Actinobacillus pleuropneumoniae serovar 4 str. M62 , [asmbl_id: NC_000000].2271179, GC%: 41.22%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12136947..2136959 attL    TTTGACCGCTTGA 0.0 Click
22139841..2139866 attL    GACCGCCGTAACAAGCGGTCTTTTTT 0.0 Click
3complement(2144205..2144378) PHAGE_Aggreg_S1249: putative lytic protein Rz1; appser4_20750; phage(gi273809573) 2e-12 Click
4complement(2144398..2144763) PHAGE_Aggreg_S1249: putative lytic protein Rz; appser4_20760; phage(gi273809574) 6e-06 Click
5complement(2144765..2145055) PHAGE_Aggreg_S1249: putative Lys protein; appser4_20770; phage(gi273809575) 1e-24 Click
6complement(2145384..2145512) hypothetical protein; appser4_20780 0.0 Click
72145844..2145918 tRNA 0.0 Click
8complement(2146027..2146374) hypothetical protein; appser4_20790 0.0 Click
9complement(2146516..2146992) PHAGE_Aggreg_S1249: NinG recombination protein; appser4_20800; phage(gi273809581) 5e-47 Click
10complement(2147081..2147194) hypothetical protein; appser4_20810 0.0 Click
11complement(2147854..2148306) PHAGE_Escher_TL_2011c: hypothetical protein; appser4_20820; phage(gi418487093) 2e-44 Click
122148491..2149156 hypothetical protein; appser4_20830 0.0 Click
13complement(2149209..2149670) hypothetical protein; appser4_20840 0.0 Click
14complement(2149868..2150713) PHAGE_Strept_PH15: putative integrase; appser4_20850; phage(gi190151416) 1e-07 Click
15complement(2150710..2151312) PHAGE_Xantho_vB_XveM_DIBBI: N-6-adenine-methyltransferase; appser4_20860; phage(gi389060440) 2e-21 Click
16complement(2151309..2151965) PHAGE_Aggreg_S1249: possible bacteriophage replication protein P; appser4_20870; phage(gi273809587) 4e-29 Click
17complement(2151965..2152249) PHAGE_Aggreg_S1249: replication protein; appser4_20890; phage(gi273809588) 8e-20 Click
182152235..2152486 hypothetical protein; appser4_20880 0.0 Click
19complement(2152732..2153481) PHAGE_Aggreg_S1249: uncharacterized phage-encoded protein; appser4_20900; phage(gi273809589) 1e-40 Click
20complement(2153536..2153703) PHAGE_Entero_ST64T: Cro; appser4_20910; phage(gi24371558) 7e-16 Click
212153870..2154547 PHAGE_Stx2_c_I: CI protein; appser4_20920; phage(gi20065916) 4e-38 Click
222154591..2155331 hypothetical protein; appser4_20930 0.0 Click
232155328..2156143 hypothetical protein; appser4_20940 0.0 Click
242156664..2156891 hypothetical protein; appser4_20950 0.0 Click
252157779..2157804 attR    GACCGCCGTAACAAGCGGTCTTTTTT 0.0 Click
262157856..2158086 hypothetical protein; appser4_20960 0.0 Click
272158090..2158569 hypothetical protein; appser4_20970 0.0 Click
282158573..2159529 PHAGE_Psychr_pOW20_A: recombinase; appser4_20980; phage(gi472339794) 2e-53 Click
292170608..2170620 attR    TTTGACCGCTTGA 0.0 Click

Region 2, total : 111 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12172701..2172712 attL    CGCTTGTCGGTA 0.0 Click
22172968..2173960 PHAGE_Escher_TL_2011b: putative integrase; appser4_21090; phage(gi418487628) 1e-97 Click
3complement(2174017..2174271) PHAGE_Aggreg_S1249: hypothetical protein; appser4_21100; phage(gi273809543) 1e-23 Click
4complement(2174261..2174860) PHAGE_Haemop_SuMu: putative tail fiber assembly protein; appser4_21110; phage(gi418489074) 3e-31 Click
5complement(2174912..2177260) PHAGE_Mannhe_phiMHaA1: variable tail fiber protein H; appser4_21120; phage(gi109289958) 5e-28 Click
6complement(2177262..2177870) PHAGE_Pseudo_PAK_P1: hypothetical protein; appser4_21130; phage(gi326804414) 3e-16 Click
7complement(2177870..2179306) PHAGE_Pseudo_vB_PaeM_C2_10_Ab1: Putative baseplate component; appser4_21140; phage(gi431810002) 4e-38 Click
8complement(2179303..2179629) PHAGE_Xantho_vB_XveM_DIBBI: hypothetical protein; appser4_21150; phage(gi389060424) 5e-13 Click
9complement(2179671..2180279) PHAGE_Aggreg_S1249: putative baseplate protein; appser4_21160; phage(gi273809550) 1e-17 Click
10complement(2180279..2181262) PHAGE_Erwini_phiEt88: hypothetical protein; appser4_21170; phage(gi327198580) 1e-36 Click
11complement(2181274..2181591) PHAGE_Pseudo_KPP10: hypothetical protein; appser4_21180; phage(gi327198192) 5e-05 Click
12complement(2181602..2182246) PHAGE_Erwini_phiEt88: hypothetical protein; appser4_21190; phage(gi327198578) 2e-17 Click
13complement(2182335..2183015) hypothetical protein; appser4_21200 0.0 Click
14complement(2183135..2184934) PHAGE_Vibrio_vB_VpaS_MAR10: tail tape measure protein; appser4_21210; phage(gi428782128) 1e-33 Click
15complement(2185247..2185399) hypothetical protein; appser4_21220 0.0 Click
16complement(2185438..2185899) hypothetical protein; appser4_21230 0.0 Click
17complement(2185899..2186324) PHAGE_Pseudo_KPP10: putative structural protein; appser4_21240; phage(gi327198186) 6e-24 Click
18complement(2186401..2187471) PHAGE_Erwini_phiEt88: hypothetical protein; appser4_21250; phage(gi327198574) 1e-54 Click
19complement(2187458..2187958) PHAGE_Erwini_phiEt88: hypothetical protein; appser4_21260; phage(gi327198573) 1e-07 Click
20complement(2187927..2188292) hypothetical protein; appser4_21270 0.0 Click
21complement(2188319..2188714) PHAGE_Erwini_phiEt88: hypothetical protein; appser4_21280; phage(gi327198571) 4e-13 Click
22complement(2188752..2189072) hypothetical protein; appser4_21290 0.0 Click
23complement(2189101..2189277) hypothetical protein; appser4_21300 0.0 Click
24complement(2189280..2190263) PHAGE_Synech_S_CBS4: major capsid protein; appser4_21310; phage(gi374531766) 2e-42 Click
25complement(2190303..2190752) PHAGE_Xantho_vB_XveM_DIBBI: hypothetical protein; appser4_21320; phage(gi389060408) 5e-07 Click
26complement(2190759..2191829) PHAGE_Xantho_vB_XveM_DIBBI: major capsid protein; appser4_21330; phage(gi389060407) 4e-48 Click
27complement(2191829..2192590) PHAGE_Psychr_pOW20_A: phage head morphogenesis protein; appser4_21340; phage(gi472339824) 3e-32 Click
28complement(2192628..2193863) PHAGE_Erwini_phiEt88: portal protein; appser4_21350; phage(gi327198564) 1e-35 Click
29complement(2193866..2195020) PHAGE_Psychr_pOW20_A: phage terminase large subunit; appser4_21360; phage(gi472339822) 2e-86 Click
30complement(2195193..2195723) PHAGE_Aggreg_S1249: putative terminase small subunit TerS; appser4_21370; phage(gi273809571) 1e-45 Click
31complement(2195761..2196261) PHAGE_Haemop_SuMu: conserved possible DNA-binding protein; appser4_21380; phage(gi418489059) 5e-45 Click
32complement(2196269..2196523) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21390; phage(gi418489058) 2e-28 Click
33complement(2196523..2196780) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21400; phage(gi418489057) 8e-35 Click
34complement(2196773..2196928) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21410; phage(gi418489056) 6e-09 Click
35complement(2196943..2197302) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21420; phage(gi418489054) 2e-21 Click
36complement(2197299..2197541) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21430; phage(gi418489053) 8e-07 Click
37complement(2197545..2198078) PHAGE_Bordet_1: Bbp2; appser4_21440; phage(gi41179364) 6e-46 Click
38complement(2198164..2198631) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21450; phage(gi418489051) 2e-47 Click
39complement(2198725..2198895) hypothetical protein; appser4_21460 0.0 Click
40complement(2198917..2199051) hypothetical protein; appser4_21470 0.0 Click
41complement(2199210..2199545) hypothetical protein; appser4_21480 0.0 Click
42complement(2200110..2200610) hypothetical protein; appser4_21490 0.0 Click
43complement(2200732..2201079) hypothetical protein; appser4_21500 0.0 Click
44complement(2201164..2201565) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21510; phage(gi418489049) 2e-44 Click
45complement(2201573..2202130) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21520; phage(gi418489048) 5e-58 Click
46complement(2202522..2202839) hypothetical protein; appser4_21530 0.0 Click
47complement(2202914..2203858) hypothetical protein; appser4_21540 0.0 Click
48complement(2203881..2204066) hypothetical protein; appser4_21550 0.0 Click
49complement(2204071..2204280) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21560; phage(gi418489044) 3e-07 Click
50complement(2204474..2204998) PHAGE_Haemop_SuMu: host-nuclease inhibitor protein; appser4_21570; phage(gi418489043) 1e-44 Click
51complement(2205209..2205385) PHAGE_Haemop_SuMu: Gam; appser4_21580; phage(gi418489041) 3e-11 Click
52complement(2205403..2205723) hypothetical protein; appser4_21590 0.0 Click
53complement(2205736..2206617) PHAGE_Haemop_SuMu: phage transposase; appser4_21600; phage(gi418489040) 1e-83 Click
54complement(2206629..2208590) PHAGE_Haemop_SuMu: phage transposase; appser4_21610; phage(gi418489038) 0.0 Click
55complement(2208635..2208913) PHAGE_Haemop_SuMu: Mu-like prophage FluMu DNA-binding protein Ner; appser4_21620; phage(gi418489037) 5e-19 Click
562209138..2209854 PHAGE_Haemop_SuMu: transcription regulator; appser4_21630; phage(gi418489036) 1e-67 Click
57complement(2210108..2211058) PHAGE_Cyanop_KBS_S_2A: RNA polymerase sigma factor RpoD; appser4_21640; phage(gi472341467) 6e-17 Click
58complement(2211207..2212544) Phosphoglycerate transporter protein; appser4_21650 0.0 Click
592212723..2213088 tRNA 0.0 Click
602213119..2213631 hypothetical protein; appser4_21660 0.0 Click
61complement(2214144..2215136) Aspartate--ammonia ligase; appser4_21670 0.0 Click
622215318..2215779 hypothetical protein; appser4_21680 0.0 Click
632215968..2216732 Uridine phosphorylase; appser4_21690 0.0 Click
642216796..2217290 4-hydroxybenzoate synthetase/chorismate--pyruvate lyase; appser4_21700 0.0 Click
652217363..2218160 Glutamate racemase; appser4_21710 0.0 Click
66complement(2218278..2220218) PHAGE_Plankt_PaV_LD: ABC transporter; appser4_21720; phage(gi371496158) 7e-38 Click
67complement(2220218..2221381) macrolide-specific efflux protein; appser4_21730 0.0 Click
68complement(2221514..2222290) 24 kDa outer membrane protein; appser4_21740 0.0 Click
69complement(2222621..2223553) DNA polymerase III subunit delta; appser4_21750 0.0 Click
70complement(2223607..2224233) PHAGE_Pseudo_EL: putative thymidylate kinase; appser4_21760; phage(gi82701134) 5e-28 Click
71complement(2224237..2225271) hypothetical protein; appser4_21770 0.0 Click
722225391..2225466 tRNA 0.0 Click
732225490..2225565 tRNA 0.0 Click
74complement(2225760..2225993) PHAGE_Ralsto_RSL1: unnamed protein product; appser4_21780; phage(gi189426860) 1e-15 Click
75complement(2226257..2226931) Ribulose-phosphate 3-epimerase; appser4_21790 0.0 Click
762227153..2227422 50S ribosomal protein L31 type B; appser4_21800 0.0 Click
772227436..2227561 50S ribosomal protein L36 2; appser4_21810 0.0 Click
78complement(2227666..2230068) Penicillin-binding protein 1B; appser4_21820 0.0 Click
79complement(2230147..2231004) 1,4-dihydroxy-2-naphthoate synthase; appser4_21830 0.0 Click
80complement(2231139..2232845) PHAGE_Salmon_SSU5: putative guanosine polyphosphate pyrophospho hydrolase/synthetase; appser4_21840; phage(gi410491509) 2e-12 Click
81complement(2232941..2233222) DNA-directed RNA polymerase subunit omega; appser4_21850 0.0 Click
82complement(2233349..2235430) ATP-dependent DNA helicase recG; appser4_21860 0.0 Click
83complement(2235554..2235919) PilT protein-like protein; appser4_21870 0.0 Click
84complement(2235982..2236269) hypothetical protein; appser4_21880 0.0 Click
852236475..2238190 Prolyl-tRNA synthetase; appser4_21890 0.0 Click
86complement(2238447..2239028) RNA polymerase sigma factor; appser4_21900 0.0 Click
872239111..2240073 hypothetical protein; appser4_21910 0.0 Click
882240073..2240666 Ferric reductase domain protein transmembrane component domain; appser4_21920 0.0 Click
89complement(2240858..2241022) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21930; phage(gi418489077) 2e-16 Click
90complement(2241133..2241603) PHAGE_Haemop_SuMu: enoyl-CoA hydratase/carnithine racemase-like protein; appser4_21940; phage(gi418489075) 1e-52 Click
91complement(2241596..2241712) hypothetical protein; appser4_21950 0.0 Click
92complement(2241722..2242303) hypothetical protein; appser4_21960 0.0 Click
93complement(2242321..2244060) PHAGE_Haemop_SuMu: putative phage-related tail fiber protein; appser4_21970; phage(gi418489073) 1e-29 Click
94complement(2244070..2244654) PHAGE_Haemop_SuMu: hypothetical protein; appser4_21980; phage(gi418489072) 2e-88 Click
95complement(2244654..2245715) PHAGE_Haemop_SuMu: baseplate J family protein gp47; appser4_21990; phage(gi418489071) 2e-151 Click
96complement(2245719..2246000) PHAGE_Haemop_SuMu: Mu bacteriophage protein gp46; appser4_22000; phage(gi418489070) 7e-37 Click
97complement(2246176..2246829) PHAGE_Haemop_SuMu: phage-related baseplate assembly protein gp45; appser4_22010; phage(gi418489069) 1e-91 Click
98complement(2246826..2247998) PHAGE_Haemop_SuMu: Mu-like prophage tail protein gpP; appser4_22020; phage(gi418489068) 3e-172 Click
99complement(2248003..2249361) PHAGE_Haemop_SuMu: DNA circulation protein; appser4_22030; phage(gi418489067) 4e-149 Click
100complement(2249361..2251748) PHAGE_Haemop_SuMu: bacteriophage tail length determination protein; appser4_22040; phage(gi418489066) 0.0 Click
101complement(2251802..2251990) PHAGE_Haemop_SuMu: hypothetical protein; appser4_22050; phage(gi418489065) 5e-09 Click
1022251991..2252002 attR    CGCTTGTCGGTA 0.0 Click
103complement(2252020..2252307) PHAGE_Haemop_SuMu: hypothetical protein; appser4_22060; phage(gi418489064) 2e-22 Click
104complement(2252379..2252753) PHAGE_Haemop_SuMu: tail tube protein; appser4_22070; phage(gi418489063) 2e-49 Click
105complement(2252764..2254176) PHAGE_Haemop_SuMu: tail sheath protein gpL; appser4_22080; phage(gi418489090) 0.0 Click
106complement(2254169..2254360) PHAGE_Haemop_SuMu: hypothetical protein; appser4_22090; phage(gi418489089) 5e-14 Click
107complement(2254361..2255002) PHAGE_Haemop_SuMu: Mu-like prophage protein gp37; appser4_22100; phage(gi418489088) 1e-80 Click
108complement(2254999..2255424) PHAGE_Haemop_SuMu: Mu-like prophage protein gp36; appser4_22110; phage(gi418489087) 4e-62 Click
109complement(2255427..2255762) PHAGE_Haemop_SuMu: hypothetical protein; appser4_22120; phage(gi418489061) 1e-22 Click
110complement(2255810..2256727) PHAGE_Haemop_SuMu: gpT; appser4_22130; phage(gi418489086) 2e-136 Click
111complement(2256727..2257797) PHAGE_Haemop_SuMu: bacteriophage Mu I protein gp32; appser4_22140; phage(gi418489085) 3e-155 Click
112complement(2258056..2258472) PHAGE_Haemop_SuMu: Mu-like prophage protein gpG; appser4_22150; phage(gi418489082) 3e-58 Click
113complement(2258620..2259909) PHAGE_Haemop_SuMu: MuF; appser4_22160; phage(gi418489084) 0.0 Click
114complement(2259896..2261521) PHAGE_Haemop_SuMu: portal protein gp29; appser4_22170; phage(gi418489080) 0.0 Click
115complement(2261581..2263206) PHAGE_Haemop_SuMu: terminase; appser4_22180; phage(gi418489081) 0.0 Click
116complement(2263210..2263356) hypothetical protein; appser4_22190 0.0 Click
117complement(2263386..2264986) PHAGE_Megavi_lba: collagen-like protein 2; appser4_22200; phage(gi448825240) 6e-16 Click