Lactobacillus crispatus CTV-05 .1, whole genome shotgun [asmbl_id: NC_000000].2299477, GC%: 37.06%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 89 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1648630..648641 attL    CTTTTTTATTAA 0.0 Click
2652813..652824 attL    AAAATAAGAATT 0.0 Click
3656288..657196 PHAGE_Thermu_26: phage XerD-like integrase; PP_00695; phage(gi157265417) 8e-12 Click
4657205..657729 PROPHAGE_Escher_Sakai: ATP-dependent protease peptidase subunit; PP_00696; phage(gi15834113) 1e-39 Click
5657741..659138 PROPHAGE_Escher_Sakai: ATP-dependent protease ATP-binding subunit HslU; PP_00697; phage(gi15834112) 7e-114 Click
6659298..660194 galactose mutarotase related enzyme [Lactobacillus crispatus ST1] gi|295692923|ref|YP_003601533.1|; PP_00698 0.0 Click
7660212..661033 putative reductase [Lactobacillus johnsonii DPC 6026] gi|385825933|ref|YP_005862275.1|; PP_00699 8e-85 Click
8661123..661134 attR    AAAATAAGAATT 0.0 Click
9complement(661240..662397) PHAGE_Lactob_Lj928: putative integrase; PP_00700; phage(gi41179288) 8e-71 Click
10662474..662485 attL    TTTTTATTTTGC 0.0 Click
11complement(662477..663157) PHAGE_Bacill_IEBH: hypothetical protein IEBH_gp81; PP_00701; phage(gi197261595) 2e-05 Click
12complement(663160..663567) PHAGE_Lactob_phiadh: hypothetical protein phiadhp04; PP_00702; phage(gi9633004) 3e-28 Click
13complement(663578..663913) PHAGE_Lactob_Lj771: cl repressor; PP_00703; phage(gi163932156) 3e-19 Click
14664098..664346 PHAGE_Lactob_Lj771: hypothetical protein LJ771_005; PP_00704; phage(gi163932157) 5e-19 Click
15664349..664642 hypothetical; PP_00705 0.0 Click
16664643..664957 hypothetical; PP_00706 0.0 Click
17664954..665199 hypothetical protein LA2_05600 [Lactobacillus amylovorus GRL 1112] gi|315038306|ref|YP_004031874.1|; PP_00707 2e-15 Click
18665208..665417 PHAGE_Staphy_SpaA1: XRE family transcriptional regulator; PP_00708; phage(gi399498895) 2e-06 Click
19665430..665720 hypothetical; PP_00709 0.0 Click
20665966..666343 hypothetical; PP_00710 0.0 Click
21666336..667211 PHAGE_Lactob_Lj771: hypothetical protein LJ771_008; PP_00711; phage(gi163932160) 1e-20 Click
22667211..668170 PHAGE_Lactob_Lj771: putative recombination protein; PP_00712; phage(gi163932161) 5e-54 Click
23668172..668891 PHAGE_Burkho_Bcep22: Bcep22gp27; PP_00713; phage(gi38640333) 7e-20 Click
24668891..669016 PHAGE_Lactob_AQ113: putative transcriptional regulator; PP_00714; phage(gi446730276) 5e-05 Click
25669019..669231 hypothetical protein LA2_05670 [Lactobacillus amylovorus GRL 1112] gi|315038320|ref|YP_004031888.1|; PP_00715 1e-10 Click
26669236..669841 DNA repair protein RadC [Haemophilus somnus 2336] gi|170719078|ref|YP_001783364.1|; PP_00716 2e-20 Click
27669843..670151 hypothetical; PP_00717 0.0 Click
28670172..670435 hypothetical; PP_00718 0.0 Click
29670625..670744 hypothetical; PP_00719 0.0 Click
30670746..671162 hypothetical; PP_00720 0.0 Click
31671478..671624 PHAGE_Lactoc_r1t: Integrase; PP_00721; phage(gi23455720) 2e-06 Click
32671634..672278 PHAGE_Strept_2: hypothetical protein SpyM3_0951; PP_00722; phage(gi28876235) 3e-50 Click
33672266..672961 PHAGE_Lactob_1: hypothetical protein lb338_phage_94; PP_00723; phage(gi226377724) 7e-09 Click
34673150..673686 PHAGE_Lactob_phig1e: putative methyltransferase; PP_00724; phage(gi23455790) 5e-44 Click
35673679..673798 hypothetical; PP_00725 0.0 Click
36673795..674259 hypothetical; PP_00726 0.0 Click
37674231..674494 hypothetical; PP_00727 0.0 Click
38674506..674931 hypothetical; PP_00728 0.0 Click
39674936..675199 hypothetical; PP_00729 0.0 Click
40675192..675899 PHAGE_Entero_phiFL3A: anti-repressor protein; PP_00730; phage(gi281416221) 3e-35 Click
41675914..676069 hypothetical; PP_00731 0.0 Click
42676455..676601 hypothetical; PP_00732 0.0 Click
43676718..677575 putative transposase [Lactobacillus helveticus DPC 4571] gi|161507482|ref|YP_001577436.1|; PP_00733 2e-162 Click
44677732..677848 hypothetical; PP_00734 0.0 Click
45678029..678550 PHAGE_Lactob_Lj771: hypothetical protein LJ771_025; PP_00735; phage(gi163932177) 6e-07 Click
46678812..678882 tRNA 0.0 Click
47679294..679524 hypothetical; PP_00736 0.0 Click
48679524..679703 hypothetical; PP_00737 0.0 Click
49679707..680024 hypothetical; PP_00738 0.0 Click
50680244..680417 PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_00739; phage(gi90592604) 5e-22 Click
51680443..680607 PHAGE_Lactob_Lj771: hypothetical protein LJ771_027; PP_00740; phage(gi163932179) 2e-09 Click
52680620..680919 hypothetical; PP_00741 0.0 Click
53680989..681486 hypothetical protein LAR_0785 [Lactobacillus reuteri JCM 1112] gi|184153440|ref|YP_001841781.1|; PP_00742 1e-11 Click
54681473..682930 PHAGE_Lister_B054: TerL; PP_00743; phage(gi157325286) 3e-103 Click
55682946..684367 PHAGE_Klebsi_KP36: portal protein; PP_00744; phage(gi429216205) 4e-11 Click
56684393..685148 PHAGE_Vibrio_vB_VchM_138: putative head protein; PP_00745; phage(gi422936568) 1e-16 Click
57685154..685540 hypothetical protein LA2_05760 [Lactobacillus amylovorus GRL 1112] gi|315038338|ref|YP_004031906.1|; PP_00746 9e-10 Click
58685544..686734 PHAGE_Synech_S_CBS4: putative head protein; PP_00747; phage(gi374531764) 1e-28 Click
59686734..687300 PHAGE_Lister_B054: gp7; PP_00748; phage(gi157325291) 6e-12 Click
60687300..688340 PHAGE_Lister_B054: gp8; PP_00749; phage(gi157325292) 5e-20 Click
61688342..688731 hypothetical protein LA2_05780 [Lactobacillus amylovorus GRL 1112] gi|315038342|ref|YP_004031910.1|; PP_00750 1e-09 Click
62688731..689327 PHAGE_Lister_B054: gp11; PP_00751; phage(gi157325295) 1e-25 Click
63689345..689800 hypothetical protein LA2_05790 [Lactobacillus amylovorus GRL 1112] gi|315038344|ref|YP_004031912.1|; PP_00752 4e-19 Click
64689757..690275 hypothetical protein LA2_05795 [Lactobacillus amylovorus GRL 1112] gi|315038345|ref|YP_004031913.1|; PP_00753 6e-21 Click
65690275..691444 PHAGE_Lister_B054: gp14; PP_00754; phage(gi157325298) 1e-51 Click
66691463..691894 PHAGE_Lister_B054: gp15; PP_00755; phage(gi157325299) 2e-12 Click
67691951..692319 PHAGE_Lister_B054: gp16; PP_00756; phage(gi157325300) 8e-09 Click
68692387..692533 hypothetical; PP_00757 0.0 Click
69692563..692574 attR    TTTTTATTTTGC 0.0 Click
70692603..697810 PHAGE_Lactoc_bIL286: tail protein; PP_00758; phage(gi13095795) 3e-69 Click
71697828..698748 muramidase (flagellum-specific) [Lactobacillus amylovorus GRL 1112] gi|315038351|ref|YP_004031919.1|; PP_00759 7e-35 Click
72698793..699203 PHAGE_Lister_B054: gp20; PP_00760; phage(gi157325304) 8e-10 Click
73699203..700330 PHAGE_Lister_B054: gp21; PP_00761; phage(gi157325305) 8e-19 Click
74700343..700816 hypothetical protein LA2_05840 [Lactobacillus amylovorus GRL 1112] gi|315038354|ref|YP_004031922.1|; PP_00762 3e-32 Click
75700809..701177 PHAGE_Lister_B054: gp23; PP_00763; phage(gi157325307) 1e-06 Click
76701167..702348 PHAGE_Deep_s_D6E: baseplate protein; PP_00764; phage(gi423262343) 3e-49 Click
77702338..703090 PHAGE_Deep_s_D6E: hypothetical protein; PP_00765; phage(gi423262344) 2e-06 Click
78703101..704768 PHAGE_Lactob_Lj771: hypothetical protein LJ771_049; PP_00766; phage(gi163932148) 2e-22 Click
79704787..705179 hypothetical; PP_00767 0.0 Click
80705176..705550 PHAGE_Lactob_AQ113: hypothetical protein; PP_00768; phage(gi446730254) 7e-19 Click
81705638..706264 PHAGE_Lactob_Lj771: hypothetical protein LJ771_050; PP_00769; phage(gi163932149) 7e-13 Click
82706283..706465 hypothetical; PP_00770 0.0 Click
83706434..706823 PHAGE_Lactob_Lj771: hypothetical protein LJ771_051; PP_00771; phage(gi163932150) 3e-10 Click
84706834..707055 PHAGE_Lactob_AQ113: hypothetical protein; PP_00772; phage(gi446730257) 1e-06 Click
85707039..707269 PHAGE_Lactob_AQ113: hypothetical protein; PP_00773; phage(gi446730258) 5e-20 Click
86707269..707667 PHAGE_Lactob_AQ113: hypothetical protein; PP_00774; phage(gi446730259) 2e-16 Click
87707654..707806 hypothetical; PP_00775 0.0 Click
88707766..708887 PHAGE_Lactob_AQ113: endolysin; PP_00776; phage(gi446730260) 0.0 Click
89709125..709406 PHAGE_Lactob_Lj771: Maz-like protein; PP_00777; phage(gi163932201) 4e-21 Click
90709440..709796 PHAGE_Lactob_Lj771: MazF-like protein; PP_00778; phage(gi163932202) 2e-21 Click
91710185..710361 hypothetical; PP_00779 0.0 Click
92710591..710902 aggregation promoting factor [Lactobacillus crispatus ST1] gi|295692926|ref|YP_003601536.1|; PP_00780 5e-51 Click
93711005..711283 PHAGE_Entero_phiEF24C: peptidoglycan-binding LysM; PP_00781; phage(gi158079306) 2e-28 Click
94complement(711420..712343) PROPHAGE_Escher_MG1655: IS150 transposase B; PP_00782; phage(gi16131429) 4e-35 Click
95complement(712424..713131) PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; PP_00783; phage(gi17546156) 1e-09 Click
96726234..726245 attR    CTTTTTTATTAA 0.0 Click

Region 2, total : 70 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1823032..825344 PHAGE_Prochl_SSM4: base plate wedge component; PP_00882; phage(gi61806212) 1e-04 Click
2complement(825499..826128) endonuclease iii [Lactobacillus crispatus ST1] gi|295693029|ref|YP_003601639.1|; PP_00883 4e-115 Click
3complement(826131..826775) PHAGE_Strept_3: hypothetical protein SpyM3_1139; PP_00884; phage(gi28876309) 2e-09 Click
4complement(826854..828152) PHAGE_Acanth_moumouvirus: asparaginyl t-RNA synthetase; PP_00885; phage(gi441432571) 8e-45 Click
5complement(828206..828703) hypothetical protein LCRIS_01170 [Lactobacillus crispatus ST1] gi|295693032|ref|YP_003601642.1|; PP_00886 2e-90 Click
6complement(829167..829508) PHAGE_Lactob_Lj771: MazF-like protein; PP_00887; phage(gi163932202) 1e-48 Click
7complement(829538..829813) PHAGE_Lactob_Lj771: Maz-like protein; PP_00888; phage(gi163932201) 4e-42 Click
8complement(830561..831682) PHAGE_Lactob_AQ113: endolysin; PP_00889; phage(gi446730260) 3e-177 Click
9complement(831642..831794) hypothetical; PP_00890 0.0 Click
10complement(831781..832179) PHAGE_Lactob_AQ113: hypothetical protein; PP_00891; phage(gi446730259) 2e-16 Click
11complement(832179..832409) PHAGE_Lactob_AQ113: hypothetical protein; PP_00892; phage(gi446730258) 5e-20 Click
12complement(832393..832614) PHAGE_Lactob_AQ113: hypothetical protein; PP_00893; phage(gi446730257) 1e-06 Click
13complement(832625..833014) PHAGE_Lactob_1: holin; PP_00894; phage(gi219563212) 5e-14 Click
14complement(832983..833165) hypothetical; PP_00895 0.0 Click
15complement(833184..833810) PHAGE_Lactob_AQ113: phage related protein; PP_00896; phage(gi446730255) 5e-35 Click
16complement(833898..834290) hypothetical; PP_00897 0.0 Click
17complement(834287..834673) hypothetical; PP_00898 0.0 Click
18complement(834674..835042) hypothetical protein LA2_05880 [Lactobacillus amylovorus GRL 1112] gi|315038362|ref|YP_004031930.1|; PP_00899 2e-07 Click
19complement(835036..835515) hypothetical; PP_00900 0.0 Click
20complement(835535..837265) PHAGE_Lactob_phiadh: hypothetical protein phiadhp56; PP_00901; phage(gi9633056) 1e-26 Click
21complement(837498..838154) PHAGE_Erwini_phiEa104: hypothetical protein; PP_00902; phage(gi327198455) 2e-07 Click
22complement(838144..839325) PHAGE_Lister_B054: gp24; PP_00903; phage(gi157325308) 8e-55 Click
23complement(839315..839683) PHAGE_Lister_B054: gp23; PP_00904; phage(gi157325307) 1e-06 Click
24complement(839676..840149) hypothetical protein LA2_05840 [Lactobacillus amylovorus GRL 1112] gi|315038354|ref|YP_004031922.1|; PP_00905 3e-32 Click
25complement(840162..841289) PHAGE_Lister_B054: gp21; PP_00906; phage(gi157325305) 8e-19 Click
26complement(841289..841699) PHAGE_Lister_B054: gp20; PP_00907; phage(gi157325304) 8e-10 Click
27complement(841712..842665) PHAGE_Lister_B054: gp19; PP_00908; phage(gi157325303) 6e-12 Click
28complement(842683..846315) PHAGE_Strept_Sfi21: putative minor tail protein; PP_00909; phage(gi9632950) 3e-20 Click
29complement(846592..847023) PHAGE_Lister_B054: gp15; PP_00910; phage(gi157325299) 2e-12 Click
30complement(847042..848211) PHAGE_Lister_B054: gp14; PP_00911; phage(gi157325298) 1e-51 Click
31complement(848211..848729) hypothetical protein LA2_05795 [Lactobacillus amylovorus GRL 1112] gi|315038345|ref|YP_004031913.1|; PP_00912 6e-21 Click
32complement(848686..849141) hypothetical protein LA2_05790 [Lactobacillus amylovorus GRL 1112] gi|315038344|ref|YP_004031912.1|; PP_00913 4e-19 Click
33complement(849159..849596) PHAGE_Lister_B054: gp11; PP_00914; phage(gi157325295) 8e-11 Click
34complement(849596..849985) hypothetical protein LA2_05780 [Lactobacillus amylovorus GRL 1112] gi|315038342|ref|YP_004031910.1|; PP_00915 1e-09 Click
35complement(849987..851027) PHAGE_Lister_B054: gp8; PP_00916; phage(gi157325292) 4e-20 Click
36complement(851027..851593) PHAGE_Lister_B054: gp7; PP_00917; phage(gi157325291) 8e-12 Click
37complement(851593..852783) PHAGE_Lister_B054: gp6; PP_00918; phage(gi157325290) 8e-47 Click
38complement(852787..853173) hypothetical protein LA2_05760 [Lactobacillus amylovorus GRL 1112] gi|315038338|ref|YP_004031906.1|; PP_00919 9e-10 Click
39complement(853179..853979) PHAGE_Lister_B054: gp4; PP_00920; phage(gi157325288) 3e-30 Click
40complement(853963..854232) hypothetical; PP_00921 0.0 Click
41complement(854220..855383) PHAGE_Lister_B054: gp3; PP_00922; phage(gi157325287) 3e-47 Click
42complement(855399..856856) PHAGE_Lister_B054: TerL; PP_00923; phage(gi157325286) 3e-102 Click
43complement(856843..857340) hypothetical protein LAR_0785 [Lactobacillus reuteri JCM 1112] gi|184153440|ref|YP_001841781.1|; PP_00924 1e-11 Click
44complement(857410..857709) hypothetical; PP_00925 0.0 Click
45complement(857722..857886) PHAGE_Lactob_Lj771: hypothetical protein LJ771_027; PP_00926; phage(gi163932179) 2e-09 Click
46complement(857912..858085) PHAGE_Lactob_KC5a: putative transcriptional regulator; PP_00927; phage(gi90592604) 2e-22 Click
47complement(858069..858365) hypothetical; PP_00928 0.0 Click
48complement(858452..858628) hypothetical; PP_00929 0.0 Click
49complement(858628..858858) hypothetical; PP_00930 0.0 Click
50complement(859281..859351) tRNA 0.0 Click
51complement(859568..860089) PHAGE_Lactob_Lj771: hypothetical protein LJ771_025; PP_00931; phage(gi163932177) 1e-07 Click
52complement(860068..860262) PHAGE_Strept_PH10: hypothetical protein PH10_gp26; PP_00932; phage(gi238821343) 1e-05 Click
53complement(860555..860701) hypothetical; PP_00933 0.0 Click
54complement(860704..861081) PHAGE_Lactob_AQ113: phage protein-Restriction nuclease superfamily; PP_00934; phage(gi446730281) 2e-19 Click
55complement(861078..861479) hypothetical; PP_00935 0.0 Click
56complement(861587..861724) hypothetical; PP_00936 0.0 Click
57complement(861684..861959) PHAGE_Lactob_phiadh: hypothetical protein phiadhp26; PP_00937; phage(gi9633026) 1e-06 Click
58complement(862217..862405) hypothetical; PP_00938 0.0 Click
59complement(862451..862885) hypothetical; PP_00939 0.0 Click
60complement(862888..863700) PHAGE_Lactob_AQ113: DNA replication protein; PP_00940; phage(gi446730275) 1e-65 Click
61complement(863713..864567) PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp17; PP_00941; phage(gi215401187) 1e-36 Click
62complement(864570..865277) PHAGE_Lactob_KC5a: hypothetical protein; PP_00942; phage(gi90592586) 3e-47 Click
63complement(865537..865908) PHAGE_Lactob_AQ113: prophage protein; PP_00943; phage(gi446730271) 1e-51 Click
64complement(865959..866135) hypothetical protein LA2_05605 [Lactobacillus amylovorus GRL 1112] gi|315038307|ref|YP_004031875.1|; PP_00944 2e-06 Click
65complement(866143..866364) PHAGE_Strept_PH15: putative transcriptional repressor; PP_00945; phage(gi190151419) 8e-07 Click
66complement(866616..866906) hypothetical; PP_00946 0.0 Click
67866964..867626 hypothetical; PP_00947 0.0 Click
68complement(867750..867947) PHAGE_Lactob_phiadh: hypothetical protein phiadhp08; PP_00948; phage(gi9633008) 1e-06 Click
69complement(867959..868756) PHAGE_Lactob_KC5a: putative anti-repressor; PP_00949; phage(gi90592591) 2e-46 Click
70complement(868825..869412) DNA polymerase iii, delta subunit [Lactobacillus crispatus ST1] gi|295692722|ref|YP_003601332.1|; PP_00950 2e-93 Click
71complement(869409..871697) PHAGE_Clostr_st: metallo beta-lactamase family protein; PP_00951; phage(gi80159792) 2e-27 Click

Region 3, total : 35 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11307838..1308341 PHAGE_Lactob_1: ArpU-like protein; PP_01427; phage(gi219563240) 1e-13 Click
21309344..1309562 hypothetical; PP_01428 0.0 Click
31309609..1310181 PHAGE_Lactob_KC5a: putative phage terminase small subunit; PP_01429; phage(gi90592609) 2e-17 Click
41310178..1311650 PHAGE_Lister_B054: TerL; PP_01430; phage(gi157325286) 5e-116 Click
51311663..1313048 PHAGE_Lister_B054: gp3; PP_01431; phage(gi157325287) 8e-52 Click
61313161..1313838 PHAGE_Lister_B054: gp4; PP_01432; phage(gi157325288) 8e-25 Click
71313849..1314205 hypothetical protein LA2_05760 [Lactobacillus amylovorus GRL 1112] gi|315038338|ref|YP_004031906.1|; PP_01433 1e-32 Click
81314283..1315416 PHAGE_Lister_B054: gp6; PP_01434; phage(gi157325290) 2e-46 Click
91315416..1315952 PHAGE_Lister_B054: gp7; PP_01435; phage(gi157325291) 3e-12 Click
101315967..1316926 PHAGE_Lister_B054: gp8; PP_01436; phage(gi157325292) 2e-20 Click
111316943..1317329 PHAGE_Lister_B054: gp10; PP_01437; phage(gi157325294) 1e-06 Click
121317326..1317997 PHAGE_Lister_B054: gp11; PP_01438; phage(gi157325295) 2e-17 Click
131318007..1318426 hypothetical protein LA2_05790 [Lactobacillus amylovorus GRL 1112] gi|315038344|ref|YP_004031912.1|; PP_01439 5e-59 Click
141318389..1318949 hypothetical protein LA2_05795 [Lactobacillus amylovorus GRL 1112] gi|315038345|ref|YP_004031913.1|; PP_01440 1e-80 Click
151318953..1320287 PHAGE_Lister_B054: gp14; PP_01441; phage(gi157325298) 9e-52 Click
161320302..1320733 PHAGE_Lister_B054: gp15; PP_01442; phage(gi157325299) 1e-14 Click
171320792..1321238 hypothetical protein LA2_05810 [Lactobacillus amylovorus GRL 1112] gi|315038348|ref|YP_004031916.1|; PP_01443 3e-73 Click
181321342..1321455 hypothetical protein LA2_05815 [Lactobacillus amylovorus GRL 1112] gi|315038349|ref|YP_004031917.1|; PP_01444 1e-11 Click
191321501..1326978 PHAGE_Lactoc_bIL286: tail protein; PP_01445; phage(gi13095795) 2e-56 Click
201326996..1327949 PHAGE_Lister_B054: gp19; PP_01446; phage(gi157325303) 5e-12 Click
211327962..1328348 PHAGE_Lister_B054: gp20; PP_01447; phage(gi157325304) 7e-10 Click
221328371..1329498 PHAGE_Lister_B054: gp21; PP_01448; phage(gi157325305) 8e-19 Click
231329511..1329984 hypothetical protein LA2_05840 [Lactobacillus amylovorus GRL 1112] gi|315038354|ref|YP_004031922.1|; PP_01449 5e-32 Click
241329995..1330339 PHAGE_Lister_B054: gp23; PP_01450; phage(gi157325307) 2e-05 Click
251330336..1331517 PHAGE_Lister_B054: gp24; PP_01451; phage(gi157325308) 2e-56 Click
261331507..1332256 PHAGE_Erwini_phiEa104: hypothetical protein; PP_01452; phage(gi327198455) 2e-07 Click
271332273..1333085 PHAGE_Lactob_AQ113: hypothetical protein; PP_01453; phage(gi446730253) 2e-06 Click
281333202..1334257 PHAGE_Lactob_phiadh: hypothetical protein phiadhp56; PP_01454; phage(gi9633056) 6e-25 Click
291334630..1335022 hypothetical; PP_01455 0.0 Click
301335107..1335733 PHAGE_Lactob_AQ113: phage related protein; PP_01456; phage(gi446730255) 1e-35 Click
311335752..1335934 hypothetical; PP_01457 0.0 Click
321335903..1336292 PHAGE_Lactob_1: holin; PP_01458; phage(gi219563212) 8e-14 Click
331336506..1336736 PHAGE_Lactob_AQ113: hypothetical protein; PP_01459; phage(gi446730258) 1e-19 Click
341336736..1337134 PHAGE_Lactob_AQ113: hypothetical protein; PP_01460; phage(gi446730259) 4e-17 Click
351337227..1338348 PHAGE_Lactob_AQ113: endolysin; PP_01461; phage(gi446730260) 6e-179 Click

Region 4, total : 56 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12031906..2031950 attL    TATTAGGCACGAGTAACTTTACCAGACTTTAAAGCCTTGGTTGAA 0.0 Click
2complement(2032067..2033182) PHAGE_Lactob_LF1: phage integrase; PP_02143; phage(gi418489411) 1e-68 Click
3complement(2033332..2033859) hypothetical; PP_02144 0.0 Click
4complement(2033905..2034708) hypothetical protein lilo_0596 [Lactococcus lactis subsp. lactis IO-1] gi|459284818|ref|YP_007507923.1|; PP_02145 1e-17 Click
5complement(2034710..2035078) PHAGE_Staphy_phiETA3: repressor; PP_02146; phage(gi122891790) 1e-05 Click
62035312..2035524 PHAGE_Bacill_BCJA1c: repressor; PP_02147; phage(gi56694874) 4e-08 Click
72035525..2036322 PHAGE_Lactob_phiadh: hypothetical protein phiadhp07; PP_02148; phage(gi9633007) 5e-76 Click
82036392..2036691 PHAGE_Lactob_H: hypothetical protein; PP_02149; phage(gi148750868) 6e-10 Click
92036681..2036839 hypothetical; PP_02150 0.0 Click
102036932..2037264 hypothetical; PP_02151 0.0 Click
112037254..2037532 PHAGE_Lactob_phiadh: hypothetical protein phiadhp17; PP_02152; phage(gi9633017) 3e-05 Click
122037525..2037770 hypothetical; PP_02153 0.0 Click
132037770..2038444 PHAGE_Lactob_phiadh: NTP-binding motif protein; PP_02154; phage(gi9633018) 4e-104 Click
142038441..2038767 hypothetical; PP_02155 0.0 Click
152038773..2040116 PHAGE_Lactob_phiadh: putative DEAH-family helicase; PP_02156; phage(gi9633020) 4e-125 Click
162040279..2040392 hypothetical; PP_02157 0.0 Click
172040413..2040976 PHAGE_Lactob_phiadh: hypothetical protein phiadhp21; PP_02158; phage(gi9633021) 2e-25 Click
182040998..2041261 PHAGE_Staphy_vB_SepiS_phiIPLA5: hypothetical protein; PP_02159; phage(gi399528947) 2e-12 Click
192041239..2041514 PHAGE_Staphy_vB_SepiS_phiIPLA5: hypothetical protein; PP_02160; phage(gi399528948) 4e-13 Click
202041550..2041690 hypothetical; PP_02161 0.0 Click
212041683..2044007 PHAGE_Lactob_phiadh: putative DNA-polymerase or DNA-primase; PP_02162; phage(gi9633023) 0.0 Click
222044268..2044465 hypothetical; PP_02163 0.0 Click
232044462..2044641 hypothetical; PP_02164 0.0 Click
242044634..2044774 hypothetical; PP_02165 0.0 Click
25complement(2044767..2045624) putative transposase [Lactobacillus helveticus DPC 4571] gi|161507482|ref|YP_001577436.1|; PP_02166 8e-162 Click
262045806..2046198 PHAGE_Lactob_JCL1032: hypothetical protein; PP_02167; phage(gi418489168) 1e-13 Click
272046287..2046757 PHAGE_Lactob_AQ113: phage protein-Restriction nuclease superfamily; PP_02168; phage(gi446730281) 6e-38 Click
282046747..2046968 hypothetical; PP_02169 0.0 Click
292046970..2047506 PHAGE_Lactob_JCL1032: hypothetical protein; PP_02170; phage(gi418489169) 2e-06 Click
302047569..2048033 PHAGE_Lactob_phiadh: hypothetical protein phiadhp37; PP_02171; phage(gi9633037) 6e-16 Click
312048287..2048356 tRNA 0.0 Click
322049084..2049536 PHAGE_Lactob_phiadh: hypothetical protein phiadhp39; PP_02172; phage(gi9633039) 4e-59 Click
332049533..2049673 hypothetical; PP_02173 0.0 Click
342049793..2051691 PHAGE_Lactob_phiadh: hypothetical protein phiadhp40; PP_02174; phage(gi9633040) 0.0 Click
352051681..2051875 PHAGE_Lactob_Sha1: phage head-tail joining protein; PP_02175; phage(gi418489803) 5e-06 Click
362051878..2053062 PHAGE_Lactob_phiadh: hypothetical protein phiadhp41; PP_02176; phage(gi9633041) 7e-134 Click
372053022..2053732 PHAGE_Lactob_phiadh: ClpP-like protease; PP_02177; phage(gi9633042) 7e-76 Click
382053747..2055057 PHAGE_Lactob_phiadh: major head protein; PP_02178; phage(gi9633043) 6e-57 Click
392055078..2055437 PHAGE_Lactob_phiadh: hypothetical protein phiadhp44; PP_02179; phage(gi9633044) 5e-19 Click
402055403..2055753 PHAGE_Lactob_phiadh: hypothetical protein phiadhp45; PP_02180; phage(gi9633045) 4e-10 Click
412055746..2056186 PHAGE_Lactob_phiadh: hypothetical protein phiadhp46; PP_02181; phage(gi9633046) 6e-30 Click
422056183..2056572 PHAGE_Lactob_1: head-tail joining protein; PP_02182; phage(gi219563204) 6e-09 Click
432056554..2057258 PHAGE_Lactob_phiadh: major tail protein; PP_02183; phage(gi9633048) 2e-28 Click
442057358..2057702 PHAGE_Lactoc_lato: putative tail component; PP_02184; phage(gi30089902) 5e-06 Click
452057695..2057916 PHAGE_Lactob_phiadh: hypothetical protein phiadhp50; PP_02185; phage(gi9633050) 5e-05 Click
462057920..2064078 PHAGE_Strept_DT1: putative tail component protein; PP_02186; phage(gi29165636) 4e-92 Click
472064062..2064841 PHAGE_Lactob_phiadh: hypothetical protein phiadhp53; PP_02187; phage(gi9633053) 4e-24 Click
482064841..2068167 PHAGE_Lactob_phiadh: hypothetical protein phiadhp55; PP_02188; phage(gi9633055) 2e-38 Click
492068170..2068355 hypothetical; PP_02189 0.0 Click
502068369..2069958 PHAGE_Lactob_phiadh: hypothetical protein phiadhp56; PP_02190; phage(gi9633056) 7e-23 Click
512069976..2070443 hypothetical; PP_02191 0.0 Click
522070564..2071355 PHAGE_Strept_Abc2: host specificity protein; PP_02192; phage(gi281416401) 6e-17 Click
532071459..2071911 PHAGE_Lactob_phiadh: hypothetical protein phiadhp57; PP_02193; phage(gi9633057) 1e-08 Click
542071911..2072060 hypothetical; PP_02194 0.0 Click
552072032..2072448 PHAGE_Lactob_phiadh: hypothetical protein phiadhp59; PP_02195; phage(gi9633059) 8e-08 Click
562072464..2072691 hypothetical; PP_02196 0.0 Click
572072681..2073076 PHAGE_Lactob_Lj928: putative holin; PP_02197; phage(gi41179336) 2e-34 Click
582073069..2073923 PHAGE_Lactob_phiadh: lysin; PP_02198; phage(gi9633062) 1e-17 Click
592075167..2075211 attR    TATTAGGCACGAGTAACTTTACCAGACTTTAAAGCCTTGGTTGAA 0.0 Click