Escherichia coli E128010 gecE128010.assembly.100, whole genome [asmbl_id: NC_000000].5221267, GC%: 50.59%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1247041..247054 attL    GTGCTGCCAGAGCT 0.0 Click
2complement(250554..250853) PHAGE_Entero_mEp213: hypothetical protein; ECE128010_0277; phage(gi428782624) 1e-07 Click
3complement(250850..251116) hypothetical protein; ECE128010_0278 0.0 Click
4complement(251113..251316) hypothetical protein; ECE128010_0279 0.0 Click
5complement(251340..251756) hypothetical protein; ECE128010_0280 0.0 Click
6complement(251849..251962) putative membrane protein; ECE128010_0281 0.0 Click
7complement(251959..252201) hypothetical protein; ECE128010_0282 0.0 Click
8complement(252213..252500) hypothetical protein; ECE128010_0283 0.0 Click
9complement(252511..252849) hypothetical protein; ECE128010_0284 0.0 Click
10complement(252864..253142) hypothetical protein; ECE128010_0285 0.0 Click
11253636..254574 PHAGE_Salmon_RE_2010: integrase; ECE128010_0286; phage(gi418489683) 1e-64 Click
12254577..255077 PHAGE_Salmon_SPN3UB: hypothetical protein; ECE128010_0287; phage(gi423262401) 4e-09 Click
13255115..255615 PHAGE_Liberi_SC1: hypothetical protein; ECE128010_0288; phage(gi423262492) 5e-11 Click
14255808..256788 hemin transport system permease protein hmuU; ECE128010_0289 0.0 Click
15256851..257402 PHAGE_Mollus_1: MC066L; ECE128010_0290; phage(gi19744909) 1e-20 Click
16257402..258151 PHAGE_Plankt_PaV_LD: ABC transporter; ECE128010_0291; phage(gi371496158) 6e-09 Click
17258229..258693 PHAGE_Bacill_36: baseplate hub protein; ECE128010_0292; phage(gi156564128) 2e-08 Click
18270270..270283 attR    GTGCTGCCAGAGCT 0.0 Click

Region 2, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11506803..1506817 attL    GCTGGAACACGCGCT 0.0 Click
2complement(1513438..1514547) PHAGE_Entero_PsP3: gp26; ECE128010_1591; phage(gi41057378) 7e-92 Click
3complement(1514594..1514723) hypothetical protein; ECE128010_1592 0.0 Click
41514752..1516938 PHAGE_Entero_PsP3: gp24; ECE128010_1593; phage(gi41057376) 2e-85 Click
51516951..1517439 PHAGE_Entero_PsP3: gp25; ECE128010_1594; phage(gi41057377) 1e-32 Click
61517436..1517559 putative membrane protein; ECE128010_1595 0.0 Click
71517895..1518686 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_1596; phage(gi209447151) 5e-20 Click
81518686..1518934 PHAGE_Stx2_c_1717: transposase; ECE128010_1597; phage(gi209447152) 5e-27 Click
91519054..1520625 PHAGE_Stx2_c_1717: transposase; ECE128010_1598; phage(gi209447153) 2e-170 Click
10complement(1521371..1522552) PHAGE_Gifsy_1: leucine-rich repeat protein; ECE128010_1599; phage(gi169257209) 1e-44 Click
111522932..1523078 PHAGE_Entero_HK630: tail fiber assembly protein; ECE128010_1600; phage(gi428782810) 1e-15 Click
12complement(1523194..1523442) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; ECE128010_1601; phage(gi148609412) 1e-41 Click
13complement(1523504..1524601) PHAGE_Entero_mEp460: integrase; ECE128010_1602; phage(gi428782338) 0.0 Click
141524735..1525727 tRNA-dihydrouridine synthase A; ECE128010_1603 0.0 Click
151525688..1525702 attR    GCTGGAACACGCGCT 0.0 Click
161525861..1526103 phage shock protein G; ECE128010_1604 0.0 Click
17complement(1526269..1527252) hypothetical protein; ECE128010_1605 0.0 Click
181527335..1528750 PHAGE_Entero_P1: Ban; ECE128010_1606; phage(gi46401697) 0.0 Click

Region 3, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1571207..1572082) PHAGE_Plankt_PaV_LD: ABC transporter; ECE128010_1652; phage(gi371496158) 5e-15 Click
2complement(1572209..1573144) D-allose-binding periplasmic protein; ECE128010_1653 0.0 Click
3complement(1573203..1574093) helix-turn-helix domain, rpiR family protein; ECE128010_1654 0.0 Click
41574386..1574863 PROPHAGE_Escher_MG1655: IS1 transposase B; ECE128010_1655; phage(gi16131317) 8e-91 Click
5complement(1574864..1575332) PHAGE_Stx2_c_1717: putative tail fiber protein; ECE128010_1471; phage(gi209447198) 2e-80 Click
6complement(1575397..1576056) PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECE128010_1472; phage(gi209447197) 9e-43 Click
7complement(1576089..1577177) PHAGE_Stx2_c_1717: putative tail fiber component J; ECE128010_1473; phage(gi209447196) 5e-162 Click
81577176..1577357 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_1474; phage(gi209447151) 1e-13 Click
9complement(1577358..1577636) PHAGE_Plankt_PaV_LD: ABC transporter; ECE128010_1657; phage(gi371496158) 2e-05 Click
10complement(1577633..1578478) protein phnJ; ECE128010_1658 0.0 Click
11complement(1578471..1579153) protein phnI domain protein; ECE128010_1659 0.0 Click
12complement(1579154..1579502) PHAGE_Plankt_PaV_LD: ABC transporter; ECE128010_1660; phage(gi371496158) 4e-12 Click

Region 4, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11747969..1747980 attL    GATAAAAAAGGC 0.0 Click
21758924..1759838 PROPHAGE_Escher_CFT073: prophage P4 integrase; ECE128010_1830; phage(gi26251179) 2e-126 Click
3complement(1760444..1761595) PROPHAGE_Escher_MG1655: IS30 transposase; ECE128010_1831; phage(gi16132105) 0.0 Click
41761939..1762151 PHAGE_Entero_Sf6: putative transposase OrfB; ECE128010_1832; phage(gi41057343) 4e-25 Click
51762235..1762270 attL    CGCAGGGTGATGTAACCCGCTGACAACGGGGATTGA 0.0 Click
61762376..1762584 group II intron-encoded reverse transcriptase/maturase domain protein; ECE128010_1833 0.0 Click
71762737..1763153 PHAGE_Entero_Sf6: putative transposase OrfB; ECE128010_1834; phage(gi41057343) 3e-80 Click
8complement(1763281..1765206) high-affinity choline transport protein; ECE128010_1835 0.0 Click
9complement(1765432..1766145) PROPHAGE_Escher_CFT073: transposase insF; ECE128010_1836; phage(gi26249410) 8e-136 Click
10complement(1766752..1767696) lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase; ECE128010_1837 0.0 Click
11complement(1767761..1768711) hypothetical protein; ECE128010_1838 0.0 Click
12complement(1768716..1769228) PHAGE_Rhodot_RM378: putative glycosyltransferases; ECE128010_1839; phage(gi30044003) 8e-05 Click
13complement(1769807..1770598) polysaccharide deacetylase family protein; ECE128010_1840 0.0 Click
141770835..1771137 PHAGE_Entero_Sf6: gene 56 protein; ECE128010_1841; phage(gi41057344) 1e-40 Click
151771211..1771618 PHAGE_Entero_Sf6: putative transposase OrfB; ECE128010_1842; phage(gi41057343) 3e-63 Click
161771702..1771737 attR    CGCAGGGTGATGTAACCCGCTGACAACGGGGATTGA 0.0 Click
17complement(1771736..1772029) PHAGE_Escher_HK75: RusA-like protein; ECE128010_1843; phage(gi356870726) 6e-30 Click
18complement(1772030..1773085) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_1844; phage(gi428782365) 2e-89 Click
191773287..1773418 hypothetical protein; ECE128010_1845 0.0 Click
20complement(1773432..1773692) hypothetical protein; ECE128010_1846 0.0 Click
21complement(1773850..1774857) PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; ECE128010_1847; phage(gi209901309) 2e-21 Click
221775179..1775190 attR    GATAAAAAAGGC 0.0 Click

Region 5, total : 29 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12130178..2130191 attL    AAGAGGCTGATCAG 0.0 Click
2complement(2143593..2144597) PHAGE_Yersin_413C: Int; ECE128010_2195; phage(gi30065733) 1e-96 Click
3complement(2144694..2145047) PHAGE_Yersin_413C: gpC; ECE128010_2196; phage(gi30065734) 2e-16 Click
42145242..2145415 PHAGE_Yersin_413C: Cox; ECE128010_2197; phage(gi30065735) 1e-13 Click
52145422..2145628 putative membrane protein; ECE128010_2198 0.0 Click
62145881..2146222 hypothetical protein; ECE128010_2199 0.0 Click
72146233..2146520 hypothetical protein; ECE128010_2200 0.0 Click
82146532..2146774 hypothetical protein; ECE128010_2201 0.0 Click
92146771..2146884 putative membrane protein; ECE128010_2202 0.0 Click
102146971..2147174 hypothetical protein; ECE128010_2203 0.0 Click
112147171..2147437 hypothetical protein; ECE128010_2204 0.0 Click
122147522..2147706 hypothetical protein; ECE128010_2205 0.0 Click
132148029..2148205 hypothetical protein; ECE128010_2206 0.0 Click
142148278..2148643 hypothetical protein; ECE128010_2207 0.0 Click
152148650..2150359 PHAGE_Yersin_413C: gpA; ECE128010_2208; phage(gi30065742) 3e-52 Click
162150326..2151378 PHAGE_Yersin_413C: gpA; ECE128010_2209; phage(gi30065742) 5e-15 Click
172151532..2152491 plasmid segregation protein parM; ECE128010_2210 0.0 Click
182152496..2152807 hypothetical protein; ECE128010_2211 0.0 Click
19complement(2153393..2153557) hypothetical protein; ECE128010_2212 0.0 Click
202153730..2153858 hypothetical protein; ECE128010_2213 0.0 Click
21complement(2153927..2154532) PHAGE_Salmon_RE_2010: capsid packaging protein; ECE128010_2214; phage(gi418489696) 8e-58 Click
22complement(2154539..2154946) PHAGE_Yersin_413C: gpQ; ECE128010_2215; phage(gi30065705) 1e-26 Click
23complement(2154972..2156096) PHAGE_Ralsto_phiRSA1: terminase; ECE128010_2216; phage(gi145708080) 1e-94 Click
24complement(2156087..2156722) PHAGE_Yersin_413C: gpP; ECE128010_2217; phage(gi30065706) 2e-31 Click
25complement(2156935..2157131) hypothetical protein; ECE128010_2218 0.0 Click
26complement(2157200..2157676) DNA repair protein RadC family protein; ECE128010_2219 0.0 Click
27complement(2157692..2158177) PHAGE_Pseudo_MP1412: antirestriction protein; ECE128010_2220; phage(gi399529006) 2e-13 Click
28complement(2158269..2159087) PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; ECE128010_2221; phage(gi414086954) 2e-45 Click
292159158..2159322 hypothetical protein; ECE128010_2222 0.0 Click
30complement(2159427..2160497) PHAGE_Rhodot_RM378: hypothetical protein Rm378p022; ECE128010_2223; phage(gi30044012) 3e-08 Click
312175108..2175121 attR    AAGAGGCTGATCAG 0.0 Click

Region 6, total : 70 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12246495..2249467 bacteriophage N4 adsorption protein A; ECE128010_2331 0.0 Click
22249468..2250358 hypothetical protein; ECE128010_2332 0.0 Click
32250541..2251302 porin thermoregulatory protein envY; ECE128010_2333 0.0 Click
4complement(2251598..2251789) putative membrane protein; ECE128010_2334 0.0 Click
52251987..2252286 PROPHAGE_Escher_MG1655: IS3 transposase A; ECE128010_2335; phage(gi226524700) 4e-49 Click
62252283..2253149 PROPHAGE_Escher_MG1655: IS3 transposase B; ECE128010_2336; phage(gi16128284) 3e-173 Click
72253448..2253621 PROPHAGE_Escher_CFT073: transposase; ECE128010_2337; phage(gi26248360) 9e-27 Click
82254210..2254800 PHAGE_Entero_P1: Cin; ECE128010_2338; phage(gi46401653) 2e-24 Click
9complement(2254898..2255131) PHAGE_Entero_HK630: tail fiber assembly protein; ECE128010_2339; phage(gi428782810) 2e-35 Click
10complement(2255128..2255472) PHAGE_Entero_HK630: tail fiber assembly protein; ECE128010_2340; phage(gi428782810) 6e-57 Click
11complement(2255472..2257078) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; ECE128010_2341; phage(gi16129506) 5e-100 Click
122257906..2258079 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; ECE128010_2342; phage(gi157166059) 2e-29 Click
13complement(2258080..2258679) PHAGE_Entero_mEp460: Lom protein; ECE128010_2343; phage(gi428782335) 4e-102 Click
14complement(2258747..2262142) PHAGE_Entero_mEp460: host specificity protein; ECE128010_2344; phage(gi428782334) 0.0 Click
15complement(2262203..2262751) PHAGE_Entero_mEp460: tail assembly protein; ECE128010_2345; phage(gi428782333) 1e-98 Click
16complement(2262748..2263491) PHAGE_Entero_mEp460: tail fiber component; ECE128010_2346; phage(gi428782332) 6e-150 Click
17complement(2263496..2264194) PHAGE_Entero_mEp460: minor tail protein; ECE128010_2347; phage(gi428782331) 6e-136 Click
18complement(2264204..2264533) PHAGE_Entero_mEp460: minor tail protein; ECE128010_2348; phage(gi428782330) 2e-61 Click
19complement(2264533..2267598) PHAGE_Entero_mEp460: tail length tape measure protein; ECE128010_2349; phage(gi428782329) 0.0 Click
20complement(2267570..2267899) PHAGE_Entero_mEp460: tail assembly protein; ECE128010_2350; phage(gi428782328) 5e-59 Click
21complement(2267908..2268312) PHAGE_Entero_mEp460: minor tail protein; ECE128010_2351; phage(gi428782327) 3e-65 Click
22complement(2268355..2269098) PHAGE_Entero_mEp460: major tail protein; ECE128010_2352; phage(gi428782326) 3e-138 Click
23complement(2269109..2269510) PHAGE_Entero_mEp460: minor tail protein; ECE128010_2353; phage(gi428782325) 2e-73 Click
24complement(2269507..2270097) PHAGE_Entero_mEp460: minor tail protein; ECE128010_2354; phage(gi428782324) 1e-83 Click
25complement(2270109..2270384) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2355; phage(gi428782323) 2e-46 Click
26complement(2270377..2270700) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2356; phage(gi428782322) 7e-55 Click
27complement(2270787..2272745) PHAGE_Entero_mEp460: putative protease/scaffold protein; ECE128010_2357; phage(gi428782321) 0.0 Click
28complement(2272759..2274267) PHAGE_Entero_mEp460: portal protein; ECE128010_2358; phage(gi428782320) 0.0 Click
29complement(2274267..2274479) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2359; phage(gi428782319) 8e-35 Click
30complement(2274476..2276479) PHAGE_Entero_mEp460: terminase large subunit; ECE128010_2360; phage(gi428782318) 0.0 Click
31complement(2276578..2277072) PHAGE_Entero_mEp460: terminase small subunit; ECE128010_2361; phage(gi428782317) 7e-85 Click
32complement(2277307..2277438) hypothetical protein; ECE128010_2362 0.0 Click
33complement(2277526..2277909) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp60; ECE128010_2363; phage(gi148609442) 4e-67 Click
34complement(2277910..2278377) PHAGE_Entero_cdtI: lysin; ECE128010_2364; phage(gi148609441) 1e-81 Click
35complement(2278374..2278850) PHAGE_Escher_HK75: lysozyme; ECE128010_2365; phage(gi356870730) 2e-85 Click
36complement(2278854..2279189) PHAGE_Entero_SfV: holin; ECE128010_2366; phage(gi19549036) 8e-62 Click
37complement(2279266..2280318) PHAGE_Entero_mEp460: DNA methylase; ECE128010_2367; phage(gi428782369) 0.0 Click
382280401..2280538 hypothetical protein; ECE128010_2368 0.0 Click
39complement(2280949..2281347) hypothetical protein; ECE128010_2369 0.0 Click
40complement(2281642..2281998) PHAGE_Entero_phiP27: putative antitermination protein Q; ECE128010_2370; phage(gi18249885) 3e-34 Click
41complement(2282031..2282948) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2371; phage(gi428782365) 0.0 Click
42complement(2283028..2283837) PHAGE_Entero_mEp460: KilA-N domain protein; ECE128010_2372; phage(gi428782364) 9e-152 Click
43complement(2283857..2284066) PHAGE_Entero_mEp460: holliday junction resolvase; ECE128010_2373; phage(gi428782363) 4e-34 Click
44complement(2284243..2284569) PHAGE_Entero_mEp460: LexA DNA binding domain protein; ECE128010_2374; phage(gi428782362) 6e-54 Click
45complement(2284566..2285219) PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; ECE128010_2375; phage(gi428782361) 4e-126 Click
46complement(2285219..2285470) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2376; phage(gi428782360) 1e-40 Click
47complement(2285710..2286522) PHAGE_Entero_mEp460: replication protein; ECE128010_2377; phage(gi428782359) 5e-155 Click
48complement(2286525..2286749) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2378; phage(gi428782358) 1e-39 Click
49complement(2286746..2287045) PHAGE_Entero_mEp460: regulatory protein Rha; ECE128010_2379; phage(gi428782357) 2e-43 Click
502287243..2287920 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_2380; phage(gi209447151) 4e-20 Click
512287920..2288267 PHAGE_Stx2_c_1717: transposase; ECE128010_2381; phage(gi209447152) 2e-45 Click
522288287..2289048 PHAGE_Stx2_c_1717: transposase; ECE128010_2382; phage(gi209447153) 1e-55 Click
532289239..2289859 PHAGE_Stx2_c_1717: transposase; ECE128010_2383; phage(gi209447153) 3e-76 Click
54complement(2289886..2290617) PHAGE_Entero_mEp460: regulatory protein Rha; ECE128010_2384; phage(gi428782357) 3e-107 Click
55complement(2290614..2291177) PHAGE_Entero_mEp460: hypothetical protein; predicted; phage DNA-binding transcriptional regulator; ECE128010_2385(gi428782356) 9e-101 Click
56complement(2291209..2291409) PHAGE_Entero_cdtI: Repressor; ECE128010_2386; phage(gi148609424) 3e-32 Click
572291581..2292174 PHAGE_Entero_SfV: repressor; ECE128010_2387; phage(gi19549021) 2e-116 Click
582292841..2293203 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2388; phage(gi428782351) 3e-63 Click
592293269..2294093 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2389; phage(gi428782350) 2e-151 Click
602294221..2294757 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2390; phage(gi428782349) 2e-100 Click
612294748..2295626 PHAGE_Entero_lambda: NinC protein; ECE128010_2391; phage(gi9626299) 6e-144 Click
622295623..2295826 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2392; phage(gi428782347) 2e-32 Click
632295885..2296058 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2393; phage(gi428782346) 1e-24 Click
642296055..2296453 PHAGE_Escher_TL_2011c: hypothetical protein; ECE128010_2394; phage(gi418487084) 6e-22 Click
652296455..2296718 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; ECE128010_2395; phage(gi399498823) 3e-23 Click
662296729..2297307 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2396; phage(gi428782343) 9e-70 Click
672297307..2297879 PHAGE_Entero_mEp460: putative exonuclease; ECE128010_2397; phage(gi428782342) 1e-107 Click
682297904..2298188 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2398; phage(gi428782341) 1e-42 Click
69complement(2298215..2298355) hypothetical protein; ECE128010_2399 0.0 Click
70complement(2298666..2299205) PHAGE_Escher_HK639: hypothetical protein; ECE128010_2400; phage(gi356870617) 6e-09 Click

Region 7, total : 62 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12813130..2813141 attL    TTTCTGCGGGTT 0.0 Click
2complement(2814592..2815755) PHAGE_Salmon_epsilon34: Tyrosine integrase; ECE128010_2923; phage(gi221328640) 0.0 Click
3complement(2815982..2816287) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2924; phage(gi428782343) 3e-20 Click
4complement(2816287..2816643) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2925; phage(gi428782348) 5e-66 Click
5complement(2816640..2817176) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2926; phage(gi428782349) 3e-99 Click
6complement(2817304..2817959) PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2927; phage(gi428782350) 9e-119 Click
7complement(2817960..2818076) PHAGE_Entero_mEp460: hypothetical protein; predicted; phage domain protein; ECE128010_2928(gi428782351) 2e-11 Click
82818277..2819044 PHAGE_Entero_HK630: HkaP protein; ECE128010_2929; phage(gi428782827) 7e-13 Click
92819996..2820196 PHAGE_Entero_mEp390: prophage anti-repressor; ECE128010_2930; phage(gi428782702) 2e-07 Click
102820222..2820785 PHAGE_Entero_mEp460: hypothetical protein; predicted; phage DNA-binding transcriptional regulator; ECE128010_2931(gi428782356) 2e-92 Click
112821130..2822071 PHAGE_Entero_phiP27: hypothetical protein P27p17; ECE128010_2932; phage(gi18249881) 2e-41 Click
122822311..2822562 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2933; phage(gi428782360) 9e-40 Click
132822562..2822789 PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; ECE128010_2934; phage(gi428782361) 2e-41 Click
142822790..2823332 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2935; phage(gi428782365) 4e-103 Click
152823350..2823733 PHAGE_Entero_2008: antitermination protein Q; ECE128010_2936; phage(gi209427762) 2e-56 Click
16complement(2823923..2825020) outer membrane porin protein LC; ECE128010_2937 0.0 Click
172825618..2825824 PHAGE_Entero_mEp460: porin; ECE128010_2938; phage(gi428782370) 9e-34 Click
182825824..2826321 PHAGE_Entero_cdtI: lysin; ECE128010_2939; phage(gi148609440) 3e-92 Click
192826318..2826779 PHAGE_Entero_HK630: cell lysis protein Rz; ECE128010_2940; phage(gi428782852) 6e-80 Click
20complement(2826811..2827104) PHAGE_Escher_TL_2011c: Bor protein precursor; ECE128010_2941; phage(gi418487071) 2e-49 Click
212828962..2829276 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_2942; phage(gi428782371) 1e-50 Click
222829332..2829865 PHAGE_Entero_mEp460: endolysin; ECE128010_2943; phage(gi428782372) 2e-99 Click
232830026..2830163 hypothetical protein; ECE128010_2944 0.0 Click
242830165..2830632 PHAGE_Entero_4795: putative endopeptidase Rz; ECE128010_2945; phage(gi157166036) 2e-73 Click
252830715..2830855 hypothetical protein; ECE128010_2946 0.0 Click
26complement(2830981..2831094) hypothetical protein; ECE128010_2947 0.0 Click
27complement(2831493..2831717) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECE128010_2948; phage(gi209427772) 9e-19 Click
28complement(2831733..2831846) hypothetical protein; ECE128010_2949 0.0 Click
292832285..2832629 PHAGE_Entero_N15: gp1; ECE128010_2950; phage(gi9630465) 2e-19 Click
302832631..2834529 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; ECE128010_2951; phage(gi169257235) 0.0 Click
312834513..2834719 PHAGE_Entero_mEp237: head-tail connector; ECE128010_2952; phage(gi435439268) 1e-13 Click
322834716..2836204 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; ECE128010_2953; phage(gi169257233) 0.0 Click
332836205..2836613 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; ECE128010_2954; phage(gi169257232) 3e-29 Click
342836650..2836997 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; ECE128010_2955; phage(gi169257231) 4e-43 Click
352837055..2838083 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; ECE128010_2956; phage(gi169257230) 7e-172 Click
362838135..2838509 PHAGE_Entero_HK225: head assembly protein Fi; ECE128010_2957; phage(gi428782384) 3e-07 Click
372838502..2838855 PHAGE_Entero_HK630: head-tail connector Fii; ECE128010_2958; phage(gi428782797) 1e-43 Click
382838871..2839018 PHAGE_Entero_HK630: minor tail protein Z; ECE128010_2959; phage(gi428782798) 6e-14 Click
392839019..2840810 PHAGE_Entero_HK630: tail length tape measure protein H; ECE128010_2960; phage(gi428782803) 0.0 Click
402840807..2841136 PROPHAGE_Escher_Sakai: putative minor tail protein; ECE128010_2961; phage(gi15832202) 6e-57 Click
412841136..2841834 PHAGE_Stx2_c_1717: phage minor tail protein L; ECE128010_2962; phage(gi209447192) 1e-133 Click
422842029..2842583 PHAGE_Entero_mEp460: tail fiber component; ECE128010_2963; phage(gi428782332) 8e-97 Click
432842622..2843161 PHAGE_Stx2_c_1717: putative tail component; ECE128010_2964; phage(gi209447195) 9e-97 Click
44complement(2843352..2843879) PHAGE_Salmon_1: hypothetical bacteriophage protein; ECE128010_2965; phage(gi169257202) 3e-62 Click
45complement(2846529..2847512) PHAGE_Stx2_c_1717: transposase; ECE128010_2966; phage(gi209447153) 2e-172 Click
46complement(2847673..2848068) PHAGE_Stx2_c_1717: transposase; ECE128010_2967; phage(gi209447153) 4e-51 Click
47complement(2848117..2848464) PHAGE_Stx2_c_1717: transposase; ECE128010_2968; phage(gi209447152) 5e-61 Click
48complement(2848461..2848865) PHAGE_Stx2_c_1717: truncated transposase; ECE128010_2969; phage(gi209447151) 8e-33 Click
492849135..2850985 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECE128010_2970; phage(gi209427766) 0.0 Click
50complement(2851264..2851425) hypothetical protein; ECE128010_2971 0.0 Click
512851433..2851639 PHAGE_Stx2_c_1717: holin protein S-like protein; ECE128010_2972; phage(gi209447171) 3e-33 Click
522851639..2852007 PHAGE_Stx2_c_1717: phage-related lysozyme; ECE128010_2973; phage(gi209447172) 4e-53 Click
532851962..2852135 PHAGE_Salmon_SPN9CC: phage lysozyme; ECE128010_2974; phage(gi389060531) 3e-28 Click
542852132..2852569 PHAGE_Stx2_c_1717: putative Rz lysis protein; ECE128010_2975; phage(gi209447173) 3e-75 Click
552852719..2853336 PHAGE_Entero_P22: Rha; ECE128010_2976; phage(gi9635533) 3e-94 Click
562853690..2853701 attR    TTTCTGCGGGTT 0.0 Click
572853922..2854469 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; ECE128010_2977; phage(gi169257235) 3e-75 Click
582854453..2854659 PHAGE_Entero_mEp237: head-tail connector; ECE128010_2978; phage(gi435439268) 1e-13 Click
592854656..2856248 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; ECE128010_2979; phage(gi169257233) 0.0 Click
602856238..2857300 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; ECE128010_2980; phage(gi169257232) 1e-137 Click
612857301..2858220 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; ECE128010_2981; phage(gi169257230) 3e-158 Click
622858272..2858655 PHAGE_Entero_HK225: head assembly protein Fi; ECE128010_2982; phage(gi428782384) 4e-05 Click
632858648..2859001 PHAGE_Entero_HK630: head-tail connector Fii; ECE128010_2983; phage(gi428782797) 5e-43 Click
642859016..2859296 PHAGE_Entero_HK630: minor tail protein Z; ECE128010_2984; phage(gi428782798) 2e-32 Click

Region 8, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3846149..3847378) PROPHAGE_Entero_Fels-2: integrase-like protein; ECE128010_3967; phage(gi16766052) 2e-120 Click
23847615..3847626 attL    ATTTAAAATACC 0.0 Click
33848064..3848255 PHAGE_Salmon_SSU5: hypothetical protein; ECE128010_3968; phage(gi410491441) 2e-05 Click
43848267..3849034 PHAGE_Salmon_SSU5: hypothetical protein; ECE128010_3969; phage(gi410491442) 6e-27 Click
5complement(3849076..3849939) PHAGE_Cronob_phiES15: putative integrase; ECE128010_3970; phage(gi401817566) 5e-149 Click
6complement(3850427..3850573) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF3; ECE128010_3971; phage(gi157165988) 2e-20 Click
7complement(3850577..3850720) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF4; ECE128010_3972; phage(gi157165989) 9e-16 Click
8complement(3850943..3851200) PHAGE_Salmon_1: hypothetical protein STM0896.2n.Fels1; ECE128010_3973; phage(gi169257162) 6e-25 Click
9complement(3851152..3851511) PHAGE_Shigel_EP23: DNA polymerase III beta subunit; ECE128010_3974; phage(gi371496276) 5e-05 Click
10complement(3851508..3852257) PHAGE_Entero_phiP27: hypothetical protein P27p14; ECE128010_3975; phage(gi18249878) 8e-54 Click
11complement(3852301..3853128) PHAGE_Entero_phiP27: putative serine protease; ECE128010_3976; phage(gi18249869) 1e-153 Click
12complement(3853374..3853766) PHAGE_Salmon_1: hypothetical protein STM0898.1n.Fels1; ECE128010_3977; phage(gi169257164) 1e-38 Click
13complement(3853953..3854117) PHAGE_Entero_phiP27: hypothetical protein P27p07; ECE128010_3978; phage(gi18249871) 5e-06 Click
14complement(3854168..3854374) PHAGE_Salmon_1: hypothetical protein STM0898.3n.Fels1; ECE128010_3979; phage(gi169257166) 3e-15 Click
15complement(3854712..3854903) hypothetical protein; ECE128010_3980 0.0 Click
16complement(3854900..3855091) hypothetical protein; ECE128010_3981 0.0 Click
17complement(3855093..3855491) PHAGE_Entero_phiP27: hypothetical protein P27p10; ECE128010_3982; phage(gi18249874) 9e-27 Click
18complement(3855647..3856339) PHAGE_Entero_ST104: CI; ECE128010_3983; phage(gi46358671) 9e-51 Click
193857782..3858123 tonB family C-terminal domain protein; ECE128010_3984 0.0 Click
20complement(3858256..3858396) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECE128010_3985; phage(gi209427772) 3e-10 Click
213858722..3858733 attR    ATTTAAAATACC 0.0 Click
223858823..3859368 PHAGE_Entero_HK629: terminase small subunit nu1; ECE128010_3986; phage(gi428782012) 4e-98 Click
233859343..3861268 PHAGE_Entero_HK629: terminase large subunit A; ECE128010_3987; phage(gi428782013) 0.0 Click
243861265..3861471 PHAGE_Entero_HK629: head-tail connector; ECE128010_3988; phage(gi428782014) 4e-32 Click
253861468..3863069 PHAGE_Entero_HK629: portal protein; ECE128010_3989; phage(gi428782015) 0.0 Click
263863050..3863319 PHAGE_Entero_HK629: head maturation protease; ECE128010_3990; phage(gi428782016) 2e-44 Click
273863320..3865492 PHAGE_Entero_HK629: tail length tape measure protein; ECE128010_3991; phage(gi428782027) 0.0 Click
283865489..3865818 PHAGE_Entero_HK629: minor tail protein; ECE128010_3992; phage(gi428782028) 3e-60 Click
293865818..3866516 PHAGE_Entero_HK629: minor tail protein; ECE128010_3993; phage(gi428782029) 2e-135 Click
303866522..3867265 PHAGE_Entero_mEp460: tail fiber component; ECE128010_3994; phage(gi428782332) 4e-146 Click
313867311..3867805 PHAGE_Entero_HK629: tail component protein; ECE128010_3995; phage(gi428782031) 3e-63 Click
323867866..3869775 PHAGE_Entero_HK629: tail fiber; ECE128010_3996; phage(gi428782032) 0.0 Click
333869776..3871083 PHAGE_Entero_HK629: tail fiber; ECE128010_3997; phage(gi428782032) 0.0 Click
343871150..3871749 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECE128010_3998; phage(gi148609401) 1e-109 Click
353871814..3872120 PHAGE_Entero_4795: putative tail fiber protein; ECE128010_3999; phage(gi157166060) 6e-54 Click
363872121..3872706 PHAGE_Stx2_c_1717: putative tail fiber protein; ECE128010_4000; phage(gi209447198) 2e-98 Click
373872831..3873041 hypothetical protein; ECE128010_3763 0.0 Click
383873941..3874822 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECE128010_4004; phage(gi148609405) 1e-156 Click
39complement(3874797..3874982) hypothetical protein; ECE128010_4005 0.0 Click
403875046..3875894 PHAGE_Entero_cdtI: truncated nonfunctional Cif; ECE128010_4006; phage(gi148609406) 7e-155 Click
41complement(3877334..3878572) PHAGE_Entero_4795: NleA4795 protein; ECE128010_4007; phage(gi157166068) 0.0 Click

Region 9, total : 47 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14120771..4121820 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_4236; phage(gi428782365) 1e-111 Click
24121833..4122192 PHAGE_Escher_HK75: RusA-like protein; ECE128010_4237; phage(gi356870726) 1e-37 Click
34122201..4122755 PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECE128010_4238; phage(gi399528832) 9e-07 Click
44122893..4123177 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_4239; phage(gi428782368) 2e-08 Click
54123328..4124386 PHAGE_Entero_mEp460: DNA methylase; ECE128010_4240; phage(gi428782369) 1e-175 Click
64124427..4124502 tRNA 0.0 Click
74124510..4124586 tRNA 0.0 Click
84124600..4124676 tRNA 0.0 Click
9complement(4124815..4125007) PROPHAGE_Escher_EDL933: putative transposase; ECE128010_4244; phage(gi15803516) 1e-29 Click
10complement(4125008..4125270) putative transposase; ECE128010_4245 0.0 Click
114125805..4127667 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; ECE128010_4246; phage(gi116221995) 0.0 Click
124127817..4128032 PHAGE_Stx2_c_II: holin; ECE128010_4247; phage(gi302393164) 4e-35 Click
134128037..4128387 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_4248; phage(gi428782371) 2e-38 Click
144128451..4128984 PHAGE_Entero_mEp460: endolysin; ECE128010_4249; phage(gi428782372) 4e-97 Click
154129277..4129408 PHAGE_Escher_P13374: hypothetical protein; ECE128010_4250; phage(gi410491648) 5e-11 Click
164129411..4129527 putative membrane protein; ECE128010_4251 0.0 Click
174129627..4130094 PHAGE_Escher_TL_2011c: hypothetical protein; ECE128010_4252; phage(gi418487099) 4e-73 Click
18complement(4130244..4130492) hypothetical protein; ECE128010_4253 0.0 Click
194130547..4131023 PHAGE_Entero_mEp460: terminase small subunit; ECE128010_4254; phage(gi428782317) 3e-40 Click
20complement(4131568..4132551) PHAGE_Stx2_c_1717: transposase; ECE128010_4255; phage(gi209447153) 2e-172 Click
21complement(4132545..4133105) PHAGE_Stx2_c_1717: transposase; ECE128010_4256; phage(gi209447153) 2e-80 Click
22complement(4133154..4133501) PHAGE_Stx2_c_1717: transposase; ECE128010_4257; phage(gi209447152) 5e-61 Click
23complement(4133498..4133902) PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4258; phage(gi209447151) 8e-33 Click
244133901..4135604 PHAGE_Entero_mEp460: terminase large subunit; ECE128010_4259; phage(gi428782318) 0.0 Click
254135601..4135813 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_4260; phage(gi428782319) 2e-24 Click
264135813..4137315 PHAGE_Entero_mEp460: portal protein; ECE128010_4261; phage(gi428782320) 0.0 Click
274137329..4139284 PHAGE_Entero_mEp460: putative protease/scaffold protein; ECE128010_4262; phage(gi428782321) 0.0 Click
284139372..4139698 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_4263; phage(gi428782322) 5e-22 Click
294139748..4139972 PHAGE_Entero_mEp460: hypothetical protein; ECE128010_4264; phage(gi428782323) 9e-16 Click
304139969..4140598 PROPHAGE_Escher_Sakai: putative minor tail protein; ECE128010_4265; phage(gi15832208) 5e-100 Click
314140611..4141009 PROPHAGE_Escher_Sakai: putative minor tail protein U; ECE128010_4266; phage(gi15832207) 9e-72 Click
324141017..4141763 PHAGE_Entero_HK630: major tail protein V; ECE128010_4267; phage(gi428782800) 6e-107 Click
334141782..4142213 PHAGE_Entero_HK630: minor tail protein G; ECE128010_4268; phage(gi428782801) 1e-45 Click
344142264..4142644 PHAGE_Entero_HK630: tail assembly protein GT; ECE128010_4269; phage(gi428782802) 1e-46 Click
354142634..4145240 PHAGE_Entero_HK630: tail length tape measure protein H; ECE128010_4270; phage(gi428782803) 0.0 Click
364145237..4145566 PHAGE_Entero_HK630: minor tail protein M; ECE128010_4271; phage(gi428782804) 8e-54 Click
374145566..4145958 PHAGE_Entero_mEp460: minor tail protein; ECE128010_4272; phage(gi428782331) 1e-58 Click
384145955..4146263 PHAGE_Entero_mEp460: minor tail protein; ECE128010_4273; phage(gi428782331) 5e-57 Click
394146269..4147012 PHAGE_Entero_mEp460: tail fiber component; ECE128010_4274; phage(gi428782332) 1e-148 Click
404147009..4147551 PHAGE_Entero_mEp460: tail assembly protein; ECE128010_4275; phage(gi428782333) 2e-79 Click
414147625..4147963 hypothetical protein; ECE128010_4276 0.0 Click
424148030..4148529 PHAGE_Entero_mEp460: host specificity protein; ECE128010_4277; phage(gi428782334) 1e-89 Click
434148530..4148796 PHAGE_Entero_cdtI: putative tail tip assembly protein; ECE128010_4278; phage(gi148609400) 8e-38 Click
444148765..4149298 PHAGE_Entero_2008: phage-related tail protein; ECE128010_4279; phage(gi209427791) 4e-58 Click
454149366..4149965 PHAGE_Entero_mEp460: Lom protein; ECE128010_4280; phage(gi428782335) 1e-104 Click
464150117..4150841 PHAGE_Entero_4795: putative tail fiber protein; ECE128010_4281; phage(gi157166060) 6e-120 Click
474150842..4151807 PHAGE_Ectoca_1: EsV-1-65; ECE128010_4282; phage(gi13242537) 4e-16 Click
48complement(4151863..4153008) coA-transferase family III family protein; ECE128010_4283 0.0 Click
49complement(4153082..4154026) membrane transport family protein; ECE128010_4284 0.0 Click
50complement(4154096..4155772) PHAGE_Ostreo_2: putative acetolactate synthase large subunit; ECE128010_4285; phage(gi314055125) 2e-33 Click

Region 10, total : 64 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4366088..4366303) PHAGE_Entero_2: DNA-invertase; ECE128010_4496; phage(gi169936026) 9e-24 Click
2complement(4366288..4366641) PHAGE_Entero_2: DNA-invertase; ECE128010_4497; phage(gi169936026) 7e-48 Click
34366669..4367070 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECE128010_4498; phage(gi431810938) 1e-12 Click
44367187..4367591 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4499; phage(gi209447151) 8e-33 Click
54367588..4367935 PHAGE_Stx2_c_1717: transposase; ECE128010_4500; phage(gi209447152) 5e-61 Click
64367984..4369522 PHAGE_Stx2_c_1717: transposase; ECE128010_4501; phage(gi209447153) 0.0 Click
74369545..4369955 PHAGE_Entero_mEp213: tail fiber assembly protein; ECE128010_4502; phage(gi428782612) 3e-24 Click
8complement(4369927..4370310) PHAGE_Entero_HK106: tail fiber assembly protein; ECE128010_4503; phage(gi428783304) 1e-65 Click
9complement(4370395..4370726) PHAGE_Stx2_c_1717: transposase; ECE128010_4504; phage(gi209447153) 6e-39 Click
10complement(4370727..4371748) PHAGE_Stx2_c_1717: transposase; ECE128010_4505; phage(gi209447153) 1e-92 Click
11complement(4371768..4372115) PHAGE_Stx2_c_1717: transposase; ECE128010_4506; phage(gi209447152) 2e-45 Click
12complement(4372115..4372792) PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4507; phage(gi209447151) 6e-20 Click
13complement(4372842..4373021) PHAGE_Entero_HK106: tail fiber assembly protein; ECE128010_4508; phage(gi428783304) 7e-18 Click
14complement(4373018..4373863) PHAGE_Entero_HK106: side tail fiber protein; ECE128010_4509; phage(gi428783303) 6e-47 Click
15complement(4373863..4374543) PHAGE_Aggreg_S1249: hypothetical protein; ECE128010_4510; phage(gi273809547) 2e-12 Click
16complement(4374540..4375739) PHAGE_Iodoba_phiPLPE: gp61 putative baseplate protein; ECE128010_4511; phage(gi197085675) 5e-44 Click
17complement(4375739..4376092) PHAGE_Vibrio_vB_VchM_138: hypothetical protein; ECE128010_4512; phage(gi422936599) 1e-14 Click
18complement(4376092..4376844) PHAGE_Haemop_Aaphi23: putative baseplate protein; ECE128010_4513; phage(gi31544048) 8e-27 Click
19complement(4376907..4377077) hypothetical protein; ECE128010_4514 0.0 Click
20complement(4377081..4377302) hypothetical protein; ECE128010_4515 0.0 Click
21complement(4377643..4377903) hypothetical protein; ECE128010_4516 0.0 Click
22complement(4377993..4379018) PHAGE_Psychr_pOW20_A: hypothetical protein; ECE128010_4517; phage(gi472339843) 3e-17 Click
23complement(4379060..4379362) hypothetical protein; ECE128010_4518 0.0 Click
24complement(4379362..4379949) PHAGE_Psychr_pOW20_A: hypothetical protein; ECE128010_4519; phage(gi472339841) 2e-09 Click
25complement(4379949..4381937) PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber/lysozyme protein; ECE128010_4520; phage(gi422937553) 1e-23 Click
26complement(4382115..4382567) hypothetical protein; ECE128010_4521 0.0 Click
27complement(4382571..4382993) PHAGE_Entero_WV8: hypothetical protein WV8_gp071; ECE128010_4522; phage(gi238801803) 2e-06 Click
28complement(4383022..4384167) PHAGE_Aggreg_S1249: hypothetical protein; ECE128010_4523; phage(gi273809558) 1e-43 Click
29complement(4384171..4384719) hypothetical protein; ECE128010_4524 0.0 Click
30complement(4384709..4385023) hypothetical protein; ECE128010_4525 0.0 Click
31complement(4385085..4385609) PHAGE_Psychr_pOW20_A: hypothetical protein; ECE128010_4526; phage(gi472339833) 2e-12 Click
32complement(4385636..4386043) PHAGE_Pseudo_KPP12: putative structural protein; ECE128010_4527; phage(gi431811107) 7e-09 Click
33complement(4386009..4386377) hypothetical protein; ECE128010_4528 0.0 Click
34complement(4386418..4387359) PHAGE_Vibrio_CP_T1: putative major capsid protein; ECE128010_4529; phage(gi418489228) 3e-16 Click
35complement(4387371..4387877) hypothetical protein; ECE128010_4530 0.0 Click
36complement(4387881..4389101) PHAGE_Pectob_ZF40: putative head protein; ECE128010_4531; phage(gi422936684) 4e-19 Click
37complement(4389116..4389553) PHAGE_Xantho_vB_XveM_DIBBI: head morphogenesis protein; ECE128010_4532; phage(gi389060406) 6e-14 Click
38complement(4389741..4391207) PHAGE_Vibrio_CP_T1: putative portal protein; ECE128010_4533; phage(gi418489212) 2e-40 Click
39complement(4391207..4392829) PHAGE_Bacter_2: terminase; ECE128010_4534; phage(gi212499721) 2e-29 Click
40complement(4392832..4393404) PHAGE_Pseudo_phi297: terminase small subunit; ECE128010_4535; phage(gi374531284) 1e-48 Click
41complement(4393466..4393990) PHAGE_Entero_HK225: lysis protein Rz; ECE128010_4536; phage(gi428782445) 3e-44 Click
42complement(4393974..4394450) PHAGE_Entero_SfV: lysin; ECE128010_4537; phage(gi19549037) 7e-87 Click
43complement(4394454..4394795) PHAGE_Entero_SfV: holin; ECE128010_4538; phage(gi19549036) 1e-55 Click
444395066..4395182 hypothetical protein; ECE128010_4539 0.0 Click
45complement(4395241..4395405) hypothetical protein; ECE128010_4540 0.0 Click
46complement(4395613..4396035) PHAGE_Bacter_2: Q protein; ECE128010_4541; phage(gi212499710) 3e-23 Click
47complement(4396317..4398245) PHAGE_Bacter_2: predicted P-loop ATPase; ECE128010_4542; phage(gi212499708) 4e-171 Click
484399158..4399469 PHAGE_Vibrio_VP882: putative repressor protein; ECE128010_4543; phage(gi126010900) 2e-09 Click
494400082..4400252 hypothetical protein; ECE128010_4544 0.0 Click
504400249..4401151 PHAGE_Bacter_2: hypothetical protein APSE242; ECE128010_4545; phage(gi212499746) 3e-09 Click
514401154..4402455 PHAGE_Bacter_2: hypothetical protein APSE241; ECE128010_4546; phage(gi212499745) 4e-135 Click
524402471..4402848 PHAGE_Bacter_2: hypothetical protein APSE240; ECE128010_4547; phage(gi212499744) 2e-27 Click
534402924..4403304 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4548; phage(gi209447151) 9e-69 Click
544403301..4403648 PHAGE_Stx2_c_1717: transposase; ECE128010_4549; phage(gi209447152) 2e-62 Click
554403723..4404400 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4550; phage(gi209447151) 4e-20 Click
564404400..4404747 PHAGE_Stx2_c_1717: transposase; ECE128010_4551; phage(gi209447152) 2e-45 Click
574404767..4406338 PHAGE_Stx2_c_1717: transposase; ECE128010_4552; phage(gi209447153) 2e-170 Click
58complement(4406617..4407246) putative membrane protein; ECE128010_4553 0.0 Click
594407293..4409356 PHAGE_Bordet_1: Bbp42; ECE128010_4554; phage(gi41179402) 0.0 Click
604409421..4410182 nucleotide-binding protein containing TIR -like domain-like protein; ECE128010_4555 0.0 Click
614410246..4410380 hypothetical protein; ECE128010_4556 0.0 Click
624410611..4410898 PHAGE_Bacter_2: hypothetical protein APSE235; ECE128010_4557; phage(gi212499740) 1e-28 Click
63complement(4410911..4411708) putative membrane protein; ECE128010_4558 0.0 Click
644411859..4413166 PHAGE_Bacter_2: DEAD box helicase; ECE128010_4559; phage(gi212499736) 0.0 Click

Region 11, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14538483..4538734 prevent-host-death family protein; ECE128010_4707 0.0 Click
24538731..4539018 toxin relE; ECE128010_4708 0.0 Click
3complement(4539149..4539487) PROPHAGE_Escher_CFT073: transposase/IS protein; ECE128010_4709; phage(gi26248359) 3e-45 Click
4complement(4539490..4540143) PROPHAGE_Escher_CFT073: transposase; ECE128010_4710; phage(gi26248360) 5e-130 Click
54540650..4541117 transposase for insertion sequence element IS21 domain protein; ECE128010_4711 0.0 Click
64541130..4541510 PROPHAGE_Escher_CFT073: transposase/IS protein; ECE128010_4712; phage(gi26248359) 2e-08 Click
74541964..4542467 PHAGE_Entero_P1: InsB; ECE128010_4713; phage(gi46401642) 1e-93 Click
84543314..4543613 hypothetical protein; ECE128010_4714 0.0 Click
9complement(4543641..4544507) PROPHAGE_Escher_MG1655: IS3 transposase B; ECE128010_4715; phage(gi16128284) 3e-173 Click
10complement(4544504..4544803) PROPHAGE_Escher_MG1655: IS3 transposase A; ECE128010_4716; phage(gi226524700) 4e-49 Click

Region 12, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14561081..4561476 PROPHAGE_Escher_CFT073: transposase; ECE128010_4734; phage(gi26246249) 2e-31 Click
24561626..4561988 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4735; phage(gi209447151) 1e-10 Click
34561985..4562335 PHAGE_Stx2_c_1717: transposase; ECE128010_4736; phage(gi209447152) 4e-40 Click
4complement(4562390..4562773) PHAGE_Stx2_c_1717: transposase; ECE128010_4737; phage(gi209447153) 1e-45 Click
5complement(4562852..4563199) PHAGE_Stx2_c_1717: transposase; ECE128010_4738; phage(gi209447152) 2e-45 Click
6complement(4563199..4563876) PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4739; phage(gi209447151) 6e-20 Click
74563944..4564090 hypothetical protein; ECE128010_4740 0.0 Click
84564126..4565529 PHAGE_Stx2_c_1717: transposase; ECE128010_4741; phage(gi209447153) 8e-177 Click
94565549..4565806 PROPHAGE_Escher_MG1655: IS3 transposase B; ECE128010_4742; phage(gi16128284) 2e-21 Click
10complement(4565951..4566148) hypothetical protein; ECE128010_4743 0.0 Click
114566226..4566435 PROPHAGE_Escher_CFT073: transposase; ECE128010_4744; phage(gi26248360) 2e-34 Click
12complement(4566482..4566808) aec61 domain protein; ECE128010_4745 0.0 Click
134567029..4567166 putative membrane protein; ECE128010_4746 0.0 Click
14complement(4567414..4567602) hemolysin expression modulating protein; ECE128010_4747 0.0 Click
154568317..4568523 PHAGE_Entero_P4: transcriptional regulator; ECE128010_4748; phage(gi9627517) 5e-05 Click
164568612..4569220 aec62; ECE128010_4749 0.0 Click
174569580..4569984 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4750; phage(gi209447151) 8e-33 Click
184569993..4570174 PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4751; phage(gi209447151) 3e-10 Click
194570171..4570518 PHAGE_Stx2_c_1717: transposase; ECE128010_4752; phage(gi209447152) 3e-60 Click
204570567..4572105 PHAGE_Stx2_c_1717: transposase; ECE128010_4753; phage(gi209447153) 0.0 Click
214572213..4572458 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; ECE128010_4754; phage(gi157166066) 3e-37 Click
22complement(4572475..4572588) hypothetical protein; ECE128010_4755 0.0 Click
234572670..4572882 PROPHAGE_Escher_EDL933: IS629 transposase; ECE128010_4756; phage(gi15802480) 2e-20 Click
244573489..4574997 PHAGE_Vibrio_VHML: ORF37; ECE128010_4757; phage(gi27311204) 4e-10 Click
254575174..4575560 PROPHAGE_Escher_EDL933: transposase for IS629; ECE128010_4758; phage(gi15801145) 1e-64 Click
26complement(4575563..4575757) hypothetical protein; ECE128010_4759 0.0 Click
27complement(4575840..4576149) PHAGE_Stx2_c_1717: transposase; ECE128010_4760; phage(gi209447153) 3e-50 Click

Region 13, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14785029..4785042 attL    TTATAAAAAACATT 0.0 Click
2complement(4785094..4786164) PHAGE_Entero_lambda: integration protein; ECE128010_4976; phage(gi9626273) 0.0 Click
3complement(4786452..4787990) PHAGE_Stx2_c_1717: transposase; ECE128010_4977; phage(gi209447153) 0.0 Click
4complement(4788039..4788386) PHAGE_Stx2_c_1717: transposase; ECE128010_4978; phage(gi209447152) 5e-61 Click
5complement(4788383..4788787) PHAGE_Stx2_c_1717: truncated transposase; ECE128010_4979; phage(gi209447151) 8e-33 Click
64789725..4789874 hypothetical protein; ECE128010_4980 0.0 Click
7complement(4790405..4790620) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECE128010_4981; phage(gi20065893) 5e-35 Click
8complement(4790697..4790810) PHAGE_Entero_lambda: hypothetical protein lambdap38; ECE128010_4982; phage(gi9626278) 9e-13 Click
9complement(4791040..4791720) PHAGE_Stx2_c_1717: exonuclease; ECE128010_4983; phage(gi209447136) 1e-131 Click
10complement(4791717..4792502) PHAGE_Entero_lambda: bet; ECE128010_4984; phage(gi9626281) 7e-151 Click
11complement(4792508..4792804) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; ECE128010_4985; phage(gi116222045) 6e-52 Click
12complement(4792879..4793148) PHAGE_Stx2_c_86: putative host killing protein Kil; ECE128010_4986; phage(gi116222047) 3e-44 Click
13complement(4793228..4793596) PHAGE_Entero_lambda: Putative single-stranded DNA binding protein; ECE128010_4987; phage(gi9626285) 2e-68 Click
14complement(4793785..4794666) hypothetical protein; ECE128010_4988 0.0 Click
15complement(4794663..4794986) PHAGE_Entero_lambda: early gene regulator; ECE128010_4989; phage(gi9626289) 2e-52 Click
16complement(4795159..4795284) hypothetical protein; ECE128010_4990 0.0 Click
174796523..4796690 PHAGE_Entero_HK633: prophage antirepressor; ECE128010_4991; phage(gi428782568) 1e-25 Click
184796966..4797103 PHAGE_Entero_lambda: cII protein; ECE128010_4992; phage(gi9626294) 3e-18 Click
194797136..4797600 PHAGE_Entero_lambda: DNA replication protein; ECE128010_4993; phage(gi9626295) 3e-66 Click
204797597..4797968 PHAGE_Entero_lambda: DNA replication protein; ECE128010_4994; phage(gi9626295) 1e-69 Click
214797965..4798666 PHAGE_Entero_lambda: DNA replication protein; ECE128010_4995; phage(gi9626296) 2e-129 Click
224799027..4799467 PHAGE_Entero_lambda: NinB; ECE128010_4996; phage(gi9626298) 4e-81 Click
234799464..4799991 PHAGE_Entero_mEp213: DNA N-6-adenine-methyltransferase (Dam); ECE128010_4997; phage(gi428782650) 1e-100 Click
244800741..4800941 PHAGE_Entero_lambda: NinG protein; ECE128010_4998; phage(gi9626303) 3e-31 Click
254800938..4801603 PHAGE_Stx2_c_1717: NinI protein; ECE128010_4999; phage(gi209447164) 2e-126 Click
26complement(4801720..4802778) systemic factor protein A; ECE128010_5000 0.0 Click
27complement(4802818..4803030) hypothetical protein; ECE128010_5001 0.0 Click
284803254..4803943 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECE128010_5002; phage(gi169257244) 3e-81 Click
294804603..4804616 attR    TTATAAAAAACATT 0.0 Click

Region 14, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15040572..5040871 PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; ECE128010_5256; phage(gi9630187) 4e-15 Click
2complement(5041177..5041317) PHAGE_Escher_P13374: prophage host toxic membrane protein; ECE128010_5257; phage(gi410491667) 1e-15 Click
3complement(5041929..5042069) hypothetical protein; ECE128010_5258 0.0 Click
4complement(5042687..5043796) PHAGE_Salmon_RE_2010: gene D protein; ECE128010_5259; phage(gi418489726) 2e-97 Click
5complement(5043843..5043974) hypothetical protein; ECE128010_5260 0.0 Click
65043954..5045138 PHAGE_Erwini_ENT90: tail sheath protein; ECE128010_5261; phage(gi431810939) 4e-102 Click
75045138..5045650 PHAGE_Salmon_RE_2010: major tail tube protein; ECE128010_5262; phage(gi418489721) 2e-33 Click
85045705..5046070 PROPHAGE_Salmon_Ty2: putative phage tail protein; ECE128010_5263; phage(gi29143760) 2e-06 Click
95046106..5046234 PHAGE_Burkho_phiE202: gp27, phage tail protein, P2 GpE family; ECE128010_5264; phage(gi134288776) 1e-05 Click
105046221..5049028 PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; ECE128010_5265; phage(gi428782750) 2e-113 Click
115049041..5049529 PHAGE_Salmon_RE_2010: tail protein; ECE128010_5266; phage(gi418489725) 6e-38 Click
12complement(5049556..5050155) PHAGE_Entero_2: DNA-invertase; ECE128010_5267; phage(gi169936026) 1e-80 Click
135050183..5050575 PHAGE_Erwini_ENT90: phage tail collar domain protein; ECE128010_5268; phage(gi431810938) 2e-14 Click
145050597..5051037 PHAGE_Entero_mEp213: tail fiber assembly protein; ECE128010_5269; phage(gi428782612) 3e-26 Click
15complement(5051009..5051611) PHAGE_Entero_HK106: tail fiber assembly protein; ECE128010_5270; phage(gi428783304) 4e-99 Click
16complement(5051611..5053281) PHAGE_Salmon_RE_2010: tail fiber protein; ECE128010_5271; phage(gi418489713) 8e-72 Click
17complement(5053278..5053847) PHAGE_Salmon_RE_2010: tail protein I; ECE128010_5272; phage(gi418489712) 3e-60 Click
18complement(5053879..5054775) PHAGE_Salmon_RE_2010: baseplate assembly protein J; ECE128010_5273; phage(gi418489711) 8e-83 Click
19complement(5054779..5055108) PHAGE_Salmon_RE_2010: baseplate wedge subunit; ECE128010_5274; phage(gi418489710) 8e-20 Click
20complement(5055126..5055692) PHAGE_Salmon_RE_2010: baseplate assembly protein V; ECE128010_5275; phage(gi418489709) 1e-37 Click
21complement(5055943..5056743) PHAGE_Salmon_RE_2010: terminase endonuclease subunit; ECE128010_5276; phage(gi418489700) 2e-33 Click
22complement(5056789..5057841) PHAGE_Erwini_ENT90: major capsid protein; ECE128010_5277; phage(gi431810940) 4e-75 Click
23complement(5057865..5058701) PHAGE_Salmon_RE_2010: capsid scaffolding protein; ECE128010_5278; phage(gi418489698) 5e-46 Click
24complement(5058959..5059120) hypothetical protein; ECE128010_5279 0.0 Click
255059300..5059575 PHAGE_Salmon_RE_2010: terminase ATPase subunit; ECE128010_5280; phage(gi418489697) 2e-20 Click
26complement(5059576..5059767) PHAGE_Salmon_RE_2010: terminase endonuclease subunit; ECE128010_5281; phage(gi418489700) 2e-05 Click
27complement(5059813..5060865) PHAGE_Salmon_RE_2010: major capsid protein; ECE128010_5282; phage(gi418489699) 9e-73 Click
28complement(5060889..5061725) PHAGE_Salmon_RE_2010: capsid scaffolding protein; ECE128010_5283; phage(gi418489698) 9e-46 Click
295061880..5062113 PHAGE_Burkho_KS5: gp42; ECE128010_5284; phage(gi327198040) 2e-15 Click
305062164..5063630 PHAGE_Salmon_RE_2010: terminase ATPase subunit; ECE128010_5285; phage(gi418489697) 2e-111 Click
315063630..5064676 PHAGE_Salmon_RE_2010: capsid packaging protein; ECE128010_5286; phage(gi418489696) 8e-91 Click
32complement(5064745..5064873) hypothetical protein; ECE128010_5287 0.0 Click
335065047..5065211 hypothetical protein; ECE128010_5288 0.0 Click
34complement(5065797..5066108) hypothetical protein; ECE128010_5289 0.0 Click
35complement(5066113..5067072) plasmid segregation protein parM; ECE128010_5290 0.0 Click
36complement(5067149..5068786) PHAGE_Salmon_RE_2010: replication protein; ECE128010_5291; phage(gi418489692) 2e-88 Click

Region 15, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15105246..5105485 PROPHAGE_Escher_MG1655: predicted transposase; ECE128010_5342; phage(gi16131356) 1e-39 Click
25106124..5106282 PHAGE_Entero_P1: TciB; ECE128010_5343; phage(gi46401695) 3e-06 Click
35106581..5107641 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECE128010_5344; phage(gi209427766) 0.0 Click
45107643..5107966 PHAGE_Erwini_ENT90: major tail tube protein; ECE128010_5345; phage(gi431810954) 3e-15 Click
55108021..5108247 phage tail protein E family protein; ECE128010_5346 0.0 Click
6complement(5108258..5108635) hypothetical protein; ECE128010_5347 0.0 Click
7complement(5108725..5108868) hypothetical protein; ECE128010_5348 0.0 Click
8complement(5108878..5109018) hypothetical protein; ECE128010_5349 0.0 Click
9complement(5109173..5109394) hypothetical protein; ECE128010_5350 0.0 Click
10complement(5109529..5109688) protein traC domain protein; ECE128010_5351 0.0 Click
11complement(5109814..5109945) protein traC domain protein; ECE128010_5352 0.0 Click
12complement(5109930..5110110) protein traC domain protein; ECE128010_5353 0.0 Click
13complement(5110111..5110929) PHAGE_Erwini_ENT90: phage tail collar domain protein; ECE128010_5354; phage(gi431810938) 2e-104 Click
14complement(5110926..5111156) PHAGE_Erwini_ENT90: bacteriophage protein; ECE128010_5355; phage(gi431810948) 6e-18 Click
15complement(5111175..5111987) PHAGE_Stx2_c_1717: putative tail fiber component J; ECE128010_5356; phage(gi209447196) 5e-97 Click
16complement(5112104..5112241) PHAGE_Entero_HK630: tail fiber J; ECE128010_5357; phage(gi428782808) 9e-19 Click
175112242..5112559 hypothetical protein; ECE128010_5358 0.0 Click
185112697..5113164 PHAGE_Erwini_ENT90: phage tail completion protein; ECE128010_5359; phage(gi431810962) 2e-17 Click
195113157..5113726 PHAGE_Pseudo_phiCTX: predicted tail completion; ECE128010_5360; phage(gi17313233) 4e-17 Click
20complement(5113919..5114110) PROPHAGE_Escher_MG1655: ecotin, a serine protease inhibitor; ECE128010_5335; phage(gi16130146) 1e-31 Click
215114485..5114737 PROPHAGE_Escher_MG1655: IS1 transposase B; ECE128010_5361; phage(gi16131317) 8e-44 Click
22complement(5114785..5115798) O-antigen acetylase domain protein; ECE128010_5362 0.0 Click
23complement(5115799..5116884) PROPHAGE_Escher_MG1655: IS186 transposase; ECE128010_5363; phage(gi90111427) 0.0 Click

Region 16, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15129243..5129464 PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p11; ECE128010_5384; phage(gi109289947) 6e-09 Click
25129457..5129933 yfhA; ECE128010_5385 0.0 Click
35130013..5130231 yfiB; ECE128010_5386 0.0 Click
45130259..5130606 yfiC; ECE128010_5387 0.0 Click
55131240..5131315 tRNA 0.0 Click
6complement(5131804..5132201) PHAGE_Entero_HK630: tail length tape measure protein H; ECE128010_5389; phage(gi428782803) 1e-62 Click
7complement(5132182..5132571) PHAGE_Entero_HK630: tail assembly protein GT; ECE128010_5390; phage(gi428782802) 3e-42 Click
8complement(5132622..5133002) PHAGE_Entero_HK630: minor tail protein G; ECE128010_5391; phage(gi428782801) 2e-37 Click
9complement(5133003..5133298) PHAGE_Entero_HK630: tail length tape measure protein H; ECE128010_5392; phage(gi428782803) 6e-49 Click
10complement(5133291..5133725) PHAGE_Entero_HK630: tail assembly protein GT; ECE128010_5393; phage(gi428782802) 2e-81 Click
11complement(5133707..5134129) PHAGE_Entero_HK630: minor tail protein G; ECE128010_5394; phage(gi428782801) 5e-76 Click
12complement(5134145..5134864) PHAGE_Entero_HK630: major tail protein V; ECE128010_5395; phage(gi428782800) 4e-134 Click
13complement(5134893..5135288) PHAGE_Entero_HK630: minor tail protein U; ECE128010_5396; phage(gi428782799) 2e-72 Click
14complement(5135285..5135863) PHAGE_Entero_HK630: minor tail protein Z; ECE128010_5397; phage(gi428782798) 1e-101 Click
15complement(5135875..5136228) PHAGE_Entero_HK630: head-tail connector Fii; ECE128010_5398; phage(gi428782797) 3e-63 Click
16complement(5136240..5136638) PHAGE_Entero_HK630: DNA packaging protein Fi; ECE128010_5399; phage(gi428782796) 5e-67 Click
17complement(5136680..5137705) PHAGE_Entero_HK630: major head subunit E; ECE128010_5400; phage(gi428782795) 0.0 Click
18complement(5137761..5138099) PHAGE_Entero_HK630: head decoration protein D; ECE128010_5401; phage(gi428782794) 1e-58 Click
19complement(5138103..5138382) PHAGE_Entero_HK630: capsid assembly protein nu3; ECE128010_5402; phage(gi428782793) 2e-45 Click
20complement(5139745..5139861) PROPHAGE_Escher_MG1655: IS3 transposase B; ECE128010_5403; phage(gi16128284) 1e-16 Click

Region 17, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5143540..5144223) PHAGE_Natria_PhiCh1: adenine methyltransferase; ECE128010_5416; phage(gi22091198) 7e-22 Click
25144331..5144454 hypothetical protein; ECE128010_5417 0.0 Click
35144455..5145429 PHAGE_Burkho_KL1: tail tape measure; ECE128010_5418; phage(gi399528734) 4e-05 Click
45145426..5145676 PHAGE_Amsact_: putative ATP-binding cassette transporter; ECE128010_5419; phage(gi9964444) 9e-05 Click
55146273..5146989 hypothetical protein; ECE128010_5420 0.0 Click
65146990..5147315 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); ECE128010_5421; phage(gi134288689) 4e-17 Click
75147315..5147515 PHAGE_Salmon_RE_2010: tail component protein; ECE128010_5422; phage(gi418489702) 4e-12 Click
85147518..5147841 PHAGE_Aeromo_phiO18P: putative holin; ECE128010_5423; phage(gi148727161) 1e-09 Click
95147838..5148224 PHAGE_Entero_phiP27: putative endolysin; ECE128010_5424; phage(gi18249894) 2e-52 Click
10complement(5148361..5148642) PROPHAGE_Escher_Sakai: putative transposase; ECE128010_5425; phage(gi15834436) 1e-46 Click
115148665..5149549 PHAGE_Entero_If1: hypothetical protein If1p09; ECE128010_5426; phage(gi9630756) 3e-81 Click
125149527..5149871 PHAGE_Entero_If1: hypothetical protein If1p09; ECE128010_5427; phage(gi9630756) 8e-51 Click
135150099..5150347 transglycosylase associated family protein; ECE128010_5428 0.0 Click
14complement(5150406..5150522) hypothetical protein; ECE128010_5429 0.0 Click
15complement(5150614..5151639) PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; ECE128010_5430; phage(gi399529005) 7e-06 Click

Region 18, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5173465..5174382) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; ECE128010_5457; phage(gi116221995) 8e-94 Click
2complement(5174509..5174622) kelch repeat domain protein; ECE128010_5458 0.0 Click
3complement(5174648..5174917) PROPHAGE_Escher_MG1655: IS1 transposase B; ECE128010_5459; phage(gi16131317) 3e-47 Click
45174918..5175139 PHAGE_Escher_TL_2011c: putative tail fiber protein; ECE128010_5460; phage(gi418487108) 8e-39 Click
5complement(5175178..5176749) PHAGE_Stx2_c_1717: transposase; ECE128010_5461; phage(gi209447153) 2e-169 Click
6complement(5176769..5177116) PHAGE_Stx2_c_1717: transposase; ECE128010_5462; phage(gi209447152) 2e-45 Click
7complement(5177116..5177793) PHAGE_Stx2_c_1717: truncated transposase; ECE128010_5463; phage(gi209447151) 2e-19 Click
85177848..5178117 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF76; ECE128010_5464; phage(gi157166061) 1e-46 Click
9complement(5178244..5178672) PHAGE_Grapev_virus: hypothetical protein GFkVgp3; ECE128010_5465; phage(gi18138528) 7e-05 Click
10complement(5179441..5179650) PHAGE_Entero_4795: putative avirulence protein; ECE128010_5466; phage(gi157166069) 4e-27 Click