Escherichia coli MS 153-1 .1, whole genome [asmbl_id: NC_000000].5087744, GC%: 50.48%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
110517..11172 PHAGE_Salmon_SPN3UB: RecE; HMPREF9544_00017; phage(gi423262421) 8e-07 Click
211437..12698 conserved hypothetical protein; HMPREF9544_00018 0.0 Click
3complement(12699..12955) PHAGE_Entero_2008: putative portal protein; HMPREF9544_00019; phage(gi209427777) 6e-31 Click
4complement(12952..14256) PHAGE_Entero_2008: putative portal protein; HMPREF9544_00020; phage(gi209427777) 0.0 Click
5complement(14262..14483) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; HMPREF9544_00021; phage(gi209427801) 8e-36 Click
6complement(14528..16507) PHAGE_Entero_2008: putative major head protein/prohead proteinase; HMPREF9544_00022; phage(gi209427776) 0.0 Click
7complement(16530..18191) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; HMPREF9544_00023; phage(gi209427775) 0.0 Click
8complement(18188..18826) PHAGE_Entero_2008: putative phage terminase; HMPREF9544_00024; phage(gi209427774) 6e-99 Click
9complement(18868..18999) hypothetical protein; HMPREF9544_00025 0.0 Click
10complement(19043..19408) PHAGE_Entero_2008: putative DNAse; HMPREF9544_00026; phage(gi209427773) 5e-56 Click
1119450..19650 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; HMPREF9544_00027; phage(gi209427772) 4e-20 Click
12complement(19849..20073) conserved hypothetical protein; HMPREF9544_00028 0.0 Click
13complement(20070..20564) PHAGE_Escher_TL_2011c: hypothetical protein; HMPREF9544_00029; phage(gi418487099) 4e-73 Click
1420633..20920 conserved hypothetical protein; HMPREF9544_00030 0.0 Click
15complement(20863..21396) PHAGE_Entero_2008: putative endolysin; HMPREF9544_00031; phage(gi209427769) 3e-99 Click
16complement(21460..21871) PHAGE_Entero_2008: hypothetical protein YYZ_gp44; HMPREF9544_00032; phage(gi209427768) 5e-54 Click
1721872..22170 conserved hypothetical protein; HMPREF9544_00033 0.0 Click
1822242..22936 phage replisome organiser; HMPREF9544_00034 0.0 Click
1922937..23158 PHAGE_Entero_mEp460: replication protein; HMPREF9544_00035; phage(gi428782359) 7e-05 Click
2023159..23540 PHAGE_Entero_phiP27: hypothetical protein P27p17; HMPREF9544_00036; phage(gi18249881) 1e-29 Click
2123581..24003 conserved hypothetical protein; HMPREF9544_00037 0.0 Click
2224064..24348 conserved hypothetical protein; HMPREF9544_00038 0.0 Click
2324576..25601 conserved hypothetical protein; HMPREF9544_00039 0.0 Click
2425649..25972 conserved hypothetical protein; HMPREF9544_00040 0.0 Click
25complement(26177..26481) PHAGE_Entero_HK225: late gene regulator Q; HMPREF9544_00041; phage(gi428782441) 8e-28 Click
26complement(26478..26831) PHAGE_Escher_HK75: RusA-like protein; HMPREF9544_00042; phage(gi356870726) 3e-34 Click

Region 2, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
148959..49966 PHAGE_Pseudo_F116: nucleoid-associated protein; HMPREF9544_00082; phage(gi56692913) 3e-55 Click
2complement(50015..50466) outer membrane protein N domain protein; HMPREF9544_00084 0.0 Click
350795..50944 conserved hypothetical protein; HMPREF9544_00085 0.0 Click
451055..51270 PHAGE_Stx2_c_II: holin; HMPREF9544_00086; phage(gi302393164) 1e-28 Click
551270..51767 PHAGE_Entero_cdtI: lysin; HMPREF9544_00087; phage(gi148609440) 2e-91 Click
651764..52225 PHAGE_Entero_HK629: cell lysis protein Rz; HMPREF9544_00088; phage(gi428782076) 5e-81 Click
7complement(52257..52565) PHAGE_Entero_HK629: Bor protein; HMPREF9544_00089; phage(gi428782078) 4e-47 Click
853031..53357 protein, TonB family; HMPREF9544_00090 0.0 Click
9complement(53346..53483) hypothetical protein; HMPREF9544_00091 0.0 Click
10complement(53480..53833) conserved hypothetical protein; HMPREF9544_00092 0.0 Click
1153973..54227 conserved hypothetical protein; HMPREF9544_00093 0.0 Click
1254309..54857 PHAGE_Entero_HK629: terminase small subunit nu1; HMPREF9544_00094; phage(gi428782012) 4e-51 Click
1354829..55877 PHAGE_Entero_HK629: terminase large subunit A; HMPREF9544_00095; phage(gi428782013) 1e-150 Click
1455878..56293 PHAGE_Entero_HK629: terminase large subunit A; HMPREF9544_00096; phage(gi428782013) 2e-52 Click
1556294..56858 PHAGE_Entero_HK629: terminase large subunit A; HMPREF9544_00097; phage(gi428782013) 4e-62 Click
1656870..57511 PHAGE_Entero_HK629: tail length tape measure protein; HMPREF9544_00098; phage(gi428782027) 3e-104 Click
1757508..57837 PHAGE_Entero_HK629: minor tail protein; HMPREF9544_00099; phage(gi428782028) 6e-54 Click
1857837..58381 PHAGE_Entero_HK629: minor tail protein; HMPREF9544_00100; phage(gi428782029) 5e-101 Click
1958382..61273 PHAGE_Entero_2008: phage-related tail protein; HMPREF9544_00101; phage(gi209427791) 0.0 Click
2061332..62233 PHAGE_Entero_mEp460: side tail fiber protein; HMPREF9544_00102; phage(gi428782336) 2e-76 Click

Region 3, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(363979..366054) PHAGE_Synech_Syn19: YadA domain-containing structural protein; HMPREF9544_00425; phage(gi326783569) 5e-13 Click
2complement(366080..366316) conserved hypothetical protein; HMPREF9544_00426 0.0 Click
3complement(366381..367553) conserved hypothetical protein; HMPREF9544_00428 0.0 Click
4367464..367778 conserved domain protein; HMPREF9544_00427 0.0 Click
5368122..368499 conserved hypothetical protein; HMPREF9544_00429 0.0 Click
6368587..368748 conserved hypothetical protein; HMPREF9544_00430 0.0 Click
7368841..369014 PHAGE_Entero_N15: gp3; HMPREF9544_00431; phage(gi9630467) 4e-10 Click
8369011..369186 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; HMPREF9544_00432; phage(gi169257233) 3e-23 Click
9369187..370547 PHAGE_Entero_N15: gp4; HMPREF9544_00433; phage(gi9630468) 1e-168 Click
10370548..370850 PHAGE_Entero_N15: gp4; HMPREF9544_00434; phage(gi9630468) 3e-29 Click
11370840..372345 PHAGE_Entero_N15: gp5; HMPREF9544_00435; phage(gi9630469) 6e-106 Click
12372382..372548 PHAGE_Entero_N15: gp7; HMPREF9544_00436; phage(gi9630471) 1e-08 Click
13372549..372782 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; HMPREF9544_00437; phage(gi169257231) 2e-26 Click
14372783..372943 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; HMPREF9544_00438; phage(gi169257231) 2e-15 Click
15373001..374029 PHAGE_Entero_N15: gp8; HMPREF9544_00439; phage(gi9630472) 2e-110 Click
16374048..374464 PHAGE_Entero_N15: gp9; HMPREF9544_00440; phage(gi9630474) 4e-06 Click
17374457..374810 PHAGE_Entero_N15: gp10; HMPREF9544_00441; phage(gi9630475) 2e-35 Click
18374826..374995 PHAGE_Entero_HK630: minor tail protein Z; HMPREF9544_00442; phage(gi428782798) 1e-17 Click
19374996..375390 PHAGE_Entero_HK630: minor tail protein Z; HMPREF9544_00443; phage(gi428782798) 1e-43 Click
20375387..375782 PHAGE_Entero_N15: gp12; HMPREF9544_00444; phage(gi9630477) 2e-51 Click
21375790..376536 PHAGE_Entero_HK630: major tail protein V; HMPREF9544_00445; phage(gi428782800) 3e-106 Click
22376555..376986 PHAGE_Entero_N15: gp14; HMPREF9544_00446; phage(gi9630473) 8e-24 Click
23377013..377426 PHAGE_Entero_N15: downstream half of translational frameshift product; HMPREF9544_00447; phage(gi9630479) 3e-31 Click
24377407..378182 PHAGE_Entero_N15: gp16; HMPREF9544_00448; phage(gi9630480) 1e-95 Click
25complement(378183..378566) PHAGE_Caulob_CcrColossus: UPF0114 protein; HMPREF9544_00449; phage(gi414088293) 3e-19 Click
26378757..379641 PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; HMPREF9544_00450; phage(gi116326757) 1e-61 Click

Region 4, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1975391..1976904) PHAGE_Salmon_SPN3UB: RecE; HMPREF9544_02119; phage(gi423262421) 6e-95 Click
2complement(1976998..1977243) conserved hypothetical protein; HMPREF9544_02120 0.0 Click
3complement(1977186..1977338) DicB protein; HMPREF9544_02121 0.0 Click
4complement(1977546..1977956) PHAGE_Entero_mEpX2: prophage repressor; HMPREF9544_02122; phage(gi428765656) 2e-07 Click
51978064..1978339 PHAGE_Salmon_SPN3UB: putative Cro; HMPREF9544_02123; phage(gi423262425) 7e-08 Click
61978323..1978625 PHAGE_Pectob_ZF40: putative cII repressor; HMPREF9544_02124; phage(gi422936652) 8e-06 Click
71978626..1978721 hypothetical protein; HMPREF9544_02125 0.0 Click
81978793..1979833 PHAGE_Entero_phiV10: putative primosomal protein; HMPREF9544_02126; phage(gi89152459) 2e-11 Click
91979826..1980287 PHAGE_Entero_phiV10: putative replication protein p; HMPREF9544_02127; phage(gi155370096) 1e-13 Click
101980321..1981091 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; HMPREF9544_02128; phage(gi116222030) 3e-05 Click
111981092..1981499 conserved hypothetical protein; HMPREF9544_02129 0.0 Click
121981526..1981792 PHAGE_Klebsi_phiKO2: Gp58; HMPREF9544_02130; phage(gi46402144) 2e-23 Click
131981789..1982250 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; HMPREF9544_02131; phage(gi89152464) 1e-11 Click
141982228..1982584 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; HMPREF9544_02132; phage(gi20065868) 3e-08 Click
151982824..1982963 conserved hypothetical protein; HMPREF9544_02133 0.0 Click
161982964..1983098 PHAGE_Entero_phiEF24C: hypothetical protein EFP_gp163; HMPREF9544_02134; phage(gi158079459) 9e-05 Click
171983091..1983215 PHAGE_Shigel_AG3: hypothetical protein; HMPREF9544_02135; phage(gi282599330) 2e-07 Click
181983216..1983359 PHAGE_Shigel_AG3: hypothetical protein; HMPREF9544_02136; phage(gi282599330) 3e-13 Click
191983356..1983613 hypothetical protein; HMPREF9544_02137 0.0 Click
20complement(1983749..1984006) hypothetical protein; HMPREF9544_02138 0.0 Click
21complement(1983997..1984173) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip072; HMPREF9544_02139; phage(gi20065867) 6e-09 Click
221984320..1984679 conserved domain protein; HMPREF9544_02140 0.0 Click
23complement(1984782..1985123) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip091; HMPREF9544_02142; phage(gi20065886) 2e-43 Click
241985117..1985380 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; HMPREF9544_02141; phage(gi399498823) 1e-23 Click
251985391..1985558 PHAGE_Salmon_c341: Truncated P22 EaA protein; HMPREF9544_02143; phage(gi255252704) 5e-16 Click
261985555..1985899 PHAGE_Entero_N15: gp45; HMPREF9544_02144; phage(gi9630511) 7e-11 Click
271986165..1986860 L-ribulose-5-phosphate 4-epimerase; HMPREF9544_02145 0.0 Click
281986935..1989286 PHAGE_Microm_12T: DNA polymerase; HMPREF9544_02146; phage(gi472342778) 1e-28 Click
29complement(1989544..1989939) hypothetical protein; HMPREF9544_02147 0.0 Click
301989973..1992357 PHAGE_Bacill_36: RecQ helicase; HMPREF9544_02148; phage(gi156564053) 4e-09 Click

Region 5, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12265878..2265890 attL    CCACTGGCGGTGC 0.0 Click
22278872..2280422 PROPHAGE_Escher_Sakai: putative ATP-dependent protease; HMPREF9544_02455; phage(gi15833954) 0.0 Click
3complement(2280447..2280785) conserved hypothetical protein; HMPREF9544_02456 0.0 Click
42280904..2281743 transcriptional regulator, LysR family; HMPREF9544_02457 0.0 Click
5complement(2281839..2281914) tRNA 0.0 Click
6complement(2281923..2281999) tRNA 0.0 Click
72282073..2282651 gram-negative porin; HMPREF9544_02460 0.0 Click
8complement(2282840..2283223) PHAGE_Entero_2008: antitermination protein Q; HMPREF9544_02461; phage(gi209427762) 2e-56 Click
9complement(2283309..2283446) PHAGE_Entero_mEp237: hypothetical protein; HMPREF9544_02462; phage(gi435439319) 6e-09 Click
10complement(2283446..2283673) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; HMPREF9544_02463; phage(gi435439318) 7e-34 Click
11complement(2284015..2284362) PHAGE_Salmon_ST160: NinX; HMPREF9544_02464; phage(gi318065936) 9e-64 Click
12complement(2284532..2285059) PHAGE_Entero_HK544: putative N-6-adenine-methyltransferase; HMPREF9544_02465; phage(gi428783266) 5e-101 Click
13complement(2285056..2285496) PHAGE_Entero_HK446: NinB protein; HMPREF9544_02466; phage(gi428782241) 3e-82 Click
14complement(2285570..2285860) PHAGE_Entero_933W: Ren protein; HMPREF9544_02467; phage(gi9632496) 1e-48 Click
15complement(2285857..2286558) PHAGE_Entero_4795: putative replication protein P; HMPREF9544_02468; phage(gi157166012) 2e-131 Click
16complement(2286555..2287454) PHAGE_Entero_HK140: DNA replication protein O; HMPREF9544_02469; phage(gi428781991) 1e-174 Click
17complement(2287487..2287783) PHAGE_Stx2_c_1717: CII protein; HMPREF9544_02470; phage(gi209447147) 5e-44 Click
18complement(2287925..2288311) PHAGE_Stx2_c_1717: Cro protein; HMPREF9544_02472; phage(gi209447146) 2e-36 Click
192288216..2288911 PHAGE_Stx2_c_1717: repressor; HMPREF9544_02471; phage(gi209447145) 2e-126 Click
202288951..2289508 conserved hypothetical protein; HMPREF9544_02473 0.0 Click
212289505..2290257 PHAGE_Burkho_2: gp47, conserved hypothetical protein; HMPREF9544_02474; phage(gi134288670) 6e-06 Click
22complement(2290501..2290722) hypothetical protein; HMPREF9544_02476 0.0 Click
232290694..2290966 PHAGE_Stx2_c_1717: N protein; HMPREF9544_02475; phage(gi209447143) 2e-44 Click
24complement(2290983..2291564) PHAGE_Entero_HK140: superinfection exclusion protein; HMPREF9544_02477; phage(gi428781984) 4e-101 Click
252291856..2291978 PHAGE_Entero_HK544: restriction alleviation protein; HMPREF9544_02478; phage(gi428783253) 3e-17 Click
262292161..2292529 PHAGE_Stx2_c_1717: putative single-stranded DNA binding protein; HMPREF9544_02479; phage(gi209447141) 5e-68 Click
272292609..2292878 PHAGE_Stx2_c_1717: Kil protein; HMPREF9544_02480; phage(gi209447139) 1e-44 Click
282292954..2293250 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; HMPREF9544_02481; phage(gi116222045) 8e-52 Click
292293256..2294041 PHAGE_Stx2_c_I: Bet protein; HMPREF9544_02482; phage(gi20065900) 2e-151 Click
302294038..2294718 PHAGE_Stx2_c_1717: exonuclease; HMPREF9544_02483; phage(gi209447136) 2e-131 Click
312294870..2295061 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF10; HMPREF9544_02484; phage(gi157165995) 2e-28 Click
322295138..2295353 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp09; HMPREF9544_02485; phage(gi209447134) 5e-35 Click
332295452..2295673 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp08; HMPREF9544_02486; phage(gi209447133) 9e-37 Click
342295670..2296434 PHAGE_Entero_HK140: hypothetical protein; HMPREF9544_02487; phage(gi428781974) 1e-59 Click
352296424..2296690 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp05; HMPREF9544_02488; phage(gi209447130) 2e-14 Click
362296726..2297241 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp45; HMPREF9544_02489; phage(gi116222037) 1e-20 Click
372297243..2297452 PHAGE_Entero_phiV10: hypothetical protein PhiV10p52; HMPREF9544_02490; phage(gi89152466) 7e-34 Click
382297449..2298189 PHAGE_Entero_P22: EaA; HMPREF9544_02491; phage(gi9635497) 2e-55 Click
392298182..2298466 PHAGE_Entero_ST104: ORF6; HMPREF9544_02492; phage(gi46358654) 7e-47 Click
402298492..2298731 PHAGE_Entero_phiP27: hypothetical protein P27p03; HMPREF9544_02493; phage(gi18249867) 2e-07 Click
412298871..2299107 putative excisionase; HMPREF9544_02494 0.0 Click
422299097..2300239 PHAGE_Entero_mEp235: integrase; HMPREF9544_02495; phage(gi428781836) 2e-61 Click
43complement(2300353..2301603) isocitrate dehydrogenase, NADP-dependent; HMPREF9544_02496 0.0 Click
442301775..2302428 conserved hypothetical protein; HMPREF9544_02497 0.0 Click
452302438..2302899 PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; HMPREF9544_02498; phage(gi34419395) 6e-05 Click
462307794..2307806 attR    CCACTGGCGGTGC 0.0 Click

Region 6, total : 37 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12311133..2312269 PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF9544_02507; phage(gi371496158) 7e-27 Click
22312253..2313116 spermidine/putrescine transport system permease protein PotB; HMPREF9544_02508 0.0 Click
3complement(2313397..2313663) PHAGE_Entero_HK630: tail fiber assembly protein; HMPREF9544_02509; phage(gi428782810) 2e-20 Click
42313752..2313933 hypothetical protein; HMPREF9544_02510 0.0 Click
52314151..2314579 protein, TonB family; HMPREF9544_02511 0.0 Click
62314730..2315125 conserved hypothetical protein; HMPREF9544_02512 0.0 Click
72315377..2315592 PHAGE_Entero_mEp460: porin; HMPREF9544_02513; phage(gi428782370) 3e-34 Click
82315597..2315908 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9544_02514; phage(gi428782371) 4e-28 Click
92315905..2316438 PHAGE_Entero_mEp460: endolysin; HMPREF9544_02515; phage(gi428782372) 3e-97 Click
102316435..2316932 PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; HMPREF9544_02516; phage(gi16765210) 7e-53 Click
112317143..2317274 conserved hypothetical protein; HMPREF9544_02517 0.0 Click
122317293..2317508 PHAGE_Lactoc_bIL312: Csp; HMPREF9544_02518; phage(gi13095918) 1e-15 Click
132317780..2318010 conserved hypothetical protein; HMPREF9544_02519 0.0 Click
142318120..2318356 GnsA/GnsB family protein; HMPREF9544_02520 0.0 Click
152318652..2318858 PHAGE_Entero_HK630: hypothetical protein; HMPREF9544_02521; phage(gi428782856) 1e-24 Click
162319411..2319905 PHAGE_Entero_mEp460: terminase small subunit; HMPREF9544_02522; phage(gi428782317) 7e-85 Click
172319905..2322001 PHAGE_Entero_mEp460: terminase large subunit; HMPREF9544_02523; phage(gi428782318) 0.0 Click
182321992..2322210 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9544_02524; phage(gi428782319) 9e-35 Click
192322210..2323718 PHAGE_Entero_mEp460: portal protein; HMPREF9544_02525; phage(gi428782320) 0.0 Click
202323732..2325693 PHAGE_Entero_mEp460: putative protease/scaffold protein; HMPREF9544_02526; phage(gi428782321) 0.0 Click
212325780..2326103 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9544_02527; phage(gi428782322) 5e-54 Click
222326096..2326371 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9544_02528; phage(gi428782323) 4e-47 Click
232326383..2326961 PHAGE_Entero_mEp460: minor tail protein; HMPREF9544_02529; phage(gi428782324) 3e-104 Click
242326946..2327359 PHAGE_Entero_mEp460: minor tail protein; HMPREF9544_02530; phage(gi428782325) 1e-75 Click
252327370..2328113 PHAGE_Entero_mEp460: major tail protein; HMPREF9544_02531; phage(gi428782326) 3e-137 Click
262328171..2328566 PHAGE_Entero_mEp460: minor tail protein; HMPREF9544_02532; phage(gi428782327) 6e-67 Click
272328575..2328904 PHAGE_Entero_mEp460: tail assembly protein; HMPREF9544_02533; phage(gi428782328) 5e-59 Click
282328876..2331941 PHAGE_Entero_mEp460: tail length tape measure protein; HMPREF9544_02534; phage(gi428782329) 0.0 Click
292331941..2332270 PHAGE_Entero_mEp460: minor tail protein; HMPREF9544_02535; phage(gi428782330) 2e-61 Click
302332280..2332824 PHAGE_Entero_mEp460: minor tail protein; HMPREF9544_02536; phage(gi428782331) 7e-103 Click
312332845..2333138 PHAGE_Halomo_1: hypothetical protein HAPgp19; HMPREF9544_02537; phage(gi167832364) 9e-08 Click
32complement(2333363..2334031) methyltransferase domain protein; HMPREF9544_02538 0.0 Click
33complement(2334032..2334789) transporter, gluconate:H+ symporter family protein; HMPREF9544_02539 0.0 Click
342335007..2335176 conserved domain protein; HMPREF9544_02540 0.0 Click
35complement(2335177..2335335) conserved hypothetical protein; HMPREF9544_02541 0.0 Click
36complement(2335319..2335573) PHAGE_Pectob_ZF40: putative cro anti-repressor; HMPREF9544_02542; phage(gi422936651) 1e-09 Click
372335653..2336291 PHAGE_Pectob_ZF40: putative cI repressor; HMPREF9544_02543; phage(gi422936650) 3e-18 Click

Region 7, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12678667..2679555 PHAGE_Stx2_c_1717: transposase; HMPREF9544_02905; phage(gi209447153) 2e-90 Click
22679557..2679880 PHAGE_Stx2_c_1717: transposase; HMPREF9544_02906; phage(gi209447153) 2e-36 Click
32679877..2680010 PHAGE_Stx2_c_1717: transposase; HMPREF9544_02907; phage(gi209447153) 6e-18 Click
42680011..2680377 PHAGE_Stx2_c_1717: transposase; HMPREF9544_02908; phage(gi209447153) 7e-32 Click
52680378..2680661 conserved domain protein; HMPREF9544_02909 0.0 Click
62680658..2681563 conserved hypothetical protein; HMPREF9544_02910 0.0 Click
72681560..2681799 PHAGE_Rhodot_RM378: hypothetical protein Rm378p022; HMPREF9544_02911; phage(gi30044012) 2e-06 Click
8complement(2681804..2681879) tRNA 0.0 Click
92682206..2683123 PHAGE_Burkho_phi1026b: gp58; HMPREF9544_02913; phage(gi38707948) 3e-08 Click
102683225..2684175 cys regulon transcriptional regulator Cbl; HMPREF9544_02914 0.0 Click
11complement(2684183..2685385) PHAGE_Pseudo_B3: tail length tape measure protein; HMPREF9544_02915; phage(gi56692618) 2e-05 Click

Region 8, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12993934..2993947 attL    GAAGAGAAACCAGA 0.0 Click
23005319..3005912 PHAGE_Entero_HK630: tail component I; HMPREF9544_03251; phage(gi428782807) 2e-105 Click
33005973..3006581 PHAGE_Entero_cdtI: putative tail tip assembly protein; HMPREF9544_03252; phage(gi148609400) 4e-110 Click
43006582..3006852 PHAGE_Entero_mEp460: host specificity protein; HMPREF9544_03253; phage(gi428782334) 4e-46 Click
5complement(3006926..3007255) PROPHAGE_Escher_Sakai: putative minor tail protein; HMPREF9544_03254; phage(gi15832202) 3e-60 Click
6complement(3007252..3007893) PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; HMPREF9544_03255; phage(gi15832203) 9e-111 Click
73007894..3008612 conserved hypothetical protein; HMPREF9544_03256 0.0 Click
83008587..3008814 conserved domain protein; HMPREF9544_03257 0.0 Click
9complement(3008868..3009029) conserved domain protein; HMPREF9544_03259 0.0 Click
103009028..3009453 PHAGE_Pseudo_YuA: hypothetical protein; HMPREF9544_03258; phage(gi162135127) 2e-14 Click
113009472..3009928 conserved hypothetical protein; HMPREF9544_03260 0.0 Click
123009925..3010110 conserved hypothetical protein; HMPREF9544_03261 0.0 Click
133010264..3011292 UDP-N-acetylenolpyruvoylglucosamine reductase; HMPREF9544_03262 0.0 Click
143011289..3012254 biotin-[acetyl-CoA-carboxylase] ligase; HMPREF9544_03263 0.0 Click
15complement(3012283..3013254) pantothenate kinase; HMPREF9544_03265 0.0 Click
163013216..3013410 conserved hypothetical protein; HMPREF9544_03264 0.0 Click
17complement(3013420..3013557) conserved hypothetical protein; HMPREF9544_03266 0.0 Click
183013595..3013670 tRNA 0.0 Click
193013679..3013763 tRNA 0.0 Click
203013880..3013954 tRNA 0.0 Click
213013961..3014036 tRNA 0.0 Click
223014151..3014281 PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p19b; HMPREF9544_03271; phage(gi45862228) 3e-08 Click
233014282..3014803 putative D-serine deaminase transcriptional activator; HMPREF9544_03272 0.0 Click
24complement(3015198..3015767) PHAGE_Achole_L2: integrase; HMPREF9544_03273; phage(gi9626516) 3e-10 Click
253026591..3026604 attR    GAAGAGAAACCAGA 0.0 Click

Region 9, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13380329..3380351 attL    CGGTGTAGTCACTGGTGTAGTCA 0.0 Click
23380389..3381606 PHAGE_Salmon_vB_SosS_Oslo: integrase; HMPREF9544_03655; phage(gi399528791) 3e-57 Click
33381972..3382160 PHAGE_Entero_P4: transcriptional regulator; HMPREF9544_03657; phage(gi9627517) 3e-07 Click
4complement(3382661..3382840) conserved hypothetical protein; HMPREF9544_03659 0.0 Click
53382839..3383240 conserved domain protein; HMPREF9544_03658 0.0 Click
63383237..3383467 PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; HMPREF9544_03660; phage(gi169257169) 2e-07 Click
73383457..3383678 conserved hypothetical protein; HMPREF9544_03661 0.0 Click
83383671..3384036 conserved domain protein; HMPREF9544_03662 0.0 Click
93384029..3384262 conserved hypothetical protein; HMPREF9544_03663 0.0 Click
103384255..3384488 conserved hypothetical protein; HMPREF9544_03664 0.0 Click
113384494..3384793 conserved hypothetical protein; HMPREF9544_03665 0.0 Click
123384790..3386544 PHAGE_Entero_P4: DNA primase; HMPREF9544_03666; phage(gi9627512) 3e-93 Click
133386833..3387111 conserved hypothetical protein; HMPREF9544_03667 0.0 Click
143387108..3387530 PHAGE_Pseudo_F116: single-stranded DNA-binding protein; HMPREF9544_03668; phage(gi56692915) 4e-10 Click
15complement(3387654..3387788) hypothetical protein; HMPREF9544_03669 0.0 Click
163387946..3388152 conserved hypothetical protein; HMPREF9544_03670 0.0 Click
173388152..3389207 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; HMPREF9544_03671; phage(gi169257230) 3e-84 Click
183389220..3389555 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; HMPREF9544_03672; phage(gi169257231) 7e-08 Click
193389568..3389981 conserved hypothetical protein; HMPREF9544_03673 0.0 Click
20complement(3390009..3390191) conserved hypothetical protein; HMPREF9544_03675 0.0 Click
213390144..3390578 conserved hypothetical protein; HMPREF9544_03674 0.0 Click
223390647..3390769 conserved hypothetical protein; HMPREF9544_03676 0.0 Click
233390858..3391139 conserved hypothetical protein; HMPREF9544_03677 0.0 Click
243391447..3391572 hypothetical protein; HMPREF9544_03678 0.0 Click
253391509..3391531 attR    CGGTGTAGTCACTGGTGTAGTCA 0.0 Click
26complement(3391596..3391742) hypothetical protein; HMPREF9544_03679 0.0 Click
273391877..3392047 conserved hypothetical protein; HMPREF9544_03680 0.0 Click
283392154..3392519 PHAGE_Acinet_ZZ1: putative quaternary ammonium compound-resistance protein qacE; HMPREF9544_03681; phage(gi392973036) 1e-06 Click
293392506..3392835 PHAGE_Acinet_ZZ1: putative quaternary ammonium compound-resistance protein qacE; HMPREF9544_03682; phage(gi392973036) 1e-09 Click

Region 10, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13396951..3396963 attL    AATTTCAGCGAAA 0.0 Click
23411730..3412749 PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; HMPREF9544_03702; phage(gi326781942) 2e-18 Click
3complement(3412937..3414232) PHAGE_Entero_4795: putative integrase; HMPREF9544_03703; phage(gi157165986) 1e-154 Click
4complement(3414252..3414503) PHAGE_Entero_4795: putative excisionase; HMPREF9544_03704; phage(gi157165987) 6e-17 Click
53414613..3414737 conserved hypothetical protein; HMPREF9544_03705 0.0 Click
63414787..3415161 YagB/YeeU/YfjZ family protein; HMPREF9544_03706 0.0 Click
73415208..3415585 conserved hypothetical protein; HMPREF9544_03707 0.0 Click
83415749..3416096 conserved hypothetical protein; HMPREF9544_03708 0.0 Click
9complement(3416175..3416429) PROPHAGE_Escher_EDL933: putative transposase; HMPREF9544_03709; phage(gi15803522) 6e-18 Click
10complement(3416477..3417163) PROPHAGE_Escher_CFT073: putative transposase; HMPREF9544_03710; phage(gi26246170) 3e-135 Click
11complement(3417311..3417496) PHAGE_Stx2_c_1717: transposase; HMPREF9544_03711; phage(gi209447153) 2e-22 Click
12complement(3417620..3417895) PHAGE_Entero_4795: putative transposase OrfA protein of IS629; HMPREF9544_03712; phage(gi157166066) 1e-46 Click
133417908..3418075 hypothetical protein; HMPREF9544_03713 0.0 Click
143418080..3418298 conserved hypothetical protein; HMPREF9544_03714 0.0 Click
153418306..3419598 aminotransferase, class I/II; HMPREF9544_03715 0.0 Click
163419654..3421042 Na+/H+ antiporter NhaC; HMPREF9544_03716 0.0 Click
173421650..3422762 PHAGE_Entero_mEp460: host specificity protein; HMPREF9544_03717; phage(gi428782334) 0.0 Click
183422832..3423092 PHAGE_Entero_4795: outer membrane protein Lom precursor; HMPREF9544_03718; phage(gi157166058) 3e-41 Click
193423124..3423454 PHAGE_Entero_4795: outer membrane protein Lom precursor; HMPREF9544_03719; phage(gi157166058) 5e-59 Click
20complement(3424030..3424779) PHAGE_Celeri_P12053L: putative phage tail fiber protein; HMPREF9544_03720; phage(gi399528893) 4e-13 Click
213424898..3426496 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; HMPREF9544_03721; phage(gi16129506) 2e-130 Click
223426496..3427071 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; HMPREF9544_03722; phage(gi16129505) 5e-108 Click
23complement(3427169..3427759) PHAGE_Escher_D108: G region invertase; HMPREF9544_03723; phage(gi281199698) 7e-25 Click
24complement(3428076..3428342) conserved hypothetical protein; HMPREF9544_03724 0.0 Click
253429095..3430378 PHAGE_Burkho_phi1026b: gp59; HMPREF9544_03725; phage(gi38707949) 1e-33 Click
263430467..3431927 PHAGE_Microm_MpV1: hypothetical protein; HMPREF9544_03726; phage(gi313768442) 1e-41 Click
273445461..3445473 attR    AATTTCAGCGAAA 0.0 Click

Region 11, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13686770..3686900 PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p19b; HMPREF9544_03992; phage(gi45862228) 3e-08 Click
23686901..3687306 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9544_03993; phage(gi428782371) 7e-38 Click
3complement(3687272..3687550) conserved hypothetical protein; HMPREF9544_03994 0.0 Click
43687650..3688183 PHAGE_Entero_mEp460: endolysin; HMPREF9544_03995; phage(gi428782372) 2e-100 Click
53688180..3688647 PHAGE_Entero_mEp460: Rz lysis protein; HMPREF9544_03996; phage(gi428782373) 6e-72 Click
63688635..3688787 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9544_03997; phage(gi428782374) 3e-22 Click
73688954..3689514 PHAGE_Escher_HK639: rha protein; HMPREF9544_03998; phage(gi356870673) 8e-97 Click
8complement(3689817..3690242) PHAGE_Entero_HK629: putative envelope protein; HMPREF9544_03999; phage(gi428782079) 9e-60 Click
9complement(3690285..3690518) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; HMPREF9544_04000; phage(gi209427772) 7e-21 Click
10complement(3690742..3690924) conserved hypothetical protein; HMPREF9544_04002 0.0 Click
113690913..3691422 PHAGE_Entero_N15: gp1; HMPREF9544_04001; phage(gi9630465) 4e-19 Click
123691394..3692576 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; HMPREF9544_04003; phage(gi169257235) 0.0 Click
133693375..3693506 hypothetical protein; HMPREF9544_04004 0.0 Click
143693750..3694316 conserved hypothetical protein; HMPREF9544_04005 0.0 Click
153694563..3695123 conserved hypothetical protein; HMPREF9544_04006 0.0 Click
163695117..3695425 PHAGE_Erwini_phiEt88: probable excisionase HkaC; HMPREF9544_04007; phage(gi327198591) 5e-06 Click

Region 12, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13779168..3779179 attL    TTGTTTTTATCC 0.0 Click
2complement(3792685..3793107) PROPHAGE_Ralsto_GMI1000: isrso11-transposase orfb protein; HMPREF9544_04110; phage(gi17546155) 6e-25 Click
3complement(3793180..3793719) PHAGE_Entero_Sf6: putative transposase OrfB; HMPREF9544_04111; phage(gi41057343) 4e-05 Click
4complement(3793756..3794217) conserved hypothetical protein; HMPREF9544_04112 0.0 Click
5complement(3794633..3795088) conserved hypothetical protein; HMPREF9544_04113 0.0 Click
6complement(3795100..3795918) PROPHAGE_Escher_CFT073: transposase insF; HMPREF9544_04114; phage(gi26249410) 5e-159 Click
7complement(3796003..3797154) PROPHAGE_Escher_MG1655: IS30 transposase; HMPREF9544_04115; phage(gi16132105) 0.0 Click
8complement(3797111..3797479) PHAGE_Entero_Sf6: gene 56 protein; HMPREF9544_04116; phage(gi41057344) 4e-07 Click
9complement(3797531..3797732) hypothetical protein; HMPREF9544_04117 0.0 Click
10complement(3797745..3799844) PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; HMPREF9544_04118; phage(gi414087138) 9e-05 Click
11complement(3799819..3801618) PROPHAGE_Shigel_301: serine protease; HMPREF9544_04119; phage(gi24114232) 6e-135 Click
123816077..3816088 attR    TTGTTTTTATCC 0.0 Click

Region 13, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3811975..3812289) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; HMPREF9544_04129; phage(gi24111655) 9e-58 Click
2complement(3812399..3812734) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; HMPREF9544_04130; phage(gi209447168) 3e-46 Click
3complement(3812860..3813009) conserved hypothetical protein; HMPREF9544_04132 0.0 Click
43812995..3813183 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; HMPREF9544_04131; phage(gi209427766) 2e-28 Click
53813180..3813341 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; HMPREF9544_04133; phage(gi116221995) 2e-16 Click
63813527..3814032 PHAGE_Synech_S_SSM5: YadA domain-containing structural protein; HMPREF9544_04134; phage(gi326784342) 7e-06 Click
7complement(3814033..3814885) D-serine ammonia-lyase; HMPREF9544_04135 0.0 Click
8complement(3814965..3815231) PROPHAGE_Escher_CFT073: transposase; HMPREF9544_04136; phage(gi26248346) 1e-37 Click
9complement(3815225..3815344) hypothetical protein; HMPREF9544_04137 0.0 Click
10complement(3817146..3817307) conserved hypothetical protein; HMPREF9544_04138 0.0 Click
113817374..3821489 PROPHAGE_Escher_CFT073: Pic serine protease precursor; HMPREF9544_04139; phage(gi26246250) 0.0 Click
123821730..3822014 adhesin biosynthesis transcription regulatory protein; HMPREF9544_04140 0.0 Click
13complement(3822247..3822378) hypothetical protein; HMPREF9544_04141 0.0 Click
14complement(3822498..3823622) PROPHAGE_Escher_CFT073: transposase; HMPREF9544_04142; phage(gi26246249) 0.0 Click
15complement(3823767..3824009) conserved hypothetical protein; HMPREF9544_04143 0.0 Click
16complement(3824045..3824284) conserved domain protein; HMPREF9544_04144 0.0 Click
17complement(3824281..3824472) hypothetical protein; HMPREF9544_04145 0.0 Click
18complement(3824509..3824886) Tat pathway signal sequence; HMPREF9544_04146 0.0 Click
19complement(3824962..3825420) conserved hypothetical protein; HMPREF9544_04147 0.0 Click
20complement(3825407..3826342) conserved domain protein; HMPREF9544_04148 0.0 Click
21complement(3826343..3826588) hypothetical protein; HMPREF9544_04149 0.0 Click
22complement(3826589..3827124) hypothetical protein; HMPREF9544_04150 0.0 Click
233827125..3828017 PHAGE_Entero_HK629: major head subunit; HMPREF9544_04151; phage(gi428782019) 6e-104 Click
243828036..3828443 PHAGE_Entero_HK225: head assembly protein Fi; HMPREF9544_04152; phage(gi428782384) 1e-07 Click
253828436..3828789 PHAGE_Entero_HK629: head-tail connector Fii; HMPREF9544_04153; phage(gi428782021) 9e-40 Click
263828801..3828970 PHAGE_Entero_HK629: minor tail protein; HMPREF9544_04154; phage(gi428782022) 6e-22 Click
273828971..3829410 PHAGE_Entero_HK629: minor tail protein; HMPREF9544_04155; phage(gi428782022) 7e-77 Click
283829407..3829802 PHAGE_Entero_HK629: minor tail protein; HMPREF9544_04156; phage(gi428782023) 2e-70 Click
293829792..3830550 PHAGE_Entero_HK629: major tail protein; HMPREF9544_04157; phage(gi428782024) 1e-136 Click
303830566..3830988 PHAGE_Entero_HK629: minor tail protein; HMPREF9544_04158; phage(gi428782025) 1e-69 Click
313831015..3831404 PHAGE_Entero_HK629: tail assembly protein; HMPREF9544_04159; phage(gi428782026) 5e-70 Click
323831397..3832172 PHAGE_Entero_HK629: tail length tape measure protein; HMPREF9544_04160; phage(gi428782027) 9e-138 Click
33complement(3832341..3832709) YagB/YeeU/YfjZ family protein; HMPREF9544_04161 0.0 Click
34complement(3832789..3833010) conserved hypothetical protein; HMPREF9544_04162 0.0 Click
35complement(3833097..3833315) DNA repair protein RadC domain protein; HMPREF9544_04163 0.0 Click
363833512..3834195 PHAGE_Natria_PhiCh1: adenine methyltransferase; HMPREF9544_04164; phage(gi22091198) 9e-22 Click

Region 14, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14362857..4362871 attL    GCTTATTTATCATTT 0.0 Click
2complement(4365355..4366095) site-specific recombinase, phage integrase family; HMPREF9544_04743 0.0 Click
3complement(4366106..4366234) conserved hypothetical protein; HMPREF9544_04744 0.0 Click
4complement(4366216..4366404) conserved hypothetical protein; HMPREF9544_04745 0.0 Click
54366771..4367940 conserved hypothetical protein; HMPREF9544_04746 0.0 Click
6complement(4368787..4369059) adhesin biosynthesis transcription regulatory protein; HMPREF9544_04747 0.0 Click
7complement(4369506..4369631) hypothetical protein; HMPREF9544_04748 0.0 Click
8complement(4369655..4369936) PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; HMPREF9544_04749; phage(gi17546153) 1e-35 Click
94369938..4370111 conserved hypothetical protein; HMPREF9544_04750 0.0 Click
104370150..4370296 conserved domain protein; HMPREF9544_04751 0.0 Click
11complement(4370349..4370471) conserved hypothetical protein; HMPREF9544_04752 0.0 Click
12complement(4370762..4371107) PHAGE_Entero_2008: putative tail assembly protein; HMPREF9544_04753; phage(gi209427790) 1e-56 Click
13complement(4371108..4371436) PHAGE_Entero_2008: putative tail assembly protein; HMPREF9544_04754; phage(gi209427790) 2e-56 Click
14complement(4371433..4372040) PHAGE_Entero_2008: putative tail component K-like protein; HMPREF9544_04755; phage(gi209427789) 1e-115 Click
15complement(4372041..4372246) PHAGE_Entero_2008: putative tail component K-like protein; HMPREF9544_04756; phage(gi209427789) 8e-36 Click
16complement(4372247..4372611) PHAGE_Entero_2008: putative tail component K-like protein; HMPREF9544_04757; phage(gi209427789) 5e-62 Click
17complement(4372617..4373114) PHAGE_Entero_2008: putative tail protein; HMPREF9544_04758; phage(gi209427787) 2e-89 Click
18complement(4373246..4373412) PHAGE_Entero_2008: putative tail protein; HMPREF9544_04759; phage(gi209427787) 4e-26 Click
19complement(4373412..4373753) PHAGE_Entero_2008: putative minor tail protein; HMPREF9544_04760; phage(gi209427786) 4e-62 Click
20complement(4373746..4376988) PHAGE_Entero_2008: putative tail protein; HMPREF9544_04761; phage(gi209427785) 0.0 Click
21complement(4377036..4377317) PHAGE_Entero_2008: hypothetical protein YYZ_gp61; HMPREF9544_04762; phage(gi209427784) 1e-46 Click
22complement(4377341..4377715) PHAGE_Entero_2008: putative tail assembly protein; HMPREF9544_04763; phage(gi209427783) 4e-67 Click
23complement(4377733..4378446) PHAGE_Entero_2008: putative tail protein; HMPREF9544_04764; phage(gi209427782) 3e-130 Click
24complement(4378512..4378856) PHAGE_Entero_2008: putative prophage structural protein; HMPREF9544_04765; phage(gi209427781) 6e-60 Click
25complement(4378853..4379299) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; HMPREF9544_04766; phage(gi209427780) 8e-79 Click
26complement(4379296..4379661) PHAGE_Entero_2008: putative head-tail adaptor; HMPREF9544_04767; phage(gi209427779) 2e-61 Click
27complement(4379658..4379984) PHAGE_Entero_2008: hypothetical protein YYZ_gp55; HMPREF9544_04768; phage(gi209427778) 9e-56 Click
28complement(4379981..4380650) PHAGE_Entero_2008: putative portal protein; HMPREF9544_04769; phage(gi209427777) 5e-121 Click
294380651..4381734 PHAGE_Escher_bV_EcoS_AKFV33: putative tail fiber protein; HMPREF9544_04770; phage(gi388570497) 5e-35 Click
304381731..4382009 PHAGE_Escher_bV_EcoS_AKFV33: hypothetical protein; HMPREF9544_04771; phage(gi388570496) 8e-06 Click
314382022..4382315 PHAGE_Halomo_1: hypothetical protein HAPgp19; HMPREF9544_04772; phage(gi167832364) 2e-07 Click
32complement(4382407..4383264) ABC 3 transport family protein; HMPREF9544_04773 0.0 Click
33complement(4383261..4384118) ABC 3 transport family protein; HMPREF9544_04774 0.0 Click
34complement(4384115..4384942) PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF9544_04775; phage(gi371496158) 9e-14 Click
354394343..4394357 attR    GCTTATTTATCATTT 0.0 Click