Mycobacterium tuberculosis SUMu010 .1, whole genome shotgun [asmbl_id: NC_000000].4352987, GC%: 65.34%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(804355..805128) PHAGE_Ectoca_1: EsV-1-65; TMJG_02706; phage(gi13242537) 1e-06 Click
2complement(805310..805801) transposase; TMJG_02707 0.0 Click
3complement(805767..806453) PHAGE_Burkho_KS9: tail length tape measure protein gp13; TMJG_02708; phage(gi255033744) 4e-05 Click
4complement(806487..806825) transposase; TMJG_02709 0.0 Click
5complement(806936..807220) esat-6 like protein esxI; TMJG_02710 0.0 Click
6complement(807247..807374) hypothetical protein; TMJG_02711 0.0 Click
7complement(807470..807766) esat-6 like protein esxJ; TMJG_02712 0.0 Click
8complement(807912..809087) PHAGE_Pectob_My1: YadA domain-containing protein; TMJG_02713; phage(gi410491156) 2e-08 Click
9complement(809164..809991) PHAGE_Cronob_vB_CsaP_GAP52: hypothetical protein; TMJG_02714; phage(gi414087485) 5e-07 Click
10complement(811187..811624) PROPHAGE_Brucel_1330: ISBm1, transposase orfB; TMJG_02715; phage(gi23501425) 1e-10 Click
11complement(811659..811998) PROPHAGE_Shewan_MR-1: ISSod6, transposase; TMJG_02716; phage(gi24374783) 4e-16 Click

Region 2, total : 20 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12603946..2603966 attL    CCGCGCAATAAACGCGCAATA 0.0 Click
22604545..2605432 PHAGE_Mycoba_Brujita: gp33; TMJG_01630; phage(gi206599577) 2e-18 Click
32605446..2605910 PHAGE_Staphy_EW: ORF013; TMJG_01631; phage(gi66395820) 5e-10 Click
42606043..2606369 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; TMJG_01632; phage(gi157166066) 8e-20 Click
5complement(2606366..2606462) hypothetical protein; TMJG_01633 0.0 Click
6complement(2607270..2608709) PHAGE_Mycoba_Brujita: gp7; TMJG_01635; phage(gi206599551) 9e-64 Click
7complement(2608717..2609277) PHAGE_Marino_P12026: phage prohead protease; TMJG_01636; phage(gi399528321) 1e-11 Click
8complement(2609403..2609903) PHAGE_Nocard_NBR1: terminase small subunit; TMJG_01637; phage(gi372217587) 3e-15 Click
9complement(2610061..2610525) hypothetical protein; TMJG_01638 0.0 Click
10complement(2610526..2611918) phiRv2 phage protein; TMJG_01639 0.0 Click
11complement(2611920..2612312) phiRv2 phage protein; TMJG_01640 0.0 Click
12complement(2612309..2612506) PHAGE_Mycoba_Ramsey: gp43; TMJG_01641; phage(gi206600224) 2e-09 Click
13complement(2612586..2612951) phiRv2 phage protein; TMJG_01642 0.0 Click
14complement(2612951..2614078) PHAGE_Mycoba_SWU1: integrase; TMJG_01643; phage(gi388570553) 2e-57 Click
152614093..2614113 attR    CCGCGCAATAAACGCGCAATA 0.0 Click
16complement(2614223..2614450) hypothetical protein; TMJG_01644 0.0 Click
17complement(2614447..2614836) hypothetical protein; TMJG_01645 0.0 Click
182615113..2615346 hypothetical protein; TMJG_01646 0.0 Click
192615357..2615611 hypothetical protein; TMJG_01647 0.0 Click
202616268..2616583 hypothetical protein; TMJG_01648 0.0 Click
212616584..2617042 PROPHAGE_Escher_CFT073: transposase; TMJG_01649; phage(gi26246249) 3e-13 Click
222617064..2617822 PHAGE_Mycoba_Myrna: gp251; TMJG_01650; phage(gi203454812) 4e-18 Click