Escherichia coli MS 117-3 .1, whole genome [asmbl_id: NC_000000].5013840, GC%: 50.53%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 47 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(245439..245975) PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; HMPREF9542_00255; phage(gi397912660) 1e-07 Click
2246028..247242 benzoate transporter; HMPREF9542_00256 0.0 Click
3complement(247276..247536) PROPHAGE_Escher_Sakai: putative transposase; HMPREF9542_00257; phage(gi38704244) 4e-43 Click
4247537..247900 conserved domain protein; HMPREF9542_00258 0.0 Click
5247990..248966 PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; HMPREF9542_00259; phage(gi169257204) 4e-05 Click
6248967..249637 PHAGE_Entero_mEp460: side tail fiber protein; HMPREF9542_00260; phage(gi428782336) 5e-108 Click
7249037..249052 attL    ACGGCACAGGAAAACC 0.0 Click
8complement(249638..249824) PHAGE_Entero_mEp460: Lom protein; HMPREF9542_00261; phage(gi428782335) 2e-27 Click
9complement(249891..250250) PHAGE_Entero_2008: phage-related tail protein; HMPREF9542_00262; phage(gi209427791) 4e-64 Click
10250251..250514 PHAGE_Entero_mEp460: terminase small subunit; HMPREF9542_00263; phage(gi428782317) 1e-43 Click
11250532..250876 PHAGE_Entero_mEp460: terminase large subunit; HMPREF9542_00264; phage(gi428782318) 6e-62 Click
12250878..253603 YD repeat-containing domain protein; HMPREF9542_00265 0.0 Click
13253711..254219 PROPHAGE_Escher_Sakai: putative transposase; HMPREF9542_00266; phage(gi38704244) 6e-95 Click
14complement(255322..255498) conserved domain protein; HMPREF9542_00267 0.0 Click
15255830..256039 hypothetical protein; HMPREF9542_00268 0.0 Click
16complement(256111..256773) putative exclusion-determining protein; HMPREF9542_00269 0.0 Click
17complement(256844..257076) hypothetical protein; HMPREF9542_00270 0.0 Click
18complement(257077..257558) transglycosylase SLT domain protein; HMPREF9542_00271 0.0 Click
19complement(257561..257737) hypothetical protein; HMPREF9542_00272 0.0 Click
20complement(257914..258147) lipofamily protein; HMPREF9542_00273 0.0 Click
21complement(258152..258418) hypothetical protein; HMPREF9542_00274 0.0 Click
22complement(258495..259096) conserved domain protein; HMPREF9542_00275 0.0 Click
23complement(259097..259633) PHAGE_Entero_mEp460: minor tail protein; HMPREF9542_00276; phage(gi428782324) 6e-97 Click
24complement(259645..259920) PHAGE_Entero_mEp460: hypothetical protein; HMPREF9542_00277; phage(gi428782323) 4e-47 Click
25complement(259913..260236) PHAGE_Entero_mEp460: hypothetical protein; HMPREF9542_00278; phage(gi428782322) 1e-54 Click
26complement(260323..262281) PHAGE_Entero_mEp460: putative protease/scaffold protein; HMPREF9542_00279; phage(gi428782321) 0.0 Click
27complement(262295..263810) PHAGE_Entero_mEp460: portal protein; HMPREF9542_00280; phage(gi428782320) 0.0 Click
28263811..264119 hypothetical protein; HMPREF9542_00281 0.0 Click
29264274..264492 conserved domain protein; HMPREF9542_00282 0.0 Click
30264569..264706 hypothetical protein; HMPREF9542_00283 0.0 Click
31264799..265047 PHAGE_Entero_mEp234: HicA protein; HMPREF9542_00284; phage(gi428782292) 1e-09 Click
32265044..265391 PHAGE_Entero_mEp234: HicB protein; HMPREF9542_00285; phage(gi428782291) 2e-21 Click
33complement(265405..265530) hypothetical protein; HMPREF9542_00286 0.0 Click
34complement(265542..265673) hypothetical protein; HMPREF9542_00287 0.0 Click
35complement(265762..266019) conserved domain protein; HMPREF9542_00288 0.0 Click
36266065..266214 hypothetical protein; HMPREF9542_00289 0.0 Click
37complement(266199..267116) PHAGE_Stx2_c_1717: transposase; HMPREF9542_00290; phage(gi209447153) 3e-172 Click
38complement(267190..270156) PROPHAGE_Xantho_33913: Tn5041 transposase; HMPREF9542_00291; phage(gi21231545) 2e-32 Click
39complement(270137..270760) PHAGE_Escher_D108: G region invertase; HMPREF9542_00292; phage(gi281199698) 5e-43 Click
40complement(270918..271445) hypothetical protein; HMPREF9542_00293 0.0 Click
41271534..272175 PHAGE_Salisa_1: hypothetical protein; HMPREF9542_00294; phage(gi388570712) 1e-27 Click
42272353..272913 PHAGE_Deerpo_83: hypothetical protein DpV83gp038; HMPREF9542_00295; phage(gi62637416) 8e-06 Click
43complement(272951..273565) hypothetical protein; HMPREF9542_00296 0.0 Click
44273734..274501 hypothetical protein; HMPREF9542_00297 0.0 Click
45complement(274669..278745) PHAGE_Prochl_Syn1: virion structural protein; HMPREF9542_00298; phage(gi326784191) 2e-05 Click
46278941..279129 PROPHAGE_Xantho_33913: ISxac3 transposase; HMPREF9542_00299; phage(gi21231087) 2e-13 Click
47complement(279099..279434) conserved domain protein; HMPREF9542_00300 0.0 Click
48279489..280103 PROPHAGE_Escher_CFT073: transposase insF; HMPREF9542_00301; phage(gi26250329) 7e-115 Click
49289226..289241 attR    ACGGCACAGGAAAACC 0.0 Click

Region 2, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1660845..660856 attL    GGAGAAAAACAT 0.0 Click
2complement(666812..667834) PHAGE_Ostreo_OlV5: 6-phosphofructokinase; HMPREF9542_00736; phage(gi472341206) 5e-16 Click
3complement(667955..668857) ferrous iron efflux protein F; HMPREF9542_00737 0.0 Click
4complement(668872..668994) hypothetical protein; HMPREF9542_00738 0.0 Click
5669145..669552 PHAGE_Burkho_KS14: gp9; HMPREF9542_00739; phage(gi327198278) 1e-07 Click
6complement(669603..669857) PHAGE_Yersin_413C: Ogr; HMPREF9542_00740; phage(gi30065732) 2e-45 Click
7complement(669903..671066) PHAGE_Yersin_413C: gpD; HMPREF9542_00741; phage(gi30065731) 0.0 Click
8complement(671066..671545) PHAGE_Yersin_413C: gpU; HMPREF9542_00742; phage(gi30065730) 4e-86 Click
9complement(671560..674007) PHAGE_Yersin_413C: gpT; HMPREF9542_00743; phage(gi30065729) 0.0 Click
10complement(674000..674155) PHAGE_Yersin_413C: gpE+E'; HMPREF9542_00744; phage(gi30065728) 1e-23 Click
11complement(674152..674427) PHAGE_Yersin_413C: gpE; HMPREF9542_00745; phage(gi30065727) 3e-44 Click
12complement(674480..674966) PHAGE_Yersin_413C: FII; HMPREF9542_00746; phage(gi30065726) 5e-87 Click
13complement(674979..676169) PHAGE_Yersin_413C: gpFI; HMPREF9542_00747; phage(gi30065725) 0.0 Click
14complement(676229..676822) PHAGE_Entero_2: DNA-invertase; HMPREF9542_00748; phage(gi169936026) 3e-88 Click
15677220..677708 PHAGE_Entero_mEp213: tail fiber assembly protein; HMPREF9542_00749; phage(gi428782612) 6e-25 Click
16complement(677680..678282) PHAGE_Entero_HK106: tail fiber assembly protein; HMPREF9542_00750; phage(gi428783304) 4e-99 Click
17complement(678282..679544) PHAGE_Salmon_RE_2010: tail fiber protein; HMPREF9542_00751; phage(gi418489713) 3e-109 Click
18complement(679541..680152) PHAGE_Yersin_413C: gpI; HMPREF9542_00752; phage(gi30065721) 3e-82 Click
19complement(680145..681053) PHAGE_Yersin_413C: gpJ; HMPREF9542_00753; phage(gi30065720) 3e-166 Click
20complement(681058..681405) PHAGE_Yersin_413C: gpW; HMPREF9542_00754; phage(gi30065719) 1e-60 Click
21complement(681402..682037) PHAGE_Yersin_413C: gpV; HMPREF9542_00755; phage(gi30065718) 1e-117 Click
22complement(682104..682556) PHAGE_Yersin_413C: gpS; HMPREF9542_00756; phage(gi30065717) 2e-79 Click
23complement(682549..683016) PHAGE_Yersin_413C: gpR; HMPREF9542_00757; phage(gi30065716) 4e-84 Click
24complement(682979..683137) PHAGE_Erwini_ENT90: putative host lysis-related protein; HMPREF9542_00758; phage(gi431810968) 2e-10 Click
25complement(683124..683537) PHAGE_Yersin_413C: LysB; HMPREF9542_00759; phage(gi30065715) 4e-71 Click
26complement(683537..683962) PHAGE_Yersin_413C: LysA; HMPREF9542_00760; phage(gi30065714) 3e-67 Click
27complement(683977..684474) PHAGE_Yersin_413C: gpK; HMPREF9542_00761; phage(gi30065713) 8e-94 Click
28complement(684474..684755) PHAGE_Yersin_413C: gpY; HMPREF9542_00762; phage(gi30065712) 3e-46 Click
29complement(684759..684962) PHAGE_Yersin_413C: gpX; HMPREF9542_00763; phage(gi30065711) 4e-32 Click
30complement(684962..685471) PHAGE_Yersin_413C: gpL; HMPREF9542_00764; phage(gi30065710) 3e-92 Click
31complement(685571..686290) PHAGE_Yersin_413C: gpM; HMPREF9542_00765; phage(gi30065709) 3e-130 Click
32complement(686318..687391) PHAGE_Yersin_413C: gpN; HMPREF9542_00766; phage(gi30065708) 0.0 Click
33complement(687450..688304) PHAGE_Yersin_413C: gpO; HMPREF9542_00767; phage(gi30065707) 3e-159 Click
34688478..690250 PHAGE_Yersin_413C: gpP; HMPREF9542_00768; phage(gi30065706) 0.0 Click
35690250..691284 PHAGE_Yersin_413C: gpQ; HMPREF9542_00769; phage(gi30065705) 0.0 Click
36complement(691323..691484) hypothetical protein; HMPREF9542_00770 0.0 Click
37691497..691661 hypothetical protein; HMPREF9542_00771 0.0 Click
38complement(691803..692006) PHAGE_Entero_PsP3: gp37; HMPREF9542_00772; phage(gi41057391) 1e-21 Click
39complement(692006..692461) PHAGE_Yersin_413C: hypothetical protein L-413Cp39; HMPREF9542_00773; phage(gi30065743) 3e-77 Click
40complement(692458..694749) PHAGE_Yersin_413C: gpA; HMPREF9542_00774; phage(gi30065742) 0.0 Click
41complement(694746..695753) PHAGE_Stenot_S1: putative PAPS; HMPREF9542_00775; phage(gi213163929) 1e-67 Click
42complement(695750..696253) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; HMPREF9542_00776; phage(gi30065741) 3e-31 Click
43complement(696253..696555) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; HMPREF9542_00777; phage(gi30065739) 3e-44 Click
44complement(696555..696779) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; HMPREF9542_00778; phage(gi30065738) 1e-33 Click
45complement(696843..697349) PHAGE_Yersin_413C: gpB; HMPREF9542_00779; phage(gi30065737) 8e-92 Click
46complement(697340..697537) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; HMPREF9542_00780; phage(gi30065736) 1e-26 Click
47complement(697513..697785) PHAGE_Yersin_413C: Cox; HMPREF9542_00781; phage(gi30065735) 2e-42 Click
48697876..698214 PHAGE_Yersin_413C: gpC; HMPREF9542_00782; phage(gi30065734) 4e-33 Click
49698254..699264 PHAGE_Yersin_413C: Int; HMPREF9542_00783; phage(gi30065733) 0.0 Click
50complement(699478..699981) periplasmic repressor CpxP; HMPREF9542_00784 0.0 Click
51700128..700826 PHAGE_Feldma_virus: putative sensor histidine kinase; HMPREF9542_00785; phage(gi197322366) 4e-09 Click
52700823..702196 PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; HMPREF9542_00786; phage(gi197322490) 1e-08 Click
53complement(702302..703006) MOSC domain protein; HMPREF9542_00787 0.0 Click
54complement(703125..704114) PHAGE_Strept_Sfi11: putative minor tail protein; HMPREF9542_00788; phage(gi9635024) 2e-06 Click
55711174..711185 attR    GGAGAAAAACAT 0.0 Click

Region 3, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(744363..744995) PHAGE_Bacill_BCP78: putative dihydrofolate reductase; HMPREF9542_00836; phage(gi410492794) 2e-14 Click
2744927..744938 attL    GGCGTAACGCGC 0.0 Click
3744994..746007 PHAGE_Salmon_RE_2010: integrase; HMPREF9542_00835; phage(gi418489683) 2e-08 Click
4746108..746560 transposon Tn21 modulator family protein; HMPREF9542_00837 0.0 Click
5746686..747246 PHAGE_Ralsto_RSM3: hypothetical protein RSM3_gp14; HMPREF9542_00838; phage(gi209901327) 5e-25 Click
6747249..747800 hypothetical protein; HMPREF9542_00839 0.0 Click
7complement(747805..747899) PHAGE_Escher_P13374: lysis protein, holin; HMPREF9542_00840; phage(gi410491645) 2e-06 Click
8complement(747966..749018) PHAGE_Entero_cdtI: putative DNA methylase; HMPREF9542_00841; phage(gi148609438) 0.0 Click
9complement(749169..749396) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp55; HMPREF9542_00842; phage(gi148609437) 1e-37 Click
10complement(749601..750572) amino acid or sugar ABC transport system, permease protein; HMPREF9542_00843 0.0 Click
11complement(750565..752049) PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF9542_00844; phage(gi371496158) 1e-13 Click
12759189..759200 attR    GGCGTAACGCGC 0.0 Click

Region 4, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1793561..793573 attL    CACCTGTAACCAT 0.0 Click
2complement(808253..808405) PHAGE_Entero_P4: hypothetical protein P4p05; HMPREF9542_00901; phage(gi19263411) 8e-20 Click
3complement(808414..808560) PHAGE_Entero_P4: hypothetical protein P4p05; HMPREF9542_00902; phage(gi19263411) 7e-08 Click
4complement(808669..811002) PHAGE_Entero_P4: DNA primase; HMPREF9542_00903; phage(gi9627512) 0.0 Click
5complement(811017..811337) PHAGE_Entero_P4: hypothetical protein P4p07; HMPREF9542_00904; phage(gi9627513) 6e-57 Click
6complement(811473..811928) PHAGE_Entero_P4: hypothetical protein P4p08; HMPREF9542_00905; phage(gi9627514) 4e-89 Click
7complement(811921..812208) PHAGE_Entero_P4: helper derepression protein; HMPREF9542_00906; phage(gi9627515) 4e-50 Click
8complement(812201..812800) PHAGE_Entero_P4: putative CI repressor; HMPREF9542_00907; phage(gi9627516) 8e-63 Click
9complement(812797..813015) PHAGE_Entero_P4: transcriptional regulator; HMPREF9542_00908; phage(gi9627517) 3e-37 Click
10complement(813076..813267) hypothetical protein; HMPREF9542_00909 0.0 Click
11complement(813395..813541) hypothetical protein; HMPREF9542_00910 0.0 Click
12813615..814349 PHAGE_Entero_P4: head size determination protein sid; HMPREF9542_00911; phage(gi9627518) 2e-134 Click
13814346..814846 PHAGE_Entero_P4: transactivation protein; HMPREF9542_00912; phage(gi9627519) 6e-92 Click
14814920..815492 PHAGE_Entero_P4: amber mutation-suppressing protein; HMPREF9542_00913; phage(gi9627520) 3e-102 Click
15815602..815742 conserved domain protein; HMPREF9542_00914 0.0 Click
16complement(815758..816498) hypothetical protein; HMPREF9542_00915 0.0 Click
17complement(816495..818123) hypothetical protein; HMPREF9542_00916 0.0 Click
18817879..817891 attR    CACCTGTAACCAT 0.0 Click
19complement(818116..819300) PROPHAGE_Escher_CFT073: putative prophage integrase; HMPREF9542_00917; phage(gi26250313) 2e-144 Click

Region 5, total : 60 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11246832..1246878 attL    ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT 0.0 Click
2complement(1246892..1248052) PHAGE_Entero_HK542: integrase; HMPREF9542_01363; phage(gi428783369) 0.0 Click
3complement(1248365..1248736) PHAGE_Entero_HK022: hypothetical protein HK022p30; HMPREF9542_01364; phage(gi19343379) 4e-67 Click
4complement(1248736..1248903) PHAGE_Entero_HK630: hypothetical protein; HMPREF9542_01365; phage(gi428782816) 5e-29 Click
5complement(1249062..1249340) PHAGE_Entero_HK106: hypothetical protein; HMPREF9542_01366; phage(gi428783310) 1e-48 Click
6complement(1249340..1249912) PHAGE_Entero_ST104: ORF8; HMPREF9542_01367; phage(gi46358656) 9e-48 Click
7complement(1249914..1250213) PHAGE_Entero_Sf6: gene 22 protein; HMPREF9542_01368; phage(gi41057300) 5e-58 Click
8complement(1250210..1250737) PHAGE_Entero_mEpX2: hypothetical protein; HMPREF9542_01369; phage(gi428765641) 2e-48 Click
9complement(1250734..1250916) PHAGE_Entero_Sf6: gene 23 protein; HMPREF9542_01370; phage(gi41057301) 1e-24 Click
10complement(1250909..1251202) PHAGE_Entero_HK633: Abc2 protein; HMPREF9542_01371; phage(gi428782555) 3e-52 Click
11complement(1251705..1252178) PHAGE_Entero_Sf6: gene 27 protein; HMPREF9542_01372; phage(gi41057305) 1e-87 Click
12complement(1252179..1252886) PHAGE_Entero_Sf6: gene 28 protein; HMPREF9542_01373; phage(gi41057306) 5e-139 Click
13complement(1252986..1253159) PHAGE_Entero_Sf6: gene 30 protein; HMPREF9542_01374; phage(gi41057308) 2e-25 Click
14complement(1253141..1253293) PHAGE_Entero_Sf6: gene 31 protein; HMPREF9542_01375; phage(gi41057309) 4e-23 Click
15complement(1253278..1253412) PHAGE_Entero_mEpX2: CIII protein; HMPREF9542_01376; phage(gi428765650) 3e-18 Click
16complement(1253639..1253890) PHAGE_Entero_mEp234: hypothetical protein; HMPREF9542_01377; phage(gi428782288) 2e-44 Click
17complement(1253899..1254225) PHAGE_Entero_HK633: anti-termination protein N; HMPREF9542_01378; phage(gi428782565) 1e-56 Click
18complement(1254687..1255091) PHAGE_Entero_Sf6: gene 38 protein; HMPREF9542_01379; phage(gi41057316) 7e-72 Click
19complement(1255088..1255720) PHAGE_Entero_HK446: prophage repressor; HMPREF9542_01380; phage(gi428782233) 2e-119 Click
201255824..1256039 PHAGE_Entero_Sf6: gene 40 protein; HMPREF9542_01381; phage(gi41057317) 3e-34 Click
211256159..1256437 PHAGE_Entero_Sf6: gene 41 protein; HMPREF9542_01382; phage(gi41057318) 6e-46 Click
221256472..1256618 PHAGE_Entero_mEp235: hypothetical protein; HMPREF9542_01383; phage(gi428781853) 4e-22 Click
231256611..1257471 PHAGE_Entero_c_1: DNA replication protein O; HMPREF9542_01384; phage(gi428781786) 1e-164 Click
241257579..1259459 PHAGE_Entero_c_1: hypothetical protein; HMPREF9542_01385; phage(gi428781787) 0.0 Click
251259537..1259977 PHAGE_Entero_HK446: NinB protein; HMPREF9542_01386; phage(gi428782241) 3e-81 Click
261259974..1260846 PHAGE_Entero_lambda: NinC protein; HMPREF9542_01387; phage(gi9626299) 6e-176 Click
271261162..1261332 PHAGE_Escher_HK75: NinF; HMPREF9542_01388; phage(gi356870723) 9e-27 Click
281261325..1262047 PHAGE_Entero_HK140: DNA-binding protein; HMPREF9542_01389; phage(gi428781998) 6e-133 Click
291262047..1262337 PHAGE_Entero_mEpX2: hypothetical protein; HMPREF9542_01390; phage(gi428765668) 1e-53 Click
301262334..1262696 PHAGE_Entero_mEpX2: endodeoxyribonuclease RusA; HMPREF9542_01391; phage(gi428765669) 8e-65 Click
311262693..1262881 PHAGE_Entero_mEpX2: NinH protein; HMPREF9542_01392; phage(gi428765670) 2e-29 Click
321262878..1263501 PHAGE_Entero_mEpX1: late gene regulator Q; HMPREF9542_01393; phage(gi428781929) 7e-118 Click
331263825..1264346 PHAGE_Deep_s_D6E: HNH endonuclease; HMPREF9542_01394; phage(gi423262342) 5e-30 Click
341264574..1264897 PHAGE_Entero_mEp213: holin protein; HMPREF9542_01395; phage(gi428782657) 1e-55 Click
351264881..1265357 PHAGE_Escher_HK75: lysozyme; HMPREF9542_01396; phage(gi356870730) 2e-88 Click
361265354..1265791 PHAGE_Entero_Sf6: gene 63 protein; HMPREF9542_01397; phage(gi41057336) 9e-74 Click
371265788..1265931 PHAGE_Entero_Sf6: gene 65 protein; HMPREF9542_01398; phage(gi41057338) 2e-20 Click
381266171..1266551 PHAGE_Entero_Sf6: hypothetical protein Sf6p66; HMPREF9542_01399; phage(gi41057339) 1e-67 Click
391266655..1266897 PHAGE_Entero_Sf6: hypothetical protein Sf6p67; HMPREF9542_01400; phage(gi41057340) 6e-39 Click
401266900..1267340 PHAGE_Riemer_RAP44: hypothetical protein; HMPREF9542_01401; phage(gi418489899) 2e-29 Click
411267337..1268752 PHAGE_Entero_Sf6: gene 2 protein; HMPREF9542_01402; phage(gi41057280) 0.0 Click
421268754..1270952 PHAGE_Entero_Sf6: gene 3 protein; HMPREF9542_01403; phage(gi41057281) 0.0 Click
431271043..1271936 PHAGE_Entero_Sf6: gene 4 protein; HMPREF9542_01404; phage(gi41057282) 1e-28 Click
441271955..1273208 PHAGE_Entero_P22: coat protein; HMPREF9542_01405; phage(gi9635538) 2e-34 Click
451273262..1273438 hypothetical protein; HMPREF9542_01406 0.0 Click
461273419..1273880 PHAGE_Entero_Sf6: gene 7 protein; HMPREF9542_01407; phage(gi41057285) 3e-27 Click
471273890..1275308 PHAGE_Entero_Sf6: gene 8 protein; HMPREF9542_01408; phage(gi41057286) 0.0 Click
481275308..1276009 PHAGE_Entero_IME10: DNA stabilization protein; HMPREF9542_01409; phage(gi422934286) 2e-124 Click
491276009..1276464 PHAGE_Entero_Sf6: head assembly protein; HMPREF9542_01410; phage(gi41057288) 2e-86 Click
501276467..1277159 PHAGE_Entero_Sf6: gene 11 protein; HMPREF9542_01411; phage(gi41057289) 1e-116 Click
511277169..1278635 PHAGE_Entero_Sf6: gene 12 protein; HMPREF9542_01412; phage(gi41057290) 6e-121 Click
521278632..1280464 PHAGE_Entero_P22: injection protein; HMPREF9542_01413; phage(gi51236731) 9e-179 Click
53complement(1280486..1281124) PHAGE_Entero_P22: SieA; HMPREF9542_01414; phage(gi9635547) 6e-16 Click
54complement(1281175..1281474) PHAGE_Salmon_SPN3UB: Arc-like DNA binding domain protein; HMPREF9542_01415; phage(gi423262396) 9e-13 Click
551281532..1281723 PHAGE_Salmon_vB_SosS_Oslo: Arc-like DNA binding domain protein; HMPREF9542_01416; phage(gi399528776) 2e-20 Click
561281713..1282435 PHAGE_Salmon_SPN3UB: hypothetical protein; HMPREF9542_01417; phage(gi423262398) 3e-121 Click
571282524..1283252 PHAGE_Entero_P1: Ant2; HMPREF9542_01418; phage(gi46401670) 2e-27 Click
58complement(1283279..1283566) PHAGE_Salmon_ST160: Mnt; HMPREF9542_01419; phage(gi318065963) 3e-16 Click
591283669..1285759 PHAGE_Entero_Sf6: gene 14 protein; HMPREF9542_01420; phage(gi41057292) 1e-55 Click
60complement(1285800..1286969) PHAGE_Acidia_virus: hypothetical protein ATV_gp34; HMPREF9542_01421; phage(gi75750403) 2e-07 Click
611287070..1287456 PHAGE_Entero_N15: UmuD; HMPREF9542_01422; phage(gi9630490) 1e-56 Click
621287667..1287713 attR    ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT 0.0 Click

Region 6, total : 52 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11698228..1699247 PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; HMPREF9542_01865; phage(gi326781942) 5e-18 Click
21699384..1699395 attL    AATTTATGGATT 0.0 Click
3complement(1699435..1700730) PHAGE_Entero_2008: putative integrase; HMPREF9542_01866; phage(gi209427727) 5e-157 Click
4complement(1700750..1701001) PHAGE_Gifsy_2: bacteriophage excisionase; HMPREF9542_01867; phage(gi169257269) 2e-17 Click
5complement(1701074..1703545) PHAGE_Entero_mEp460: putative exonuclease; HMPREF9542_01868; phage(gi428782342) 4e-58 Click
6complement(1703639..1703884) hypothetical protein; HMPREF9542_01869 0.0 Click
7complement(1703827..1704015) DicB protein; HMPREF9542_01870 0.0 Click
81704056..1704214 conserved domain protein; HMPREF9542_01871 0.0 Click
91704416..1704568 conserved domain protein; HMPREF9542_01872 0.0 Click
10complement(1704555..1704770) hypothetical protein; HMPREF9542_01873 0.0 Click
11complement(1704800..1704970) hypothetical protein; HMPREF9542_01874 0.0 Click
12complement(1704930..1705166) PHAGE_Salico_CGphi29: hypothetical protein; HMPREF9542_01875; phage(gi472340166) 8e-09 Click
13complement(1705351..1705770) PHAGE_Entero_c_1: prophage repressor; HMPREF9542_01876; phage(gi428781782) 6e-27 Click
141705871..1706152 PHAGE_Entero_c_1: prophage antirepressor; HMPREF9542_01877; phage(gi428781783) 2e-25 Click
151706136..1706561 PHAGE_Pectob_ZF40: putative cII repressor; HMPREF9542_01878; phage(gi422936652) 3e-06 Click
161706633..1707703 PHAGE_Entero_mEp460: replication protein; HMPREF9542_01879; phage(gi428782359) 1e-27 Click
171707744..1708166 hypothetical protein; HMPREF9542_01880 0.0 Click
181708501..1710504 transporter, betaine/carnitine/choline transporter family protein; HMPREF9542_01881 0.0 Click
191710568..1711845 hypothetical protein; HMPREF9542_01882 0.0 Click
20complement(1711976..1712857) PHAGE_Burkho_phi1026b: gp58; HMPREF9542_01883; phage(gi38707948) 2e-05 Click
21complement(1712854..1713546) ChaC-like protein; HMPREF9542_01884 0.0 Click
22complement(1713558..1714757) transporter, major facilitator family protein; HMPREF9542_01885 0.0 Click
231715421..1715633 PHAGE_Stx2_c_II: putative host killer protein; HMPREF9542_01886; phage(gi302393105) 3e-27 Click
241715700..1716107 PHAGE_Cronob_phiES15: hypothetical protein; HMPREF9542_01887; phage(gi401817580) 2e-13 Click
251716181..1717158 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9542_01888; phage(gi428782365) 5e-103 Click
261717171..1717545 PHAGE_Escher_HK75: RusA-like protein; HMPREF9542_01889; phage(gi356870726) 6e-36 Click
271717542..1718363 PHAGE_Entero_HK225: late gene regulator Q; HMPREF9542_01890; phage(gi428782441) 1e-88 Click
281718507..1718582 tRNA 0.0 Click
291718688..1718764 tRNA 0.0 Click
301718902..1719228 conserved domain protein; HMPREF9542_01893 0.0 Click
311719264..1719395 hypothetical protein; HMPREF9542_01894 0.0 Click
32complement(1719477..1719599) conserved domain protein; HMPREF9542_01895 0.0 Click
331719762..1720190 protein, TonB family; HMPREF9542_01896 0.0 Click
341720341..1720736 hypothetical protein; HMPREF9542_01897 0.0 Click
351720958..1721082 PHAGE_Entero_mEp460: porin; HMPREF9542_01898; phage(gi428782370) 6e-12 Click
36complement(1721174..1721746) D,D-heptose 1,7-bisphosphate phosphatase; HMPREF9542_01899 0.0 Click
371721934..1722965 PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF9542_01900; phage(gi371496158) 6e-38 Click
381722958..1723611 ABC transporter, permease protein; HMPREF9542_01901 0.0 Click
391723651..1724466 D-methionine-binding lipoprotein MetQ; HMPREF9542_01902 0.0 Click
401724635..1724988 outer membrane lipoprotein; HMPREF9542_01903 0.0 Click
411724985..1725692 hypothetical protein; HMPREF9542_01904 0.0 Click
421725804..1727522 prolyl-tRNA synthetase; HMPREF9542_01905 0.0 Click
431727522..1728157 hypothetical protein; HMPREF9542_01906 0.0 Click
441728163..1728399 conserved domain protein; HMPREF9542_01907 0.0 Click
45complement(1728525..1729625) PHAGE_Entero_mEp460: tail length tape measure protein; HMPREF9542_01908; phage(gi428782329) 0.0 Click
461729626..1730246 PHAGE_Entero_mEp460: terminase large subunit; HMPREF9542_01909; phage(gi428782318) 2e-123 Click
471730237..1730446 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9542_01910; phage(gi428782319) 2e-33 Click
48complement(1730574..1730999) PHAGE_Entero_mEp460: hypothetical protein; HMPREF9542_01911; phage(gi428782367) 2e-75 Click
49complement(1731037..1731198) hypothetical protein; HMPREF9542_01912 0.0 Click
50complement(1731280..1732087) PHAGE_Entero_mEp460: late gene regulator; HMPREF9542_01913; phage(gi428782366) 1e-144 Click
511732088..1732292 hypothetical protein; HMPREF9542_01914 0.0 Click
521732289..1732879 hypothetical protein; HMPREF9542_01915 0.0 Click
53complement(1732897..1733244) hypothetical protein; HMPREF9542_01916 0.0 Click
541733273..1733395 hypothetical protein; HMPREF9542_01917 0.0 Click
551733373..1733708 colicin E1 immunity protein; HMPREF9542_01918 0.0 Click
56complement(1733730..1735610) PHAGE_Entero_EPS7: putative phage tail protein; HMPREF9542_01919; phage(gi182682945) 3e-07 Click
571737536..1737547 attR    AATTTATGGATT 0.0 Click

Region 7, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12272901..2272912 attL    ACCTTAGTTGAA 0.0 Click
22274037..2274957 PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; HMPREF9542_02484; phage(gi163932195) 9e-05 Click
3complement(2274946..2275416) PHAGE_Burkho_KL3: gp46; HMPREF9542_02485; phage(gi327198091) 3e-35 Click
4complement(2275397..2276815) PHAGE_Burkho_KL3: gp47; HMPREF9542_02486; phage(gi327198092) 2e-101 Click
5complement(2276882..2277577) PHAGE_Marseillevirus: metal dependent phosphohydrolase; HMPREF9542_02487; phage(gi284504106) 2e-06 Click
6complement(2277617..2277919) putative inner membrane protein; HMPREF9542_02488 0.0 Click
72278563..2279024 hypothetical protein; HMPREF9542_02489 0.0 Click
82279018..2279692 outer membrane protein N domain protein; HMPREF9542_02490 0.0 Click
92279744..2280036 PROPHAGE_Xantho_33913: ISxac3 transposase; HMPREF9542_02491; phage(gi21231087) 3e-07 Click
102280146..2280964 PROPHAGE_Escher_CFT073: transposase insF; HMPREF9542_02492; phage(gi26249410) 5e-159 Click
112290292..2290303 attR    ACCTTAGTTGAA 0.0 Click

Region 8, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13109496..3109507 attL    CGTTATGCCTTA 0.0 Click
2complement(3119459..3120934) phage integrase, SAM-like domain protein; HMPREF9542_03404 0.0 Click
3complement(3120944..3121633) PHAGE_Bacill_BCP78: putative RNA polymerase sigma 28 subunit SigF; HMPREF9542_03405; phage(gi410492877) 2e-11 Click
4complement(3121939..3123678) PHAGE_Synech_S_CBS4: tail fiber protein; HMPREF9542_03406; phage(gi374531790) 2e-13 Click
53123944..3125350 PHAGE_Equid__1: envelope glycoprotein J; HMPREF9542_03407; phage(gi50313312) 1e-10 Click
63125375..3125785 flagellar protein FliS; HMPREF9542_03408 0.0 Click
73125785..3126150 flagellar protein; HMPREF9542_03409 0.0 Click
83126228..3127715 cytoplasmic alpha-amylase; HMPREF9542_03410 0.0 Click
9complement(3127749..3128165) hypothetical protein; HMPREF9542_03411 0.0 Click
103128349..3129554 YeeE/YedE family protein; HMPREF9542_03412 0.0 Click
113129551..3129784 hypothetical protein; HMPREF9542_03413 0.0 Click
123129893..3130564 PHAGE_Pseudo_F116: hypothetical protein F116p67; HMPREF9542_03414; phage(gi56692976) 2e-42 Click
133130732..3131327 PHAGE_Entero_SfV: hypothetical protein SfVp44; HMPREF9542_03415; phage(gi19549031) 2e-85 Click
14complement(3131476..3132300) PHAGE_Entero_SfV: hypothetical protein SfVp31; HMPREF9542_03416; phage(gi19549018) 9e-152 Click
15complement(3132366..3132746) PHAGE_Entero_SfV: hypothetical protein SfVp32; HMPREF9542_03417; phage(gi19549019) 2e-62 Click
163132986..3133375 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9542_03418; phage(gi428782353) 7e-48 Click
17complement(3133388..3133537) hypothetical protein; HMPREF9542_03419 0.0 Click
18complement(3133540..3133850) PHAGE_Entero_SfV: repressor; HMPREF9542_03420; phage(gi19549021) 5e-59 Click
193143759..3143770 attR    CGTTATGCCTTA 0.0 Click

Region 9, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3401411..3401940) PHAGE_Entero_HK629: minor tail protein; HMPREF9542_03698; phage(gi428782029) 6e-98 Click
2complement(3401940..3402269) PHAGE_Entero_HK629: minor tail protein; HMPREF9542_03699; phage(gi428782028) 2e-59 Click
3complement(3402266..3404827) PHAGE_Entero_HK629: tail length tape measure protein; HMPREF9542_03700; phage(gi428782027) 0.0 Click
4complement(3404820..3405254) PHAGE_Entero_HK629: tail assembly protein; HMPREF9542_03701; phage(gi428782026) 3e-81 Click
5complement(3405236..3405658) PHAGE_Entero_HK629: minor tail protein; HMPREF9542_03702; phage(gi428782025) 2e-73 Click
6complement(3405674..3406432) PHAGE_Entero_HK629: major tail protein; HMPREF9542_03703; phage(gi428782024) 1e-142 Click
7complement(3406422..3406817) PHAGE_Entero_HK629: minor tail protein; HMPREF9542_03704; phage(gi428782023) 2e-72 Click
8complement(3406814..3407392) PHAGE_Entero_HK629: minor tail protein; HMPREF9542_03705; phage(gi428782022) 1e-101 Click
9complement(3407404..3407757) PHAGE_Entero_HK629: head-tail connector Fii; HMPREF9542_03706; phage(gi428782021) 7e-63 Click
10complement(3407769..3408203) PHAGE_Entero_HK629: DNA packaging protein Fi; HMPREF9542_03707; phage(gi428782020) 3e-57 Click
11complement(3408206..3409231) PHAGE_Entero_HK629: major head subunit; HMPREF9542_03708; phage(gi428782019) 0.0 Click
12complement(3409287..3409625) PHAGE_Entero_HK629: head decoration protein; HMPREF9542_03709; phage(gi428782018) 5e-57 Click
13complement(3409629..3410909) PHAGE_Entero_HK629: head maturation protease; HMPREF9542_03710; phage(gi428782016) 0.0 Click
14complement(3410929..3412530) PHAGE_Entero_HK629: portal protein; HMPREF9542_03711; phage(gi428782015) 0.0 Click
15complement(3412527..3412733) PHAGE_Entero_HK629: head-tail connector; HMPREF9542_03712; phage(gi428782014) 2e-31 Click
16complement(3412730..3414655) PHAGE_Entero_HK629: terminase large subunit A; HMPREF9542_03713; phage(gi428782013) 0.0 Click
17complement(3414630..3415175) PHAGE_Entero_HK629: terminase small subunit nu1; HMPREF9542_03714; phage(gi428782012) 1e-96 Click
183415175..3415318 hypothetical protein; HMPREF9542_03715 0.0 Click
193415624..3415758 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; HMPREF9542_03716; phage(gi209427772) 6e-09 Click
203416106..3416414 PHAGE_Entero_HK629: Bor protein; HMPREF9542_03717; phage(gi428782078) 1e-46 Click
21complement(3416446..3416847) PHAGE_Entero_HK629: cell lysis protein Rz; HMPREF9542_03718; phage(gi428782076) 5e-70 Click
223416848..3417476 PHAGE_Entero_HK629: tail fiber; HMPREF9542_03719; phage(gi428782032) 5e-114 Click
23complement(3417616..3417852) hypothetical protein; HMPREF9542_03720 0.0 Click
243417878..3418218 PHAGE_Xantho_vB_XveM_DIBBI: single-stranded DNA-binding protein; HMPREF9542_03721; phage(gi389060431) 6e-43 Click
253418219..3418393 hypothetical protein; HMPREF9542_03722 0.0 Click
263418491..3418689 hypothetical protein; HMPREF9542_03723 0.0 Click
273418742..3419029 hypothetical protein; HMPREF9542_03724 0.0 Click
283419221..3419970 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; HMPREF9542_03725; phage(gi414086954) 3e-42 Click

Region 10, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13607138..3607562 PHAGE_Entero_2008: antitermination protein Q; HMPREF9542_03952; phage(gi209427762) 1e-55 Click
2complement(3607647..3608093) hypothetical protein; HMPREF9542_03953 0.0 Click
3complement(3608268..3608797) PHAGE_Entero_mEp460: minor tail protein; HMPREF9542_03954; phage(gi428782331) 2e-100 Click
4complement(3608807..3609136) PHAGE_Entero_mEp460: minor tail protein; HMPREF9542_03955; phage(gi428782330) 2e-61 Click
5complement(3609136..3609456) PHAGE_Entero_mEp460: tail length tape measure protein; HMPREF9542_03956; phage(gi428782329) 2e-56 Click
63609457..3609983 conserved domain protein; HMPREF9542_03957 0.0 Click
73609980..3610549 hypothetical protein; HMPREF9542_03958 0.0 Click
8complement(3610851..3611336) PHAGE_Pseudo_YuA: hypothetical protein; HMPREF9542_03959; phage(gi162135127) 4e-14 Click
9complement(3611428..3611529) conserved domain protein; HMPREF9542_03960 0.0 Click
10complement(3611726..3612356) PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; HMPREF9542_03961; phage(gi414086954) 2e-33 Click
11complement(3612357..3612634) PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; HMPREF9542_03962; phage(gi414086954) 7e-16 Click
123612635..3612877 conserved domain protein; HMPREF9542_03963 0.0 Click
133612871..3613107 conserved domain protein; HMPREF9542_03964 0.0 Click
14complement(3613104..3613514) PHAGE_Erwini_phiEaH2: hypothetical protein; HMPREF9542_03965; phage(gi431810676) 1e-08 Click
15complement(3613530..3614213) hypothetical protein; HMPREF9542_03966 0.0 Click
16complement(3614349..3615419) PHAGE_Rhodot_RM378: hypothetical protein Rm378p022; HMPREF9542_03967; phage(gi30044012) 4e-07 Click

Region 11, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14544907..4545932 PHAGE_Pseudo_MP1412: diguanylate-cyclase GGDEF domain; HMPREF9542_04977; phage(gi399529005) 7e-06 Click
2complement(4546199..4546447) transglycosylase associated protein; HMPREF9542_04978 0.0 Click
3complement(4546459..4546614) hypothetical protein; HMPREF9542_04979 0.0 Click
4complement(4546674..4546928) PHAGE_Entero_If1: hypothetical protein If1p09; HMPREF9542_04980; phage(gi9630756) 6e-38 Click
54547092..4547325 antirestriction protein; HMPREF9542_04981 0.0 Click
64547433..4547710 PHAGE_Entero_cdtI: Repressor; HMPREF9542_04982; phage(gi148609424) 4e-33 Click
74547742..4548311 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp43; HMPREF9542_04983; phage(gi148609425) 8e-94 Click
84548308..4548646 hypothetical protein; HMPREF9542_04984 0.0 Click
94548656..4549133 PHAGE_Entero_phiP27: hypothetical protein P27p17; HMPREF9542_04985; phage(gi18249881) 2e-40 Click
104549134..4549604 PHAGE_Entero_HK140: DNA replication protein O; HMPREF9542_04986; phage(gi428781991) 3e-19 Click
114549601..4550095 PHAGE_Entero_mEp460: hypothetical protein; HMPREF9542_04987; phage(gi428782360) 7e-87 Click
124550095..4550480 PHAGE_Entero_cdtI: putative DNA adenine methylase; HMPREF9542_04988; phage(gi148609429) 2e-73 Click
134550838..4551290 hypothetical protein; HMPREF9542_04989 0.0 Click
14complement(4551403..4551981) firmicute plasmid replication protein; HMPREF9542_04990 0.0 Click
154552166..4552354 hypothetical protein; HMPREF9542_04991 0.0 Click
16complement(4552355..4552938) PHAGE_Entero_SfV: hypothetical protein SfVp44; HMPREF9542_04992; phage(gi19549031) 2e-91 Click
174553052..4553405 StbA protein; HMPREF9542_04993 0.0 Click
184553398..4553814 hypothetical protein; HMPREF9542_04994 0.0 Click
19complement(4553816..4555090) PHAGE_Cronob_ENT39118: DNA polymerase; HMPREF9542_04995; phage(gi431811050) 1e-143 Click
20complement(4555090..4555527) PHAGE_Cronob_ENT39118: protein umuD; HMPREF9542_04996; phage(gi431811072) 2e-21 Click
21complement(4555524..4555805) PHAGE_Sodali_phiSG1: ImpC protein; HMPREF9542_04997; phage(gi89886014) 3e-16 Click