain protein; ECLT68_0850; phage(gi428782364) 9e-152 Click
77complement(714280..714669) PHAGE_Entero_mEp460: holliday junction resolvase; ECLT68_0851; phage(gi428782363) 8e-70 Click
78complement(714666..714992) PHAGE_Entero_mEp460: LexA DNA binding domain protein; ECLT68_0852; phage(gi428782362) 1e-54 Click
79complement(714989..715642) PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; ECLT68_0853; phage(gi428782361) 7e-127 Click
80complement(715642..715893) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0854; phage(gi428782360) 4e-42 Click
81complement(716133..716936) PHAGE_Entero_mEp460: replication protein; ECLT68_0855; phage(gi428782359) 2e-152 Click
82complement(716948..717172) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0856; phage(gi428782358) 9e-40 Click
83complement(717169..718332) PHAGE_Entero_mEp460: regulatory protein Rha; ECLT68_0857; phage(gi428782357) 3e-174 Click
84complement(718329..718991) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0858; phage(gi428782356) 5e-52 Click
85719312..720016 PHAGE_Escher_HK639: cI; ECLT68_0859; phage(gi356870650) 2e-69 Click
86complement(721364..722131) PHAGE_Entero_HK630: HkaP protein; ECLT68_0860; phage(gi428782827) 7e-13 Click
87722394..722711 PHAGE_Entero_mEp460: hypothetical protein; predicted; phage protein; ECLT68_0861(gi428782351) 1e-54 Click
88722777..723601 PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0862; phage(gi428782350) 4e-151 Click
89723730..724266 PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0863; phage(gi428782349) 1e-100 Click
90724278..724607 PHAGE_Escher_P13374: hypothetical protein; ECLT68_0864; phage(gi410491610) 4e-38 Click
91724571..725077 PHAGE_Pectob_ZF40: putative methylase; ECLT68_0865; phage(gi422936660) 2e-66 Click
92725123..725134 attR    ATAATTAAATTC 0.0 Click
93725224..725640 PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0866; phage(gi428782343) 2e-14 Click
94725642..726223 PHAGE_Entero_mEp460: hypothetical protein; ECLT68_0867; phage(gi428782343) 1e-77 Click
95726235..726795 PHAGE_Entero_mEp460: putative exonuclease; ECLT68_0868; phage(gi428782342) 3e-105 Click
96complement(726985..727125) hypothetical protein; ECLT68_0869 0.0 Click
97complement(727605..727748) hypothetical protein; ECLT68_0870 0.0 Click
98complement(728309..728431) tRNA-dihydrouridine synthase A domain protein; ECLT68_0871 0.0 Click
99complement(728794..729117) hypothetical protein; ECLT68_0872 0.0 Click
100729637..730140 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_0873; phage(gi16131317) 2e-87 Click

Region 8, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12208327..2208341 attL    GAGCGCGAGGCATCT 0.0 Click
2complement(2216327..2217391) PHAGE_Lactob_KC5a: putative minor tail protein; ECLT68_2445; phage(gi90592623) 4e-06 Click
3complement(2217384..2218586) PHAGE_Plankt_PaV_LD: ABC transporter; ECLT68_2446; phage(gi371496158) 1e-24 Click
4complement(2218941..2219900) PHAGE_Mycoba_Myrna: gp256; ECLT68_2447; phage(gi203454817) 4e-129 Click
5complement(2219910..2222054) PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; ECLT68_2448; phage(gi158079505) 0.0 Click
6complement(2222027..2222437) PHAGE_Bacill_SP10: ribonucleotide reductase stimulatory protein; ECLT68_2449; phage(gi418489617) 7e-14 Click
7complement(2222434..2222679) PHAGE_Mycoba_Porky: gp37; ECLT68_2450; phage(gi194303333) 3e-10 Click
8complement(2222927..2223256) hypothetical protein; ECLT68_2451 0.0 Click
92223408..2223752 hypothetical protein; ECLT68_2452 0.0 Click
10complement(2223789..2224058) hypothetical protein; ECLT68_2453 0.0 Click
112224954..2225310 hypothetical protein; ECLT68_2454 0.0 Click
12complement(2225357..2225875) inner membrane protein ygaP; ECLT68_2455 0.0 Click
13complement(2225891..2226190) transcriptional activator hlyU; ECLT68_2456 0.0 Click
142226373..2226531 hypothetical protein; ECLT68_2457 0.0 Click
152226615..2227064 PHAGE_Clostr_CD119: XkdP protein; ECLT68_2458; phage(gi90592656) 4e-09 Click
16complement(2227065..2227727) transcriptional regulator, GntR family protein; ECLT68_2459 0.0 Click
17complement(2227748..2229148) GABA permease; ECLT68_2460 0.0 Click
18complement(2229288..2230529) PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_2461; phage(gi24375070) 7e-51 Click
192230781..2231032 PHAGE_Entero_Sf6: gene 56 protein; ECLT68_2462; phage(gi41057344) 2e-31 Click
202231199..2231579 PHAGE_Entero_Sf6: putative transposase OrfB; ECLT68_2463; phage(gi41057343) 9e-34 Click
212231678..2231929 PHAGE_Entero_P1: InsA; ECLT68_2464; phage(gi46401643) 7e-35 Click
222231931..2232326 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_2465; phage(gi16131317) 7e-69 Click
232233043..2233162 hypothetical protein; ECLT68_2466 0.0 Click
242233476..2233679 hypothetical protein; ECLT68_2467 0.0 Click
25complement(2233738..2234979) PHAGE_Entero_P4: integrase; ECLT68_2468; phage(gi9627511) 5e-66 Click
26complement(2235183..2235545) tRNA 0.0 Click
27complement(2235760..2236242) ssrA-binding protein; ECLT68_2469 0.0 Click
282236412..2236849 polyketide cyclase / dehydrase and lipid transport family protein; ECLT68_2470 0.0 Click
292236839..2237129 hypothetical protein; ECLT68_2471 0.0 Click
30complement(2237191..2237532) smpA / OmlA family protein; ECLT68_2472 0.0 Click
31complement(2237681..2239342) PHAGE_Human__8: LANA; ECLT68_2473; phage(gi139472804) 2e-05 Click
322252400..2252414 attR    GAGCGCGAGGCATCT 0.0 Click

Region 9, total : 62 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2295911..2297212) PHAGE_Acyrth_1: hypothetical protein APSE-1_41; ECLT68_2537; phage(gi9633588) 0.0 Click
2complement(2297350..2298039) PHAGE_Salmon_E1: DNA-binding protein; ECLT68_2538; phage(gi170676304) 7e-16 Click
3complement(2298145..2298393) hypothetical protein; ECLT68_2539 0.0 Click
42298427..2298780 PHAGE_Salmon_ST160: Mnt; ECLT68_2540; phage(gi318065963) 9e-05 Click
5complement(2298911..2299207) PHAGE_Acyrth_1: hypothetical protein APSE-1_44; ECLT68_2541; phage(gi9633591) 1e-27 Click
6complement(2299170..2299322) PHAGE_Klebsi_phiKO2: Gp58; ECLT68_2542; phage(gi46402144) 3e-07 Click
7complement(2299466..2299627) hypothetical protein; ECLT68_2543 0.0 Click
8complement(2299734..2300495) PHAGE_Stx2_c_II: putative antirepressor protein AntB; ECLT68_2544; phage(gi302393111) 9e-39 Click
9complement(2300586..2300723) hypothetical protein; ECLT68_2545 0.0 Click
102300896..2301021 hypothetical protein; ECLT68_2546 0.0 Click
11complement(2300977..2301672) PHAGE_Bordet_1: Bbp42; ECLT68_2547; phage(gi41179402) 6e-77 Click
12complement(2301722..2302474) PHAGE_Sodali_1: gp39; ECLT68_2548; phage(gi273810593) 3e-56 Click
13complement(2302746..2303903) PHAGE_Bordet_1: Bbp42; ECLT68_2549; phage(gi41179402) 2e-152 Click
14complement(2303970..2304872) PHAGE_Bacter_2: hypothetical protein APSE233; ECLT68_2550; phage(gi212499738) 4e-35 Click
15complement(2305336..2305596) PHAGE_Bordet_1: Bbp40; ECLT68_2551; phage(gi41179400) 1e-15 Click
16complement(2306144..2307244) PHAGE_Bacter_2: hypothetical protein APSE241; ECLT68_2552; phage(gi212499745) 1e-113 Click
172307334..2307459 hypothetical protein; ECLT68_2553 0.0 Click
18complement(2307438..2307956) PHAGE_Lactob_AQ113: HNH endonuclease; ECLT68_2554; phage(gi446730230) 3e-20 Click
19complement(2307959..2308861) PHAGE_Acyrth_1: hypothetical protein APSE-1_53; ECLT68_2555; phage(gi9633600) 2e-09 Click
20complement(2308858..2309007) hypothetical protein; ECLT68_2556 0.0 Click
212309232..2309801 PHAGE_Entero_HK446: hypothetical protein; ECLT68_2557; phage(gi428782230) 2e-41 Click
22complement(2310178..2310441) transcriptional regulator, XRE family; ECLT68_2558 0.0 Click
232311002..2311139 regulatory protein cro; ECLT68_2559 0.0 Click
242311233..2312930 PHAGE_Salmon_SPN19: putative primase; ECLT68_2560; phage(gi414090202) 1e-10 Click
252312933..2313289 hypothetical protein; ECLT68_2561 0.0 Click
262313892..2314140 hypothetical protein; ECLT68_2562 0.0 Click
272315028..2315363 PHAGE_Entero_SfV: holin; ECLT68_2563; phage(gi19549036) 3e-56 Click
282315367..2315843 PHAGE_Entero_SfV: lysin; ECLT68_2564; phage(gi19549037) 2e-86 Click
292315827..2316351 PHAGE_Entero_HK225: lysis protein Rz; ECLT68_2565; phage(gi428782445) 7e-44 Click
302316413..2316985 PHAGE_Pseudo_phi297: terminase small subunit; ECLT68_2566; phage(gi374531284) 5e-49 Click
312316988..2318607 PHAGE_Burkho_BcepB1A: gp33 TerL; ECLT68_2567; phage(gi48697520) 4e-157 Click
322318607..2320148 PHAGE_Burkho_BcepNY3: NUDIX hydrolase; ECLT68_2568; phage(gi149882917) 1e-98 Click
332320189..2320878 PHAGE_Burkho_BcepNY3: head protein; ECLT68_2569; phage(gi149882916) 5e-36 Click
342321465..2322223 PHAGE_Burkho_BcepNY3: scaffold protein; ECLT68_2570; phage(gi149882914) 2e-07 Click
352322246..2322707 PHAGE_Burkho_BcepNY3: minor capsid protein; ECLT68_2571; phage(gi149882912) 3e-13 Click
362322707..2323756 PHAGE_Burkho_BcepNY3: major capsid protein; ECLT68_2572; phage(gi149882911) 7e-71 Click
372323759..2323929 hypothetical protein; ECLT68_2573 0.0 Click
382323926..2324087 hypothetical protein; ECLT68_2574 0.0 Click
392324093..2324551 PHAGE_Burkho_BcepNY3: BcepNY3gp07; ECLT68_2575; phage(gi149882907) 7e-20 Click
402324627..2325124 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; ECLT68_2576; phage(gi422937546) 3e-15 Click
412325121..2325354 hypothetical protein; ECLT68_2577 0.0 Click
422325484..2325795 hypothetical protein; ECLT68_2578 0.0 Click
432325999..2326382 PHAGE_Burkho_BcepNY3: BcepNY3gp03; ECLT68_2579; phage(gi149882903) 3e-13 Click
44complement(2326354..2326674) hypothetical protein; ECLT68_2580 0.0 Click
452326893..2327483 PHAGE_Acinet_AP22: hypothetical protein; ECLT68_2581; phage(gi388570807) 2e-33 Click
462327484..2327930 PHAGE_Burkho_BcepNY3: BcepNY3gp02; ECLT68_2582; phage(gi149882902) 7e-14 Click
472327930..2328334 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; ECLT68_2583; phage(gi422937551) 3e-22 Click
482328376..2328558 hypothetical protein; ECLT68_2584 0.0 Click
492328542..2330428 PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber/lysozyme protein; ECLT68_2585; phage(gi422937553) 1e-08 Click
502330559..2331269 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; ECLT68_2586; phage(gi422937557) 2e-06 Click
512331269..2331571 PHAGE_Burkho_BcepNY3: BcepNY3gp51; ECLT68_2587; phage(gi149882952) 1e-08 Click
522331568..2332437 PHAGE_Burkho_BcepNY3: BcepNY3gp38; ECLT68_2588; phage(gi149882939) 5e-10 Click
532332448..2333095 PHAGE_Xantho_OP2: putative baseplate protein; ECLT68_2589; phage(gi84662684) 3e-23 Click
542333108..2333464 PHAGE_Burkho_BcepNY3: BcepNY3gp52; ECLT68_2590; phage(gi149882953) 3e-15 Click
552333461..2334702 PHAGE_Burkho_BcepNY3: BcepNY3gp32; ECLT68_2591; phage(gi149882933) 8e-48 Click
562334704..2335309 PHAGE_Burkho_BcepNY3: BcepNY3gp31; ECLT68_2592; phage(gi149882932) 2e-26 Click
57complement(2335455..2335593) PHAGE_Entero_P1: InsA; ECLT68_2593; phage(gi46401643) 3e-22 Click
58complement(2335692..2336630) PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_2594; phage(gi24375070) 2e-41 Click
59complement(2336636..2337511) hypothetical protein; ECLT68_2595 0.0 Click
60complement(2337475..2338278) hypothetical protein; ECLT68_2596 0.0 Click
61complement(2338275..2339324) hypothetical protein; ECLT68_2597 0.0 Click
62complement(2339328..2339741) lysozyme family protein; ECLT68_2598 0.0 Click

Region 10, total : 64 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12392911..2392923 attL    TTTTTTCGCTGTG 0.0 Click
22399578..2399589 attL    TGTCATATGATT 0.0 Click
32406684..2407508 PHAGE_Plankt_PaV_LD: ABC transporter; ECLT68_2665; phage(gi371496158) 5e-13 Click
42407505..2408362 chelated iron transport system membrane protein yfeC; ECLT68_2666 0.0 Click
52408359..2409216 chelated iron transport system membrane protein yfeD; ECLT68_2667 0.0 Click
6complement(2409417..2409883) PHAGE_Entero_phiP27: hypothetical protein P27p57; ECLT68_2668; phage(gi18249921) 5e-70 Click
7complement(2409884..2410212) PHAGE_Entero_phiP27: putative tail fiber assembly protein; ECLT68_2669; phage(gi18249919) 2e-39 Click
8complement(2410215..2410688) PHAGE_Salmon_ST64B: tail protein; ECLT68_2670; phage(gi23505468) 3e-21 Click
9complement(2410757..2410927) putative transposase; ECLT68_2671 0.0 Click
102411020..2411523 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_2672; phage(gi16131317) 2e-87 Click
11complement(2411517..2412200) PHAGE_Salmon_ST64B: tail protein; ECLT68_2673; phage(gi23505468) 7e-25 Click
12complement(2412187..2412777) PHAGE_Salmon_ST64B: putative tail protein; ECLT68_2674; phage(gi23505467) 3e-83 Click
13complement(2412777..2413859) PHAGE_Salmon_ST64B: putative head assembly protein; ECLT68_2675; phage(gi23505465) 5e-79 Click
14complement(2413852..2414199) PHAGE_Salmon_ST64B: putative tail protein; ECLT68_2676; phage(gi23505464) 1e-48 Click
15complement(2414271..2414804) PHAGE_Salmon_ST64B: putative base plate assembly protein; ECLT68_2677; phage(gi23505463) 2e-73 Click
16complement(2414782..2415858) PHAGE_Salmon_ST64B: Tail protein; ECLT68_2678; phage(gi23505462) 4e-151 Click
17complement(2415855..2417264) PHAGE_Salmon_ST64B: tail/DNA circulation protein; ECLT68_2679; phage(gi23505461) 1e-125 Click
18complement(2417311..2417517) hypothetical protein; ECLT68_2680 0.0 Click
19complement(2417860..2419809) PHAGE_Salmon_ST64B: tail protein; ECLT68_2681; phage(gi23505460) 0.0 Click
20complement(2419894..2420223) PHAGE_Salmon_ST64B: hypothetical protein sb15; ECLT68_2682; phage(gi23505501) 7e-37 Click
21complement(2420177..2420551) PHAGE_Salmon_ST64B: Tail tube protein; ECLT68_2683; phage(gi23505459) 6e-42 Click
22complement(2420583..2422079) PHAGE_Salmon_ST64B: Tail Sheath protein; ECLT68_2684; phage(gi23505458) 0.0 Click
23complement(2422076..2422237) PHAGE_Salmon_ST64B: hypothetical protein sb12; ECLT68_2685; phage(gi23505457) 1e-14 Click
24complement(2422247..2422810) PHAGE_Salmon_ST64B: hypothetical protein sb11; ECLT68_2686; phage(gi23505456) 3e-87 Click
25complement(2422807..2423331) PHAGE_Salmon_ST64B: hypothetical protein sb10; ECLT68_2687; phage(gi23505455) 6e-59 Click
26complement(2423297..2423713) PHAGE_Salmon_ST64B: hypothetical protein sb9; ECLT68_2688; phage(gi23505454) 5e-48 Click
27complement(2423710..2424033) PHAGE_Salmon_ST64B: hypothetical protein sb8; ECLT68_2689; phage(gi23505453) 2e-37 Click
28complement(2424078..2424503) PHAGE_Salmon_ST64B: Major capsid protein precursor; ECLT68_2690; phage(gi23505451) 1e-68 Click
29complement(2424500..2425303) PHAGE_Salmon_ST64B: Major capsid protein precursor; ECLT68_2691; phage(gi23505451) 2e-117 Click
30complement(2425502..2426743) PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_2692; phage(gi24375070) 7e-51 Click
31complement(2426772..2427272) PHAGE_Salmon_ST64B: Pro-head protease; ECLT68_2693; phage(gi23505450) 2e-91 Click
32complement(2427250..2428434) PHAGE_Salmon_ST64B: Portal Protein; ECLT68_2694; phage(gi23505449) 0.0 Click
33complement(2428491..2428646) PHAGE_Salmon_ST64B: putative integral membrane protein; ECLT68_2695; phage(gi23505448) 2e-18 Click
34complement(2428685..2429950) PHAGE_Salmon_ST64B: Terminase large subunit; ECLT68_2696; phage(gi23505447) 8e-64 Click
35complement(2430020..2430442) PHAGE_Entero_mEp235: terminase large subunit; ECLT68_2697; phage(gi428781812) 1e-61 Click
36complement(2430442..2430762) PHAGE_Entero_mEp235: terminase small subunit; ECLT68_2698; phage(gi428781811) 4e-46 Click
37complement(2431072..2431323) PHAGE_Salmon_ST64B: hypothetical protein sb56; ECLT68_2699; phage(gi23505500) 2e-38 Click
38complement(2431465..2431621) PHAGE_Salmon_ST64B: lysis protein; ECLT68_2700; phage(gi23505497) 1e-12 Click
39complement(2431659..2432024) PHAGE_Escher_HK75: RusA-like protein; ECLT68_2701; phage(gi356870726) 2e-39 Click
40complement(2432025..2433011) PHAGE_Salmon_ST64B: hypothetical protein sb47; ECLT68_2702; phage(gi23505491) 8e-47 Click
412433010..2433555 hypothetical protein; ECLT68_2703 0.0 Click
422433999..2434301 PROPHAGE_Xantho_33913: ISxac3 transposase; ECLT68_2704; phage(gi21231087) 9e-10 Click
432434442..2435155 PROPHAGE_Escher_CFT073: transposase insF; ECLT68_2705; phage(gi26249410) 9e-137 Click
44complement(2435604..2436026) PHAGE_Entero_phiV10: hypothetical protein PhiV10p53; ECLT68_2706; phage(gi89152467) 4e-06 Click
45complement(2436117..2436572) PHAGE_Salmon_ST64B: hypothetical protein sb32; ECLT68_2707; phage(gi23505476) 1e-20 Click
46complement(2436559..2436834) PHAGE_Klebsi_phiKO2: Gp58; ECLT68_2708; phage(gi46402144) 1e-22 Click
47complement(2436861..2437157) hypothetical protein; ECLT68_2709 0.0 Click
48complement(2437323..2438180) PHAGE_Salmon_ST64B: putative replication protein; ECLT68_2710; phage(gi23505486) 1e-26 Click
49complement(2438194..2438421) hypothetical protein; ECLT68_2711 0.0 Click
50complement(2438643..2439200) hypothetical protein; ECLT68_2712 0.0 Click
51complement(2439166..2439591) PHAGE_Pectob_ZF40: putative cII repressor; ECLT68_2713; phage(gi422936652) 2e-06 Click
52complement(2439588..2439851) PHAGE_Gifsy_2: putative bacteriophage regulatory protein; Lambda gpCro analog; ECLT68_2714; phage(gi169257277) 5e-09 Click
532439963..2440463 PHAGE_Cronob_ENT39118: phage repressor protein; ECLT68_2715; phage(gi431811060) 2e-11 Click
542440504..2440677 stability determinant domain protein; ECLT68_2716 0.0 Click
552441163..2441393 PHAGE_Salico_CGphi29: hypothetical protein; ECLT68_2717; phage(gi472340166) 2e-08 Click
562441393..2441779 PHAGE_Escher_TL_2011c: hypothetical protein; ECLT68_2718; phage(gi418487085) 3e-07 Click
57complement(2441858..2442304) hypothetical protein; ECLT68_2719 0.0 Click
582442452..2442463 attR    TGTCATATGATT 0.0 Click
59complement(2442704..2443570) PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_2720; phage(gi24375070) 9e-34 Click
60complement(2443601..2443996) PROPHAGE_Xantho_33913: IS1481 transposase; ECLT68_2721; phage(gi21229606) 2e-10 Click
612444609..2445166 PHAGE_Salmon_ST64B: putative antirepressor; ECLT68_2722; phage(gi23505485) 1e-26 Click
622445177..2445365 division inhibition protein dicB; ECLT68_2723 0.0 Click
632445362..2445550 hypothetical protein; ECLT68_2724 0.0 Click
642445784..2448084 PHAGE_Salmon_SPN3UB: RecE; ECLT68_2725; phage(gi423262421) 5e-101 Click
652448224..2448346 hypothetical protein; ECLT68_2726 0.0 Click
662448742..2449017 PHAGE_Salmon_ST64B: Integrase protein; ECLT68_2727; phage(gi23505472) 1e-27 Click
672449113..2449370 PHAGE_Salmon_ST64B: Integrase protein; ECLT68_2728; phage(gi23505472) 5e-24 Click
682450833..2450845 attR    TTTTTTCGCTGTG 0.0 Click

Region 11, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12610508..2610521 attL    ATTTCAGGGATGAA 0.0 Click
2complement(2624585..2624962) PHAGE_Entero_phiP27: hypothetical protein P27p57; ECLT68_2900; phage(gi18249921) 1e-50 Click
3complement(2625158..2626570) PHAGE_Entero_phiP27: putative tail fiber protein; ECLT68_2901; phage(gi18249920) 1e-73 Click
4complement(2626634..2627233) PHAGE_Entero_mEp460: Lom protein; ECLT68_2902; phage(gi428782335) 9e-105 Click
5complement(2627301..2628407) PHAGE_Stx2_c_1717: putative tail fiber component J; ECLT68_2903; phage(gi209447196) 1e-165 Click
6complement(2628614..2629776) PHAGE_Entero_mEp460: host specificity protein; ECLT68_2904; phage(gi428782334) 0.0 Click
7complement(2629777..2630024) PHAGE_Burkho_BcepB1A: gp33 TerL; ECLT68_2905; phage(gi48697520) 2e-14 Click
8complement(2630027..2630173) terminase small subunit; ECLT68_2906 0.0 Click
9complement(2630712..2630840) hypothetical protein; ECLT68_2907 0.0 Click
10complement(2630912..2631508) PHAGE_Acinet_AP22: putative DNA-binding protein; ECLT68_2908; phage(gi388570841) 1e-15 Click
11complement(2631803..2632177) PHAGE_Entero_mEp460: Rz lysis protein; ECLT68_2909; phage(gi428782373) 7e-56 Click
12complement(2632174..2632491) PHAGE_Stx2_c_1717: phage-related lysozyme; ECLT68_2910; phage(gi209447172) 9e-58 Click
13complement(2632670..2632876) PHAGE_Entero_mEp460: porin; ECLT68_2911; phage(gi428782370) 6e-30 Click
14complement(2633178..2633252) tRNA 0.0 Click
15complement(2633256..2633331) tRNA 0.0 Click
16complement(2633334..2633410) tRNA 0.0 Click
17complement(2633412..2633488) tRNA 0.0 Click
18complement(2633697..2634254) PHAGE_Stx2_c_II: putative antirepressor-like protein; ECLT68_2916; phage(gi302393152) 7e-60 Click
19complement(2634527..2635081) hypothetical protein; ECLT68_2917 0.0 Click
20complement(2635078..2635368) PHAGE_Erwini_phiEt88: hypothetical protein; ECLT68_2918; phage(gi327198620) 2e-33 Click
21complement(2635368..2635967) PHAGE_Entero_mEp237: hypothetical protein; ECLT68_2919; phage(gi435439315) 9e-54 Click
22complement(2636028..2636195) hypothetical protein; ECLT68_2920 0.0 Click
23complement(2636368..2636481) hypothetical protein; ECLT68_2921 0.0 Click
24complement(2637188..2637337) hypothetical protein; ECLT68_2922 0.0 Click
252637900..2638082 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip072; ECLT68_2923; phage(gi20065867) 6e-14 Click
26complement(2638656..2638778) hypothetical protein; ECLT68_2924 0.0 Click
27complement(2638794..2638943) PHAGE_Shigel_AG3: hypothetical protein; ECLT68_2925; phage(gi282599330) 1e-07 Click
28complement(2638936..2639052) hypothetical protein; ECLT68_2926 0.0 Click
29complement(2639212..2639568) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; ECLT68_2927; phage(gi20065868) 2e-08 Click
30complement(2639626..2640018) hypothetical protein; ECLT68_2928 0.0 Click
312641102..2641269 PHAGE_Entero_mEp237: prophage repressor; ECLT68_2929; phage(gi435439304) 1e-07 Click
322641575..2641730 PHAGE_Salico_CGphi29: hypothetical protein; ECLT68_2930; phage(gi472340166) 2e-09 Click
332641732..2641935 PHAGE_Cronob_phiES15: hypothetical protein; ECLT68_2931; phage(gi401817573) 1e-12 Click
34complement(2642233..2642484) hypothetical protein; ECLT68_2932 0.0 Click
352642785..2643288 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_2933; phage(gi16131317) 2e-87 Click
362643338..2643943 PHAGE_Entero_4795: putative integrase; ECLT68_2934; phage(gi157165986) 1e-55 Click
372643995..2644930 PHAGE_Parame_FR483: hypothetical protein FR483_N404R; ECLT68_2935; phage(gi155370502) 4e-08 Click
38complement(2645059..2646432) PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; ECLT68_2936; phage(gi310831360) 4e-46 Click
392656396..2656409 attR    ATTTCAGGGATGAA 0.0 Click

Region 12, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12848777..2849895 PHAGE_Plankt_PaV_LD: ABC transporter; ECLT68_3149; phage(gi371496158) 6e-27 Click
22849909..2850742 putrescine transport system permease protein potH; ECLT68_3150 0.0 Click
3complement(2850975..2851556) PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; ECLT68_3151; phage(gi16129505) 1e-102 Click
4complement(2851556..2853022) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; ECLT68_3152; phage(gi16129506) 3e-129 Click
52853093..2853890 PHAGE_Entero_lambda: hypothetical protein lambdap90; ECLT68_3153; phage(gi9626267) 2e-54 Click
62854278..2854451 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECLT68_3154; phage(gi157166059) 2e-29 Click
7complement(2854452..2855091) PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECLT68_3155; phage(gi209447197) 2e-111 Click
82856093..2856413 PHAGE_Escher_D108: G region invertase; ECLT68_3156; phage(gi281199698) 8e-54 Click
92856413..2856679 PHAGE_Escher_D108: G region invertase; ECLT68_3157; phage(gi281199698) 2e-22 Click
10complement(2856715..2857203) PHAGE_Entero_PsP3: gp25; ECLT68_3158; phage(gi41057377) 1e-32 Click
11complement(2857216..2858289) PHAGE_Entero_PsP3: gp24; ECLT68_3159; phage(gi41057376) 2e-26 Click
12complement(2858334..2859401) PHAGE_Entero_PsP3: gp24; ECLT68_3160; phage(gi41057376) 2e-51 Click
13complement(2859638..2860021) PHAGE_Burkho_phiE202: gp26, bacteriophage membrane protein; ECLT68_3161; phage(gi134288775) 2e-05 Click
14complement(2860008..2860136) PHAGE_Entero_PsP3: gp23.5; ECLT68_3162; phage(gi41057394) 3e-06 Click
15complement(2860172..2860537) PROPHAGE_Salmon_Ty2: putative phage tail protein; ECLT68_3163; phage(gi29143760) 2e-06 Click
16complement(2860592..2860894) PHAGE_Mannhe_phiMHaA1: tail tube protein FII; ECLT68_3164; phage(gi109289961) 9e-16 Click
17complement(2860885..2861109) PHAGE_Entero_PsP3: gp22; ECLT68_3165; phage(gi41057374) 4e-13 Click
18complement(2861102..2861839) PHAGE_Entero_PsP3: gp21; ECLT68_3166; phage(gi41057373) 1e-63 Click
19complement(2861836..2862285) PHAGE_Burkho_phiE202: gp30, phage tail sheath protein; ECLT68_3167; phage(gi134288772) 2e-27 Click
202862265..2862396 hypothetical protein; ECLT68_3168 0.0 Click
212862443..2863552 PHAGE_Entero_PsP3: gp26; ECLT68_3169; phage(gi41057378) 9e-93 Click
222863595..2863855 PHAGE_Entero_PsP3: Pag; ECLT68_3170; phage(gi41057379) 6e-06 Click
23complement(2864486..2865778) seryl-tRNA synthetase; ECLT68_3171 0.0 Click
24complement(2865869..2867212) PHAGE_Vibrio_vB_VpaS_MAR10: putative DNA polymerase III; ECLT68_3172; phage(gi428782157) 1e-11 Click

Region 13, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2919988..2920143) PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); ECLT68_3226; phage(gi169936018) 3e-12 Click
2complement(2920297..2921397) PHAGE_Entero_2: P2 gpD-like tail protein; ECLT68_3227; phage(gi169936019) 0.0 Click
3complement(2921394..2921879) PHAGE_Entero_2: P2 gpU-like tail protein; ECLT68_3228; phage(gi169936020) 2e-74 Click
4complement(2921876..2924953) PHAGE_Entero_2: P2 gpT-like tail protein; ECLT68_3229; phage(gi169936021) 0.0 Click
5complement(2924946..2925065) PHAGE_Entero_2: P2 gpE-like protein; ECLT68_3230; phage(gi169936022) 3e-14 Click
6complement(2925080..2925382) PHAGE_Entero_2: P2 gpE-like tail protein; ECLT68_3231; phage(gi169936023) 2e-44 Click
7complement(2925437..2925952) PHAGE_Entero_2: P2 gpFII-like protein; ECLT68_3232; phage(gi169936024) 8e-92 Click
8complement(2925962..2927110) PHAGE_Entero_2: P2 gpFI-like protein; ECLT68_3233; phage(gi169936025) 0.0 Click
92927179..2927319 hypothetical protein; ECLT68_3234 0.0 Click
10complement(2927277..2927843) PHAGE_Entero_2: DNA-invertase; ECLT68_3235; phage(gi169936026) 2e-88 Click
112928003..2928368 PHAGE_Entero_mEp213: tail fiber; ECLT68_3236; phage(gi428782611) 1e-29 Click
122928368..2928979 PHAGE_Entero_mEp213: tail fiber assembly protein; ECLT68_3237; phage(gi428782612) 1e-75 Click
13complement(2929140..2930786) PHAGE_Entero_2: P2 gpH-like protein; ECLT68_3238; phage(gi169936030) 3e-121 Click
14complement(2930783..2931388) PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; ECLT68_3239; phage(gi169936031) 6e-112 Click
15complement(2931381..2932283) PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; ECLT68_3240; phage(gi169936032) 1e-146 Click
16complement(2932276..2932635) PHAGE_Entero_2: P2 gpW-like baseplate protein; ECLT68_3241; phage(gi169936033) 1e-50 Click
17complement(2932632..2933210) PHAGE_Entero_2: P2 gpV-like protein; ECLT68_3242; phage(gi169936034) 2e-96 Click
18complement(2933279..2933725) PHAGE_Entero_2: P2 gpS-like tail completion protein; ECLT68_3243; phage(gi169936035) 9e-72 Click
19complement(2933718..2934149) PHAGE_Entero_2: P2 gpR-like tail completion protein; ECLT68_3244; phage(gi169936036) 1e-72 Click
20complement(2934142..2934285) PHAGE_Entero_2: P2 LysC-like protein; ECLT68_3245; phage(gi169936037) 8e-17 Click
21complement(2934245..2934664) PHAGE_Entero_2: P2 LysB-like protein; ECLT68_3246; phage(gi169936038) 3e-54 Click
22complement(2934670..2935047) putative membrane protein; ECLT68_3247 0.0 Click
23complement(2935049..2935522) PHAGE_Entero_2: endolysin; ECLT68_3248; phage(gi169936041) 2e-80 Click
24complement(2935542..2935757) PHAGE_Entero_2: lysis protein; ECLT68_3249; phage(gi169936042) 5e-29 Click
25complement(2935761..2935964) PHAGE_Entero_2: P2 gpX-like tail protein; ECLT68_3250; phage(gi169936043) 1e-32 Click
26complement(2935964..2936428) PHAGE_Entero_2: P2 gpL-like protein; ECLT68_3251; phage(gi169936044) 3e-79 Click
27complement(2936524..2937174) PHAGE_Entero_2: P2 gpM-like protein; ECLT68_3252; phage(gi169936045) 3e-113 Click
28complement(2937178..2938236) PHAGE_Entero_2: P2 gpN-like major capsid protein; ECLT68_3253; phage(gi169936046) 2e-178 Click
29complement(2938253..2938474) PHAGE_Entero_2: P2 gpO-like protein; ECLT68_3254; phage(gi169936047) 9e-24 Click
30complement(2938441..2939085) PHAGE_Entero_2: P2 gpO-like protein; ECLT68_3255; phage(gi169936047) 9e-93 Click
312939228..2940994 PHAGE_Entero_2: P2 gpP-like protein; ECLT68_3256; phage(gi169936048) 0.0 Click
322940994..2942031 PHAGE_Entero_2: P2 gpQ-like protein; ECLT68_3257; phage(gi169936049) 1e-172 Click
33complement(2942066..2942806) HIRAN domain protein; ECLT68_3258 0.0 Click
34complement(2942803..2943717) hypothetical protein; ECLT68_3259 0.0 Click
35complement(2944776..2946017) PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_3260; phage(gi24375070) 7e-51 Click

Region 14, total : 45 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12919231..2919242 attL    TTCTTTGTTATT 0.0 Click
2complement(2919988..2920143) PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); ECLT68_3226; phage(gi169936018) 3e-12 Click
3complement(2920297..2921397) PHAGE_Entero_2: P2 gpD-like tail protein; ECLT68_3227; phage(gi169936019) 0.0 Click
4complement(2921394..2921879) PHAGE_Entero_2: P2 gpU-like tail protein; ECLT68_3228; phage(gi169936020) 2e-74 Click
5complement(2921876..2924953) PHAGE_Entero_2: P2 gpT-like tail protein; ECLT68_3229; phage(gi169936021) 0.0 Click
6complement(2924946..2925065) PHAGE_Entero_2: P2 gpE-like protein; ECLT68_3230; phage(gi169936022) 3e-14 Click
7complement(2925080..2925382) PHAGE_Entero_2: P2 gpE-like tail protein; ECLT68_3231; phage(gi169936023) 2e-44 Click
8complement(2925437..2925952) PHAGE_Entero_2: P2 gpFII-like protein; ECLT68_3232; phage(gi169936024) 8e-92 Click
9complement(2925962..2927110) PHAGE_Entero_2: P2 gpFI-like protein; ECLT68_3233; phage(gi169936025) 0.0 Click
102927179..2927319 hypothetical protein; ECLT68_3234 0.0 Click
11complement(2927277..2927843) PHAGE_Entero_2: DNA-invertase; ECLT68_3235; phage(gi169936026) 2e-88 Click
122928003..2928368 PHAGE_Entero_mEp213: tail fiber; ECLT68_3236; phage(gi428782611) 1e-29 Click
132928368..2928979 PHAGE_Entero_mEp213: tail fiber assembly protein; ECLT68_3237; phage(gi428782612) 1e-75 Click
14complement(2929140..2930786) PHAGE_Entero_2: P2 gpH-like protein; ECLT68_3238; phage(gi169936030) 3e-121 Click
15complement(2930783..2931388) PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; ECLT68_3239; phage(gi169936031) 6e-112 Click
16complement(2931381..2932283) PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; ECLT68_3240; phage(gi169936032) 1e-146 Click
17complement(2932276..2932635) PHAGE_Entero_2: P2 gpW-like baseplate protein; ECLT68_3241; phage(gi169936033) 1e-50 Click
18complement(2932632..2933210) PHAGE_Entero_2: P2 gpV-like protein; ECLT68_3242; phage(gi169936034) 2e-96 Click
19complement(2933279..2933725) PHAGE_Entero_2: P2 gpS-like tail completion protein; ECLT68_3243; phage(gi169936035) 9e-72 Click
20complement(2933718..2934149) PHAGE_Entero_2: P2 gpR-like tail completion protein; ECLT68_3244; phage(gi169936036) 1e-72 Click
21complement(2934142..2934285) PHAGE_Entero_2: P2 LysC-like protein; ECLT68_3245; phage(gi169936037) 8e-17 Click
22complement(2934245..2934664) PHAGE_Entero_2: P2 LysB-like protein; ECLT68_3246; phage(gi169936038) 3e-54 Click
23complement(2934670..2935047) putative membrane protein; ECLT68_3247 0.0 Click
24complement(2935049..2935522) PHAGE_Entero_2: endolysin; ECLT68_3248; phage(gi169936041) 2e-80 Click
25complement(2935542..2935757) PHAGE_Entero_2: lysis protein; ECLT68_3249; phage(gi169936042) 5e-29 Click
26complement(2935761..2935964) PHAGE_Entero_2: P2 gpX-like tail protein; ECLT68_3250; phage(gi169936043) 1e-32 Click
27complement(2935964..2936428) PHAGE_Entero_2: P2 gpL-like protein; ECLT68_3251; phage(gi169936044) 3e-79 Click
28complement(2936524..2937174) PHAGE_Entero_2: P2 gpM-like protein; ECLT68_3252; phage(gi169936045) 3e-113 Click
29complement(2937178..2938236) PHAGE_Entero_2: P2 gpN-like major capsid protein; ECLT68_3253; phage(gi169936046) 2e-178 Click
30complement(2938253..2938474) PHAGE_Entero_2: P2 gpO-like protein; ECLT68_3254; phage(gi169936047) 9e-24 Click
31complement(2938441..2939085) PHAGE_Entero_2: P2 gpO-like protein; ECLT68_3255; phage(gi169936047) 9e-93 Click
322939228..2940994 PHAGE_Entero_2: P2 gpP-like protein; ECLT68_3256; phage(gi169936048) 0.0 Click
332940994..2942031 PHAGE_Entero_2: P2 gpQ-like protein; ECLT68_3257; phage(gi169936049) 1e-172 Click
34complement(2942066..2942806) HIRAN domain protein; ECLT68_3258 0.0 Click
35complement(2942803..2943717) hypothetical protein; ECLT68_3259 0.0 Click
36complement(2944776..2946017) PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_3260; phage(gi24375070) 7e-51 Click
37complement(2946376..2946609) PHAGE_Entero_2: TumB protein; ECLT68_3261; phage(gi169936052) 6e-38 Click
38complement(2946960..2949359) PHAGE_Entero_2: P2 gpA-like protein; ECLT68_3262; phage(gi169936054) 0.0 Click
39complement(2949371..2950228) PHAGE_Entero_2: DNA adenine methylase-like protein; ECLT68_3263; phage(gi169936055) 1e-118 Click
40complement(2950225..2950452) PHAGE_Entero_2: P2 gpOrf82-like protein; ECLT68_3264; phage(gi169936056) 5e-35 Click
41complement(2950452..2950685) PHAGE_Entero_2: hypothetical protein STM2732.Fels2; ECLT68_3265; phage(gi169936057) 2e-27 Click
42complement(2950753..2951094) PHAGE_Entero_2: hypothetical protein STM2733.Fels2; ECLT68_3266; phage(gi169936058) 1e-51 Click
43complement(2951212..2951337) hypothetical protein; ECLT68_3267 0.0 Click
44complement(2951516..2952025) PHAGE_Entero_2: bacteriophage regulatory protein CII; ECLT68_3268; phage(gi169936061) 2e-83 Click
45complement(2952090..2952293) PHAGE_Pasteu_F108: Cox; ECLT68_3269; phage(gi109302900) 2e-06 Click
462953060..2953071 attR    TTCTTTGTTATT 0.0 Click
472953405..2954448 PHAGE_Entero_2: P2 Int-like protein; ECLT68_3270; phage(gi169936064) 2e-102 Click

Region 15, total : 66 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13028302..3028321 attL    CGCCTTATCCGGCCTACAAA 0.0 Click
2complement(3039056..3039433) PHAGE_Entero_phiP27: hypothetical protein P27p57; ECLT68_3355; phage(gi18249921) 1e-50 Click
3complement(3039757..3041040) PHAGE_Entero_phiP27: putative tail fiber protein; ECLT68_3356; phage(gi18249920) 2e-66 Click
4complement(3041103..3041702) PHAGE_Entero_mEp460: Lom protein; ECLT68_3357; phage(gi428782335) 9e-105 Click
5complement(3041770..3045249) PHAGE_Entero_mEp460: host specificity protein; ECLT68_3358; phage(gi428782334) 0.0 Click
6complement(3045310..3045660) PHAGE_Entero_mEp460: tail assembly protein; ECLT68_3359; phage(gi428782333) 3e-46 Click
7complement(3045811..3046554) PHAGE_Entero_mEp460: tail fiber component; ECLT68_3360; phage(gi428782332) 4e-144 Click
8complement(3046559..3046999) PHAGE_Entero_mEp460: minor tail protein; ECLT68_3361; phage(gi428782331) 1e-74 Click
9complement(3047139..3047255) PHAGE_Entero_mEp460: minor tail protein; ECLT68_3362; phage(gi428782331) 1e-08 Click
10complement(3047255..3047584) PHAGE_Entero_mEp460: minor tail protein; ECLT68_3363; phage(gi428782330) 3e-58 Click
11complement(3047584..3049869) PHAGE_Entero_mEp460: tail length tape measure protein; ECLT68_3364; phage(gi428782329) 0.0 Click
12complement(3050126..3050620) PHAGE_Entero_mEp460: tail length tape measure protein; ECLT68_3365; phage(gi428782329) 1e-71 Click
13complement(3050592..3050867) PHAGE_Entero_mEp460: tail assembly protein; ECLT68_3366; phage(gi428782328) 5e-48 Click
14complement(3050930..3051334) PHAGE_Entero_mEp460: minor tail protein; ECLT68_3367; phage(gi428782327) 1e-63 Click
15complement(3051375..3052115) PHAGE_Entero_mEp460: major tail protein; ECLT68_3368; phage(gi428782326) 1e-131 Click
16complement(3052126..3052527) PHAGE_Entero_mEp460: minor tail protein; ECLT68_3369; phage(gi428782325) 2e-72 Click
17complement(3052524..3053108) PHAGE_Entero_mEp460: minor tail protein; ECLT68_3370; phage(gi428782324) 2e-93 Click
18complement(3053120..3053395) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_3371; phage(gi428782323) 5e-46 Click
19complement(3053388..3053711) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_3372; phage(gi428782322) 1e-54 Click
20complement(3053797..3055005) PHAGE_Entero_mEp460: putative protease/scaffold protein; ECLT68_3373; phage(gi428782321) 0.0 Click
21complement(3055029..3055787) PHAGE_Entero_mEp460: putative protease/scaffold protein; ECLT68_3374; phage(gi428782321) 3e-121 Click
22complement(3055801..3056637) PHAGE_Entero_mEp460: portal protein; ECLT68_3375; phage(gi428782320) 2e-133 Click
23complement(3056667..3057305) PHAGE_Entero_mEp460: portal protein; ECLT68_3376; phage(gi428782320) 9e-87 Click
24complement(3057305..3057517) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_3377; phage(gi428782319) 1e-29 Click
25complement(3057554..3059503) PHAGE_Entero_mEp460: terminase large subunit; ECLT68_3378; phage(gi428782318) 0.0 Click
26complement(3059614..3060108) PHAGE_Entero_mEp460: terminase small subunit; ECLT68_3379; phage(gi428782317) 7e-85 Click
27complement(3060260..3060403) hypothetical protein; ECLT68_3380 0.0 Click
283060466..3060642 hypothetical protein; ECLT68_3381 0.0 Click
29complement(3060719..3060919) PHAGE_Entero_mEp234: hypothetical protein; ECLT68_3382; phage(gi428782313) 4e-32 Click
30complement(3060973..3061539) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp49; ECLT68_3383; phage(gi209447174) 5e-93 Click
31complement(3061683..3061997) addiction module toxin, RelE/StbE family; ECLT68_3384 0.0 Click
32complement(3061972..3062202) hypothetical protein; ECLT68_3385 0.0 Click
33complement(3062343..3062810) PHAGE_Entero_mEp460: Rz lysis protein; ECLT68_3386; phage(gi428782373) 2e-74 Click
34complement(3063004..3063339) PHAGE_Entero_mEp460: endolysin; ECLT68_3387; phage(gi428782372) 8e-46 Click
35complement(3063661..3064191) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_3388; phage(gi428782371) 5e-37 Click
363064300..3064683 PHAGE_Escher_D108: tail fiber assembly protein; ECLT68_2236; phage(gi281199696) 6e-68 Click
37complement(3064712..3065155) PHAGE_Escher_D108: probable tail fiber assembly protein; ECLT68_2237; phage(gi281199695) 3e-78 Click
38complement(3065243..3065683) PHAGE_Escher_D108: tail fiber protein; ECLT68_2238; phage(gi281199694) 8e-75 Click
39complement(3065716..3066082) PHAGE_Entero_HK620: hypothetical protein HK620p38; ECLT68_3389; phage(gi13559861) 1e-69 Click
40complement(3066288..3066755) PHAGE_Entero_mEp460: Rz lysis protein; ECLT68_3390; phage(gi428782373) 5e-74 Click
41complement(3066752..3067285) PHAGE_Entero_mEp460: endolysin; ECLT68_3391; phage(gi428782372) 2e-101 Click
42complement(3067351..3067980) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; ECLT68_3392; phage(gi116221997) 2e-32 Click
43complement(3067984..3068190) PHAGE_Entero_mEp460: porin; ECLT68_3393; phage(gi428782370) 6e-30 Click
44complement(3068491..3068565) tRNA 0.0 Click
45complement(3068569..3068644) tRNA 0.0 Click
46complement(3068724..3068800) tRNA 0.0 Click
473068821..3068970 hypothetical protein; ECLT68_3397 0.0 Click
48complement(3069000..3069380) PHAGE_Entero_2008: antitermination protein Q; ECLT68_3398; phage(gi209427762) 2e-62 Click
49complement(3069373..3069519) PHAGE_Escher_TL_2011c: phage NinH family protein; ECLT68_3399; phage(gi418487065) 6e-15 Click
50complement(3069668..3069910) PHAGE_Entero_phiP27: hypothetical protein P27p20; ECLT68_3400; phage(gi18249884) 1e-36 Click
51complement(3069922..3070701) PHAGE_Entero_phiP27: putative helicase; ECLT68_3401; phage(gi18249883) 3e-143 Click
52complement(3070659..3071312) PHAGE_Entero_phiP27: putative helicase; ECLT68_3402; phage(gi18249883) 5e-101 Click
53complement(3071309..3071926) PHAGE_Entero_phiP27: putative replication protein DnaC; ECLT68_3403; phage(gi18249882) 2e-112 Click
54complement(3071954..3072187) PHAGE_Entero_phiP27: putative replication protein DnaC; ECLT68_3404; phage(gi18249882) 9e-16 Click
55complement(3072198..3073130) PHAGE_Entero_phiP27: hypothetical protein P27p17; ECLT68_3405; phage(gi18249881) 6e-73 Click
56complement(3073123..3073269) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_3406; phage(gi428782358) 3e-10 Click
57complement(3073320..3073514) hypothetical protein; ECLT68_3407 0.0 Click
58complement(3073511..3074359) PHAGE_Entero_mEp460: regulatory protein Rha; ECLT68_3408; phage(gi428782357) 5e-78 Click
59complement(3074356..3075249) PHAGE_Entero_phiP27: hypothetical protein P27p15; ECLT68_3409; phage(gi18249879) 1e-159 Click
60complement(3075233..3075661) PHAGE_Entero_phiP27: hypothetical protein P27p14; ECLT68_3410; phage(gi18249878) 9e-47 Click
613075754..3076030 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_3411; phage(gi16131317) 4e-42 Click
623076031..3076318 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_3412; phage(gi16131317) 5e-48 Click
633076404..3076517 hypothetical protein; ECLT68_3413 0.0 Click
643076545..3076713 PHAGE_Entero_phiP27: putative serine protease; ECLT68_3414; phage(gi18249869) 5e-21 Click
653076907..3077041 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF3; ECLT68_3415; phage(gi157165988) 3e-22 Click
663077174..3077314 PHAGE_Entero_2008: putative excisionase; ECLT68_3416; phage(gi209427728) 8e-23 Click
673077348..3078634 PROPHAGE_Escher_Sakai: putative integrase; ECLT68_3417; phage(gi15832267) 0.0 Click
683078709..3079356 HTH-type transcriptional regulator mlrA; ECLT68_3418 0.0 Click
69complement(3079504..3080235) inner membrane ABC transporter permease protein yehW; ECLT68_3419 0.0 Click
70complement(3080240..3081166) PHAGE_Plankt_PaV_LD: ABC transporter; ECLT68_3420; phage(gi371496158) 1e-24 Click
713083400..3083419 attR    CGCCTTATCCGGCCTACAAA 0.0 Click

Region 16, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13138662..3138673 attL    TCCGTCTTTATA 0.0 Click
23146853..3147041 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; ECLT68_3483; phage(gi16130540) 1e-13 Click
33147200..3147967 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; ECLT68_3484; phage(gi16130540) 5e-64 Click
43148184..3148414 hypothetical protein; ECLT68_3485 0.0 Click
5complement(3148440..3148583) hypothetical protein; ECLT68_3486 0.0 Click
63148665..3148790 prophage CP4-57 regulatory protein family protein; ECLT68_3487 0.0 Click
73148805..3149539 hypothetical protein; ECLT68_3488 0.0 Click
83149719..3149865 icd-like protein; ECLT68_3489 0.0 Click
93149858..3150085 hypothetical protein; ECLT68_3490 0.0 Click
103150091..3150378 hypothetical protein; ECLT68_3491 0.0 Click
113150375..3152384 PHAGE_Entero_P4: DNA primase; ECLT68_3492; phage(gi9627512) 6e-08 Click
123152827..3153954 PROPHAGE_Shewan_MR-1: IS110 family transposase; ECLT68_3493; phage(gi24375433) 9e-10 Click
133154229..3154954 PHAGE_Entero_P4: DNA primase; ECLT68_3494; phage(gi9627512) 2e-44 Click
143155235..3155492 hypothetical protein; ECLT68_3495 0.0 Click
153155489..3155872 PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ECLT68_3496; phage(gi115304283) 2e-09 Click
163155977..3156171 perC transcriptional activator family protein; ECLT68_3497 0.0 Click
173156413..3156619 hypothetical protein; ECLT68_3498 0.0 Click
183156619..3157086 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; ECLT68_3499; phage(gi169257230) 1e-29 Click
193157131..3157673 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; ECLT68_3500; phage(gi169257230) 8e-45 Click
203157685..3158020 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; ECLT68_3501; phage(gi169257231) 7e-08 Click
213158033..3158404 hypothetical protein; ECLT68_3502 0.0 Click
223158832..3159116 hypothetical protein; ECLT68_3503 0.0 Click
23complement(3159719..3159844) hypothetical protein; ECLT68_3504 0.0 Click
24complement(3160198..3162789) PROPHAGE_Escher_CFT073: Pic serine protease precursor; ECLT68_3505; phage(gi26246250) 6e-17 Click
253162953..3162964 attR    TCCGTCTTTATA 0.0 Click

Region 17, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13305023..3305034 attL    TAATCTGAAAAA 0.0 Click
2complement(3305137..3306141) PHAGE_Entero_P2: Int; ECLT68_3645; phage(gi9630357) 6e-91 Click
3complement(3306238..3306357) hypothetical protein; ECLT68_3646 0.0 Click
43306755..3306961 PHAGE_Entero_P2: Cox; ECLT68_3647; phage(gi9630359) 2e-16 Click
53306968..3307174 putative membrane protein; ECLT68_3648 0.0 Click
6complement(3307279..3307719) hypothetical protein; ECLT68_3649 0.0 Click
73307957..3308298 hypothetical protein; ECLT68_3650 0.0 Click
83308309..3308587 hypothetical protein; ECLT68_3651 0.0 Click
93308599..3308841 hypothetical protein; ECLT68_3652 0.0 Click
103308838..3308951 putative membrane protein; ECLT68_3653 0.0 Click
113309038..3309241 hypothetical protein; ECLT68_3654 0.0 Click
12complement(3309252..3309365) hypothetical protein; ECLT68_3655 0.0 Click
133309501..3309800 PHAGE_Entero_mEp213: hypothetical protein; ECLT68_3656; phage(gi428782624) 4e-08 Click
143309832..3310032 PHAGE_Entero_mEp460: regulatory protein Rha; ECLT68_3657; phage(gi428782357) 6e-06 Click
153310124..3310354 hypothetical protein; ECLT68_3658 0.0 Click
163310725..3311036 hypothetical protein; ECLT68_3659 0.0 Click
173311100..3311432 clpX C4-type zinc finger family protein; ECLT68_3660 0.0 Click
183311429..3311656 hypothetical protein; ECLT68_3661 0.0 Click
193311653..3311892 PHAGE_Entero_EcP1: hypothetical protein; ECLT68_3662; phage(gi418489320) 3e-15 Click
203312387..3312515 hypothetical protein; ECLT68_3663 0.0 Click
21complement(3312584..3313675) PHAGE_Salmon_RE_2010: capsid packaging protein; ECLT68_3664; phage(gi418489696) 8e-91 Click
22complement(3313629..3313937) PHAGE_Entero_P2: gpP; ECLT68_3665; phage(gi9630329) 2e-14 Click
23complement(3314038..3315381) PROPHAGE_Ralsto_GMI1000: terminase (ATPase subunit) related protein; ECLT68_3666; phage(gi17546658) 8e-109 Click
243315543..3316373 PHAGE_Salmon_RE_2010: capsid scaffolding protein; ECLT68_3667; phage(gi418489698) 3e-45 Click
253316397..3316573 PHAGE_Mannhe_phiMHaA1: major capsid protein N; ECLT68_3668; phage(gi109289940) 8e-07 Click
263316584..3316697 hypothetical protein; ECLT68_3669 0.0 Click
273316685..3317446 PHAGE_Erwini_ENT90: major capsid protein; ECLT68_3670; phage(gi431810940) 5e-56 Click
28complement(3317447..3317587) hypothetical protein; ECLT68_3671 0.0 Click
293317561..3317743 PHAGE_Ralsto_phiRSA1: terminase; ECLT68_3672; phage(gi145708083) 1e-05 Click
303317740..3318297 PHAGE_Entero_P2: gpM; ECLT68_3673; phage(gi9630332) 3e-17 Click
313318528..3318887 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); ECLT68_3674; phage(gi134288689) 8e-20 Click
323318881..3319378 PHAGE_Salmon_RE_2010: tail component protein; ECLT68_3675; phage(gi418489702) 1e-11 Click
333319359..3319925 PHAGE_Mannhe_phiMHaA1: endolysin; ECLT68_3676; phage(gi109289945) 6e-31 Click
343319910..3320377 hypothetical protein; ECLT68_3677 0.0 Click
353320449..3321543 PHAGE_Entero_P2: gpR; ECLT68_3678; phage(gi9630339) 2e-17 Click
363321540..3322121 PHAGE_Entero_P2: gpV; ECLT68_3679; phage(gi9630342) 4e-43 Click
373322139..3322468 PHAGE_Erwini_ENT90: baseplate assembly protein; ECLT68_3680; phage(gi431810974) 9e-21 Click
383322472..3323368 PHAGE_Entero_P2: gpJ; ECLT68_3681; phage(gi9630344) 2e-84 Click
39complement(3323333..3323476) hypothetical protein; ECLT68_3682 0.0 Click
403323484..3323891 PHAGE_Entero_P2: gpI; ECLT68_3683; phage(gi9630345) 2e-52 Click
413323998..3324894 PHAGE_Entero_P2: gpH; ECLT68_3684; phage(gi9630346) 1e-127 Click
42complement(3325248..3325886) PROPHAGE_Escher_MG1655: IS4 transposase; ECLT68_3685; phage(gi16132099) 9e-119 Click
43complement(3326195..3326575) PROPHAGE_Escher_MG1655: IS4 transposase; ECLT68_3686; phage(gi16132099) 4e-47 Click
443333579..3333590 attR    TAATCTGAAAAA 0.0 Click

Region 18, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13716624..3716703 attL    AAATCCGGAAACAAGTGAGCGTTTCCGGATTCTTACACAGCCACTGGATCGGTCAACTGATCCTTAACTGATCGGCATTA 0.0 Click
23722787..3723002 PHAGE_Stx2_c_1717: putative tail fiber component J; ECLT68_4122; phage(gi209447196) 1e-18 Click
33723070..3723207 PHAGE_Entero_mEp460: Lom protein; ECLT68_4123; phage(gi428782335) 1e-11 Click
43723341..3723667 PHAGE_Entero_mEp460: Lom protein; ECLT68_4124; phage(gi428782335) 8e-57 Click
53723725..3725719 PHAGE_Entero_mEp460: side tail fiber protein; ECLT68_4125; phage(gi428782336) 4e-34 Click
6complement(3725827..3726033) PHAGE_Entero_mEp460: DinI-like protein; ECLT68_4126; phage(gi428782337) 2e-33 Click
7complement(3726136..3727233) PHAGE_Entero_mEp460: integrase; ECLT68_4127; phage(gi428782338) 0.0 Click
83727322..3728359 tRNA-dihydrouridine synthase A; ECLT68_4128 0.0 Click
93728493..3728735 phage shock protein G; ECLT68_4129 0.0 Click
10complement(3728901..3729884) hypothetical protein; ECLT68_4130 0.0 Click
113729967..3731382 PHAGE_Entero_P1: Ban; ECLT68_4131; phage(gi46401697) 0.0 Click
123742541..3742620 attR    AAATCCGGAAACAAGTGAGCGTTTCCGGATTCTTACACAGCCACTGGATCGGTCAACTGATCCTTAACTGATCGGCATTA 0.0 Click

Region 19, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13998162..3998175 attL    GGCAATCATTTCGC 0.0 Click
24007961..4008857 PROPHAGE_Escher_CFT073: putative prophage integrase; ECLT68_4420; phage(gi26250313) 8e-110 Click
34009104..4009217 hypothetical protein; ECLT68_4421 0.0 Click
44009615..4009920 hypothetical protein; ECLT68_4422 0.0 Click
54009933..4010766 PHAGE_Escher_TL_2011c: putative antirepressor; ECLT68_4423; phage(gi418487055) 1e-22 Click
64010935..4012002 PHAGE_Entero_P4: putative CI repressor; ECLT68_4424; phage(gi9627516) 8e-06 Click
74012186..4012449 hypothetical protein; ECLT68_4425 0.0 Click
8complement(4012564..4013064) PHAGE_Entero_Sf6: putative transposase OrfB; ECLT68_4426; phage(gi41057343) 1e-98 Click
9complement(4013409..4013711) PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; ECLT68_4427; phage(gi24373865) 5e-09 Click
104013804..4013920 hypothetical protein; ECLT68_4428 0.0 Click
114013913..4014515 PHAGE_Entero_phiP27: hypothetical protein P27p06; ECLT68_4429; phage(gi18249870) 2e-23 Click
124014526..4014867 hypothetical protein; ECLT68_4430 0.0 Click
134015061..4015231 hypothetical protein; ECLT68_4431 0.0 Click
144015218..4017974 PHAGE_Entero_P4: DNA primase; ECLT68_4432; phage(gi9627512) 3e-38 Click
15complement(4018263..4018376) hypothetical protein; ECLT68_4433 0.0 Click
164018583..4018720 hypothetical protein; ECLT68_4434 0.0 Click
174018737..4019138 PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; ECLT68_4435; phage(gi89885999) 3e-45 Click
184019182..4019859 PHAGE_Bacter_2: injection gp7; ECLT68_4436; phage(gi212499729) 5e-63 Click
194019892..4021178 PHAGE_Bacter_2: injection gp20; ECLT68_4437; phage(gi212499730) 4e-34 Click
204029024..4029037 attR    GGCAATCATTTCGC 0.0 Click

Region 20, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4088107..4088802) PHAGE_Entero_Mu: Mom; ECLT68_4503; phage(gi9633544) 3e-134 Click
2complement(4088753..4088941) PHAGE_Entero_Mu: Com; ECLT68_4504; phage(gi9633543) 1e-33 Click
3complement(4089024..4089320) PHAGE_Entero_Mu: Gin; ECLT68_4505; phage(gi9633542) 2e-48 Click
44089722..4090711 PHAGE_Entero_Mu: tail fiber; ECLT68_4506; phage(gi9633540) 1e-119 Click
54090713..4091003 PHAGE_Entero_Mu: tail fiber assembly; ECLT68_4507; phage(gi9633541) 4e-43 Click
64091062..4091319 PHAGE_Entero_Mu: Gin; ECLT68_4508; phage(gi9633542) 5e-38 Click
7complement(4091432..4092778) PHAGE_Entero_Mu: tail fiber fragment; ECLT68_4509; phage(gi19584574) 0.0 Click
84092777..4092893 hypothetical protein; ECLT68_4510 0.0 Click
9complement(4092898..4093440) PHAGE_Entero_Mu: hypothetical protein Mup48; ECLT68_4511; phage(gi9633539) 2e-101 Click
10complement(4093431..4093583) PHAGE_Entero_Mu: hypothetical protein Mup47; ECLT68_4512; phage(gi9633538) 9e-21 Click
11complement(4093580..4094512) PHAGE_Entero_Mu: hypothetical protein Mup47; ECLT68_4513; phage(gi9633538) 7e-175 Click
12complement(4094513..4094950) PHAGE_Entero_Mu: hypothetical protein Mup46; ECLT68_4514; phage(gi9633537) 3e-81 Click
13complement(4094947..4095516) PHAGE_Entero_Mu: putative baseplate assembly protein; ECLT68_4515; phage(gi9633536) 1e-105 Click
14complement(4095528..4096445) PHAGE_Entero_Mu: putative tail protein; ECLT68_4516; phage(gi9633535) 2e-170 Click
154096457..4097764 PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_4517; phage(gi24375070) 8e-51 Click
16complement(4097781..4098932) PHAGE_Mycoba_Boomer: gp20; ECLT68_4518; phage(gi194302967) 2e-13 Click

Region 21, total : 38 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4212071..4212808) PHAGE_Acanth_mimivirus: putative alpha/beta hydrolase; ECLT68_4636; phage(gi311977920) 6e-14 Click
2complement(4212828..4213061) PHAGE_Escher_D108: G region invertase; ECLT68_4637; phage(gi281199698) 3e-20 Click
3complement(4213067..4213399) PHAGE_Entero_2: DNA-invertase; ECLT68_4638; phage(gi169936026) 3e-52 Click
44213414..4214490 PHAGE_Entero_Mu: tail fiber; ECLT68_4639; phage(gi9633540) 1e-125 Click
54214492..4215019 PHAGE_Escher_D108: probable tail fiber assembly protein; ECLT68_4640; phage(gi281199695) 1e-89 Click
6complement(4215048..4215581) PHAGE_Entero_Mu: tail fiber assembly protein; ECLT68_4641; phage(gi19584573) 8e-99 Click
7complement(4215584..4216894) PHAGE_Entero_Mu: tail fiber fragment; ECLT68_4642; phage(gi19584574) 0.0 Click
84216851..4218146 PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_4643; phage(gi24375070) 8e-51 Click
9complement(4218163..4218333) PHAGE_Burkho_BcepMu: gp52; ECLT68_4644; phage(gi48696962) 2e-13 Click
10complement(4218336..4218914) PHAGE_Burkho_BcepMu: gp51; ECLT68_4645; phage(gi48696961) 2e-62 Click
11complement(4218907..4220010) PHAGE_Burkho_BcepMu: gp50; ECLT68_4646; phage(gi48696960) 7e-111 Click
12complement(4220001..4220348) PHAGE_Burkho_BcepMu: gp49; ECLT68_4647; phage(gi48696959) 7e-34 Click
13complement(4220405..4220917) PHAGE_Burkho_BcepMu: gp48; ECLT68_4648; phage(gi48696958) 4e-29 Click
14complement(4220934..4222067) PHAGE_Burkho_BcepMu: gp47; ECLT68_4649; phage(gi48696957) 7e-88 Click
15complement(4222055..4222267) PHAGE_Burkho_BcepMu: gp46; ECLT68_4650; phage(gi48696956) 8e-20 Click
16complement(4222267..4222962) PHAGE_Burkho_BcepMu: gp45; ECLT68_4651; phage(gi48696955) 1e-48 Click
174222978..4223178 hypothetical protein; ECLT68_4652 0.0 Click
18complement(4223151..4225628) PHAGE_Burkho_BcepMu: gp44; ECLT68_4653; phage(gi48696954) 2e-112 Click
19complement(4225786..4226121) PHAGE_Burkho_BcepMu: gp41; ECLT68_4654; phage(gi48696951) 4e-05 Click
20complement(4226491..4227012) PHAGE_Burkho_BcepMu: gp40; ECLT68_4655; phage(gi48696950) 7e-68 Click
21complement(4227012..4228439) PHAGE_Burkho_BcepMu: gp39; ECLT68_4656; phage(gi48696949) 0.0 Click
22complement(4228429..4228680) PHAGE_Burkho_BcepMu: gp38; ECLT68_4657; phage(gi48696948) 6e-09 Click
23complement(4228680..4229144) PHAGE_Burkho_BcepMu: gp37; ECLT68_4658; phage(gi48696947) 2e-41 Click
24complement(4229144..4229590) PHAGE_Burkho_BcepMu: gp36; ECLT68_4659; phage(gi48696946) 2e-36 Click
25complement(4229592..4229930) PHAGE_Burkho_BcepMu: gp35; ECLT68_4660; phage(gi48696945) 5e-22 Click
26complement(4229940..4230311) PHAGE_Burkho_BcepMu: gp34; ECLT68_4661; phage(gi48696944) 5e-13 Click
27complement(4230326..4231441) PHAGE_Burkho_BcepMu: gp32; ECLT68_4662; phage(gi48696942) 8e-99 Click
28complement(4231656..4232114) PHAGE_Burkho_BcepMu: gp31; ECLT68_4663; phage(gi48696941) 5e-33 Click
29complement(4232117..4232932) PHAGE_Burkho_BcepMu: gp30; ECLT68_4664; phage(gi48696940) 1e-96 Click
30complement(4232919..4233881) PHAGE_Burkho_BcepMu: gp29; ECLT68_4665; phage(gi48696939) 1e-99 Click
314233973..4234245 hypothetical protein; ECLT68_4666 0.0 Click
324234255..4234551 hypothetical protein; ECLT68_4667 0.0 Click
33complement(4234563..4234799) hypothetical protein; ECLT68_4668 0.0 Click
344234779..4235462 PHAGE_Pseudo_JBD24: hypothetical protein; ECLT68_4669; phage(gi448245062) 1e-28 Click
354235459..4235689 hypothetical protein; ECLT68_4670 0.0 Click
364235679..4235894 putative membrane protein; ECLT68_4671 0.0 Click
374235884..4236336 PHAGE_Burkho_BcepMu: gp02; ECLT68_4672; phage(gi48696912) 8e-26 Click
384236308..4236694 PHAGE_Burkho_BcepMu: gp01; ECLT68_4673; phage(gi48696911) 8e-31 Click

Region 22, total : 62 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14522044..4522056 attL    GATGGTGATTTTA 0.0 Click
2complement(4528348..4529040) PHAGE_Entero_HK106: integrase; ECLT68_4976; phage(gi428783305) 2e-127 Click
34528997..4529134 putative membrane protein; ECLT68_4977 0.0 Click
44529191..4529493 PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; ECLT68_4978; phage(gi24373865) 1e-09 Click
54529838..4530359 PHAGE_Entero_Sf6: putative transposase OrfB; ECLT68_4979; phage(gi41057343) 4e-104 Click
6complement(4530951..4531487) PHAGE_Stx2_c_86: phage anti-repressor protein AntB; ECLT68_4980; phage(gi116222034) 2e-82 Click
7complement(4531896..4532678) PHAGE_Stx2_c_II: putative antirepressor-like protein; ECLT68_4981; phage(gi302393152) 4e-43 Click
8complement(4532803..4533012) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF5; ECLT68_4982; phage(gi157165990) 9e-37 Click
9complement(4533040..4533333) PHAGE_Entero_HK022: hypothetical protein HK022p34; ECLT68_4983; phage(gi19343383) 5e-17 Click
10complement(4533406..4533909) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip074; ECLT68_4984; phage(gi20065869) 6e-76 Click
11complement(4533906..4534031) PHAGE_Erwini_phiEt88: DNA N-6-adenine-methyltransferase; ECLT68_4985; phage(gi327198618) 7e-05 Click
12complement(4534183..4534707) PHAGE_Stx2_c_86: exonuclease; ECLT68_4986; phage(gi116222043) 2e-99 Click
13complement(4534860..4535645) PHAGE_Stx2_c_86: recombination protein Bet; ECLT68_4987; phage(gi116222044) 2e-150 Click
14complement(4535651..4535845) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ECLT68_4988; phage(gi116222045) 1e-31 Click
154535868..4535879 attL    TTCTCTTCACGG 0.0 Click
16complement(4535962..4536465) PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_4989; phage(gi16131317) 2e-87 Click
17complement(4536688..4536867) hypothetical protein; ECLT68_4990 0.0 Click
18complement(4537777..4538451) PHAGE_Erwini_phiEt88: phage repressor protein; ECLT68_4991; phage(gi327198606) 5e-28 Click
194538620..4538820 PHAGE_Escher_HK639: cro; ECLT68_4992; phage(gi356870651) 2e-25 Click
204538959..4539258 PHAGE_Stx2_c_86: regulatory protein CII; ECLT68_4993; phage(gi116222057) 1e-42 Click
21complement(4539784..4540980) PROPHAGE_Escher_CFT073: transposase; ECLT68_4994; phage(gi26248352) 0.0 Click
224541271..4541645 PHAGE_Entero_c_1: DNA replication protein O; ECLT68_4995; phage(gi428781786) 1e-66 Click
234541753..4543489 PHAGE_Entero_Min27: putative replication protein P; ECLT68_4996; phage(gi170783639) 0.0 Click
244543508..4543642 hypothetical protein; ECLT68_4997 0.0 Click
254543675..4544658 PHAGE_Entero_c_1: hypothetical protein; ECLT68_4998; phage(gi428781787) 2e-146 Click
264544733..4545011 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip129; ECLT68_4999; phage(gi20065924) 1e-50 Click
274545008..4545418 PHAGE_Entero_mEpX1: NinB recombinase; ECLT68_5000; phage(gi428781922) 6e-74 Click
28complement(4545635..4545940) PHAGE_Azospi_Cd: Helix-turn-helix motif; ECLT68_5001; phage(gi168495160) 9e-08 Click
294546048..4546161 hypothetical protein; ECLT68_5002 0.0 Click
304546255..4546401 hypothetical protein; ECLT68_5003 0.0 Click
314546555..4547241 PHAGE_Stx2_c_II: putative antirepressor-like protein; ECLT68_5004; phage(gi302393152) 5e-102 Click
324547316..4547570 PHAGE_Stx2_c_86: DNA-binding protein Roi; ECLT68_5005; phage(gi116222069) 1e-36 Click
334547567..4548337 PHAGE_Escher_HK75: KilA; ECLT68_5006; phage(gi356870724) 7e-64 Click
344548334..4548696 PHAGE_Entero_mEpX2: endodeoxyribonuclease RusA; ECLT68_5007; phage(gi428765669) 1e-63 Click
354548878..4549501 PHAGE_Entero_mEpX1: late gene regulator Q; ECLT68_5008; phage(gi428781929) 5e-117 Click
364549762..4549836 tRNA 0.0 Click
374549842..4549917 tRNA 0.0 Click
384550043..4550249 PHAGE_Stx2_c_86: lysis protein S; ECLT68_5011; phage(gi116221996) 4e-27 Click
394550254..4550670 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; ECLT68_5012; phage(gi116221997) 6e-37 Click
404550654..4550779 hypothetical protein; ECLT68_5013 0.0 Click
414551102..4551635 PHAGE_Stx2_c_86: lysozyme protein R; ECLT68_5014; phage(gi116221999) 1e-99 Click
424551632..4552099 PHAGE_Entero_HK620: endopeptidase; ECLT68_5015; phage(gi13559860) 2e-79 Click
434552302..4552883 PHAGE_Acinet_AP22: putative DNA-binding protein; ECLT68_5016; phage(gi388570841) 2e-15 Click
444552971..4553099 hypothetical protein; ECLT68_5017 0.0 Click
454553372..4553818 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; ECLT68_5018; phage(gi422937550) 2e-22 Click
464553818..4554222 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; ECLT68_5019; phage(gi422937551) 3e-22 Click
474554268..4554447 hypothetical protein; ECLT68_5020 0.0 Click
484554634..4555041 hypothetical protein; ECLT68_5021 0.0 Click
494555131..4556315 PHAGE_Yersin_12: internal virion protein D; ECLT68_5022; phage(gi9634042) 1e-07 Click
504556446..4557156 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; ECLT68_5023; phage(gi422937557) 2e-06 Click
514557156..4557452 PHAGE_Burkho_BcepNY3: BcepNY3gp51; ECLT68_5024; phage(gi149882952) 3e-08 Click
524557454..4557693 hypothetical protein; ECLT68_5025 0.0 Click
534557695..4558324 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; ECLT68_5026; phage(gi422937559) 1e-17 Click
544558335..4558547 phage P2 baseplate assembly protein gpV; ECLT68_5027 0.0 Click
554558517..4558981 PHAGE_Xantho_OP2: putative baseplate protein; ECLT68_5028; phage(gi84662684) 2e-15 Click
564558994..4559350 PHAGE_Burkho_BcepNY3: BcepNY3gp52; ECLT68_5029; phage(gi149882953) 3e-15 Click
574559347..4560588 PHAGE_Acinet_AP22: putative baseplate J-like protein; ECLT68_5030; phage(gi388570818) 4e-52 Click
584560590..4561195 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; ECLT68_5031; phage(gi422937564) 7e-33 Click
594561380..4561949 PHAGE_Entero_Mu: tail fiber; ECLT68_5032; phage(gi9633540) 2e-37 Click
604562038..4562403 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; ECLT68_5033; phage(gi17546153) 1e-45 Click
614562645..4562845 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECLT68_5034; phage(gi24111655) 7e-35 Click
624562842..4563264 PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECLT68_5035; phage(gi24112460) 4e-79 Click
634563443..4563916 PHAGE_Salmon_ST64B: tail protein; ECLT68_5036; phage(gi23505468) 2e-20 Click
644563919..4564464 PHAGE_Entero_phiP27: putative tail fiber assembly protein; ECLT68_5037; phage(gi18249919) 3e-73 Click
654564488..4565816 PHAGE_Entero_phiP27: putative tail fiber protein; ECLT68_5038; phage(gi18249920) 1e-89 Click
664565951..4566328 PHAGE_Entero_phiP27: hypothetical protein P27p57; ECLT68_5039; phage(gi18249921) 2e-50 Click
674568239..4568250 attR    TTCTCTTCACGG 0.0 Click
684575143..4575155 attR    GATGGTGATTTTA 0.0 Click

Region 23, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4820858..4821649) PHAGE_Bordet_1: adenine DNA methyltransferase; ECLT68_5304; phage(gi41179391) 1e-66 Click
2complement(4822376..4822636) PHAGE_Entero_PsP3: Pag; ECLT68_5305; phage(gi41057379) 6e-06 Click
3complement(4822679..4823050) PHAGE_Entero_PsP3: gp26; ECLT68_5306; phage(gi41057378) 3e-26 Click
4complement(4823037..4823786) PHAGE_Entero_PsP3: gp26; ECLT68_5307; phage(gi41057378) 6e-62 Click
5complement(4823833..4823964) hypothetical protein; ECLT68_5308 0.0 Click
64823944..4825128 PHAGE_Erwini_ENT90: tail sheath protein; ECLT68_5309; phage(gi431810939) 2e-101 Click
74825121..4825639 PHAGE_Entero_PsP3: gp22; ECLT68_5310; phage(gi41057374) 5e-29 Click
84825694..4826002 PHAGE_Burkho_KS14: gp13; ECLT68_5311; phage(gi327198282) 2e-05 Click
94826093..4826221 PHAGE_Entero_PsP3: gp23.5; ECLT68_5312; phage(gi41057394) 3e-06 Click
104826208..4828934 PHAGE_Entero_PsP3: gp24; ECLT68_5313; phage(gi41057376) 5e-102 Click
114829390..4829779 hypothetical protein; ECLT68_5314 0.0 Click
12complement(4829797..4829964) PROPHAGE_Escher_Sakai: putative transposase TnA; ECLT68_5315; phage(gi15832531) 4e-24 Click
134830187..4830306 hypothetical protein; ECLT68_5316 0.0 Click
144830310..4830729 PROPHAGE_Escher_Sakai: putative transposase; ECLT68_5317; phage(gi38704244) 1e-74 Click
154830744..4831070 PROPHAGE_Escher_Sakai: putative transposase; ECLT68_5318; phage(gi38704244) 2e-49 Click
164831031..4831837 PROPHAGE_Escher_Sakai: putative transposase; ECLT68_5319; phage(gi38704244) 2e-145 Click
17complement(4831877..4833052) benzoate transporter family protein; ECLT68_5320 0.0 Click
184833144..4833680 PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; ECLT68_5321; phage(gi397912660) 1e-07 Click

Region 24, total : 44 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14964176..4964379 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ECLT68_5456; phage(gi410491512) 1e-13 Click
2complement(4964414..4965874) PHAGE_Microm_MpV1: hypothetical protein; ECLT68_5457; phage(gi313768442) 3e-41 Click
3complement(4965963..4967246) PHAGE_Burkho_phi1026b: gp59; ECLT68_5458; phage(gi38707949) 2e-33 Click
44968107..4968265 hypothetical protein; ECLT68_5459 0.0 Click
54968533..4968546 attL    TGGTGATTTTAAGG 0.0 Click
64968748..4969251 PROPHAGE_Escher_MG1655: IS1 transposase B; ECLT68_5460; phage(gi16131317) 2e-87 Click
74969358..4969948 PHAGE_Escher_D108: G region invertase; ECLT68_5461; phage(gi281199698) 5e-25 Click
8complement(4970045..4970620) PHAGE_Entero_HK629: tail fiber assembly protein; ECLT68_5462; phage(gi428782036) 2e-104 Click
9complement(4970620..4972275) PHAGE_Entero_HK629: tail fiber; ECLT68_5463; phage(gi428782035) 3e-89 Click
10complement(4972288..4972422) hypothetical protein; ECLT68_5464 0.0 Click
114972458..4973195 PHAGE_Entero_lambda: hypothetical protein lambdap90; ECLT68_5465; phage(gi9626267) 2e-56 Click
124973583..4973756 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECLT68_5466; phage(gi157166059) 2e-29 Click
13complement(4973757..4974356) PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECLT68_5467; phage(gi209427792) 9e-107 Click
14complement(4974423..4977902) PHAGE_Entero_HK629: tail fiber; ECLT68_5468; phage(gi428782032) 0.0 Click
15complement(4977962..4978534) PHAGE_Entero_HK629: tail component protein; ECLT68_5469; phage(gi428782031) 4e-101 Click
16complement(4978531..4979130) PHAGE_Entero_HK629: tail component protein; ECLT68_5470; phage(gi428782030) 9e-121 Click
17complement(4979280..4979945) PHAGE_Entero_HK629: minor tail protein; ECLT68_5471; phage(gi428782029) 4e-114 Click
18complement(4979977..4980306) PHAGE_Entero_HK629: minor tail protein; ECLT68_5472; phage(gi428782028) 3e-52 Click
19complement(4980303..4981031) PHAGE_Entero_HK629: tail length tape measure protein; ECLT68_5473; phage(gi428782027) 2e-120 Click
204981154..4982395 PROPHAGE_Shewan_MR-1: ISSod3, transposase; ECLT68_5474; phage(gi24375070) 7e-51 Click
21complement(4982412..4982657) PHAGE_Entero_HK629: minor tail protein; ECLT68_5475; phage(gi428782022) 3e-37 Click
22complement(4982669..4983022) PHAGE_Entero_HK629: head-tail connector Fii; ECLT68_5476; phage(gi428782021) 9e-64 Click
23complement(4983034..4983432) PHAGE_Entero_HK629: DNA packaging protein Fi; ECLT68_5477; phage(gi428782020) 1e-67 Click
24complement(4983474..4984499) PHAGE_Entero_HK629: major head subunit; ECLT68_5478; phage(gi428782019) 0.0 Click
25complement(4984554..4984886) PHAGE_Entero_HK629: head decoration protein; ECLT68_5479; phage(gi428782018) 2e-57 Click
26complement(4984896..4986215) PHAGE_Entero_HK629: head maturation protease; ECLT68_5480; phage(gi428782016) 0.0 Click
27complement(4986196..4987797) PHAGE_Entero_HK629: portal protein; ECLT68_5481; phage(gi428782015) 0.0 Click
28complement(4987794..4988000) PHAGE_Entero_HK629: head-tail connector; ECLT68_5482; phage(gi428782014) 1e-31 Click
29complement(4987997..4989733) PHAGE_Entero_HK629: terminase large subunit A; ECLT68_5483; phage(gi428782013) 0.0 Click
30complement(4989897..4990442) PHAGE_Entero_HK629: terminase small subunit nu1; ECLT68_5484; phage(gi428782012) 4e-96 Click
31complement(4992619..4992819) PHAGE_Lactoc_bIL312: Csp; ECLT68_5485; phage(gi13095918) 1e-15 Click
324992844..4992993 hypothetical protein; ECLT68_5486 0.0 Click
33complement(4993193..4993615) PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; ECLT68_5487; phage(gi16765210) 4e-44 Click
34complement(4993686..4994219) PHAGE_Entero_mEp460: endolysin; ECLT68_5488; phage(gi428782372) 2e-97 Click
35complement(4994216..4994527) PHAGE_Entero_mEp460: hypothetical protein; ECLT68_5489; phage(gi428782371) 1e-29 Click
36complement(4994532..4994738) PHAGE_Stx2_c_II: holin; ECLT68_5490; phage(gi302393164) 3e-27 Click
37complement(4995500..4995715) PHAGE_Lactoc_bIL312: Csp; ECLT68_5491; phage(gi13095918) 5e-16 Click
384996015..4996227 cold shock-like protein cspI; ECLT68_5492 0.0 Click
39complement(4996462..4996617) hypothetical protein; ECLT68_5493 0.0 Click
40complement(4996649..4997401) PHAGE_Entero_SfV: antitermination protein Q; ECLT68_5494; phage(gi19549033) 1e-137 Click
41complement(4997415..4998368) PHAGE_Entero_SfV: hypothetical protein SfVp45; ECLT68_5495; phage(gi19549032) 1e-104 Click
42complement(4998811..4999059) hypothetical protein; ECLT68_5496 0.0 Click
43complement(4999792..5000031) antitoxin RelB; ECLT68_5497 0.0 Click
445000728..5000880 protein flxA; ECLT68_5498 0.0 Click
45complement(5001330..5002649) integrase core domain protein; ECLT68_5499 0.0 Click
465006241..5006254 attR    TGGTGATTTTAAGG 0.0 Click

Region 25, total : 57 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15145547..5145560 attL    CTGGCGGCGCAGGA 0.0 Click
2complement(5158105..5158569) PHAGE_Bacill_36: baseplate hub protein; ECLT68_5671; phage(gi156564128) 2e-08 Click
3complement(5158647..5159384) PHAGE_Plankt_PaV_LD: ABC transporter; ECLT68_5672; phage(gi371496158) 4e-09 Click
4complement(5159396..5159947) PHAGE_Mollus_1: MC066L; ECLT68_5673; phage(gi19744909) 9e-21 Click
5complement(5160010..5160990) hemin transport system permease protein hmuU; ECLT68_5674 0.0 Click
6complement(5161182..5161496) PHAGE_Liberi_SC2: hypothetical protein; ECLT68_5675; phage(gi423262534) 9e-08 Click
7complement(5161565..5161684) hypothetical protein; ECLT68_5676 0.0 Click
8complement(5161720..5162220) PHAGE_Salmon_SPN3UB: hypothetical protein; ECLT68_5677; phage(gi423262401) 6e-09 Click
9complement(5162223..5163080) PHAGE_Yersin_413C: Int; ECLT68_5678; phage(gi30065733) 4e-69 Click
10complement(5163249..5163401) PHAGE_Yersin_413C: gpC; ECLT68_5679; phage(gi30065734) 7e-08 Click
115163949..5164287 hypothetical protein; ECLT68_5680 0.0 Click
125164298..5164585 hypothetical protein; ECLT68_5681 0.0 Click
135164597..5164839 hypothetical protein; ECLT68_5682 0.0 Click
145164836..5164949 putative membrane protein; ECLT68_5683 0.0 Click
155165036..5165239 hypothetical protein; ECLT68_5684 0.0 Click
165165236..5165481 hypothetical protein; ECLT68_5685 0.0 Click
17complement(5165458..5165598) hypothetical protein; ECLT68_5686 0.0 Click
185165623..5165988 hypothetical protein; ECLT68_5687 0.0 Click
195165995..5168817 PHAGE_Yersin_413C: gpA; ECLT68_5688; phage(gi30065742) 7e-77 Click
205168894..5169853 plasmid segregation protein parM; ECLT68_5689 0.0 Click
215169858..5170166 hypothetical protein; ECLT68_5690 0.0 Click
225170426..5170755 hypothetical protein; ECLT68_5691 0.0 Click
235171485..5171613 hypothetical protein; ECLT68_5692 0.0 Click
24complement(5171680..5172705) PHAGE_Salmon_RE_2010: capsid packaging protein; ECLT68_5693; phage(gi418489696) 7e-91 Click
25complement(5172725..5173555) PHAGE_Yersin_413C: gpP; ECLT68_5694; phage(gi30065706) 5e-62 Click
265173574..5173762 hypothetical protein; ECLT68_5695 0.0 Click
27complement(5173839..5174027) PHAGE_Burkho_phiE202: gp4, phage terminase, ATPase subunit; ECLT68_5696; phage(gi134288784) 7e-06 Click
285174085..5174282 hypothetical protein; ECLT68_5697 0.0 Click
29complement(5174239..5174472) PHAGE_Burkho_KS5: gp42; ECLT68_5698; phage(gi327198040) 3e-15 Click
305174627..5175463 PHAGE_Salmon_RE_2010: capsid scaffolding protein; ECLT68_5699; phage(gi418489698) 3e-45 Click
315175487..5175669 PHAGE_Mannhe_phiMHaA1: major capsid protein N; ECLT68_5700; phage(gi109289940) 4e-07 Click
325175666..5176538 PHAGE_Yersin_413C: gpN; ECLT68_5701; phage(gi30065708) 3e-60 Click
33complement(5176539..5176679) hypothetical protein; ECLT68_5702 0.0 Click
345176653..5177384 PHAGE_Ralsto_phiRSA1: terminase; ECLT68_5703; phage(gi145708083) 1e-34 Click
355177492..5177980 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); ECLT68_5704; phage(gi134288689) 2e-25 Click
365177974..5178162 PHAGE_Salmon_RE_2010: tail component protein; ECLT68_5705; phage(gi418489702) 4e-11 Click
375178170..5178472 hypothetical protein; ECLT68_5706 0.0 Click
385178453..5179001 PHAGE_Mannhe_phiMHaA1: endolysin; ECLT68_5707; phage(gi109289945) 5e-31 Click
395178998..5179471 hypothetical protein; ECLT68_5708 0.0 Click
405179543..5180010 PHAGE_Yersin_413C: gpR; ECLT68_5709; phage(gi30065716) 1e-18 Click
415180003..5180638 PHAGE_Pseudo_phiCTX: predicted tail completion; ECLT68_5710; phage(gi17313233) 4e-20 Click
425180635..5181216 PHAGE_Yersin_413C: gpV; ECLT68_5711; phage(gi30065718) 5e-43 Click
435181234..5181563 PHAGE_Erwini_ENT90: baseplate assembly protein; ECLT68_5712; phage(gi431810974) 9e-21 Click
445181567..5182463 PHAGE_Yersin_413C: gpJ; ECLT68_5713; phage(gi30065720) 1e-84 Click
455182456..5182986 PHAGE_Yersin_413C: gpI; ECLT68_5714; phage(gi30065721) 7e-62 Click
465183093..5183989 PHAGE_Yersin_413C: gpH; ECLT68_5715; phage(gi30065722) 2e-64 Click
475184007..5184429 PHAGE_Entero_mEp237: CII protein; ECLT68_5041; phage(gi435439306) 6e-08 Click
485184307..5184320 attR    CTGGCGGCGCAGGA 0.0 Click
49complement(5184515..5184859) PHAGE_Entero_mEp460: minor tail protein; ECLT68_5716; phage(gi428782324) 2e-31 Click
50complement(5184846..5185217) PHAGE_Entero_HK630: head-tail connector Fii; ECLT68_5717; phage(gi428782797) 3e-28 Click
51complement(5185229..5185630) PHAGE_Entero_HK225: head assembly protein Fi; ECLT68_5718; phage(gi428782384) 1e-16 Click
52complement(5185682..5186073) PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; ECLT68_5719; phage(gi169257230) 2e-62 Click
535186168..5186407 putative transposase; ECLT68_5720 0.0 Click
54complement(5186610..5187326) PROPHAGE_Escher_MG1655: IS186 transposase; ECLT68_5721; phage(gi90111427) 3e-133 Click
555187418..5187621 maturase-related domain protein; ECLT68_5722 0.0 Click
565187782..5187937 maturase-related domain protein; ECLT68_5723 0.0 Click
575188040..5188354 maturase-related domain protein; ECLT68_5724 0.0 Click
58complement(5188448..5188720) PHAGE_Stx2_c_1717: truncated transposase; ECLT68_5725; phage(gi209447151) 3e-07 Click
595189260..5189427 PROPHAGE_Escher_CFT073: putative transposase; ECLT68_5726; phage(gi26246170) 1e-26 Click