Clostridium difficile 6407 , whole genome shotgun sequence. [asmbl_id: NC_000000].3264754, GC%: 28.58%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(29245..29562) PHAGE_Clostr_phiCD27: endolysin; PP_00053; phage(gi209901271) 6e-10 Click
2complement(30077..30517) PHAGE_Bacill_36: low copy number virion structural protein; PP_00054; phage(gi156564190) 3e-10 Click
3complement(30715..30828) immunoreactive 47 kDa antigen [Porphyromonas asaccharolytica DSM 20707] gi|332300234|ref|YP_004442155.1|; PP_00055 7e-05 Click
4complement(30810..31094) PHAGE_Amsact_: Possible surface protein; PP_00056; phage(gi9964319) 2e-09 Click
5complement(31151..31987) PHAGE_Melano_entomopoxvirus: ORF MSV251 hypothetical protein containing C3H2C3 RING finger; PP_00057; phage(gi9631414) 3e-16 Click
6complement(32199..32381) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp28; PP_00058; phage(gi209901265) 3e-28 Click
7complement(32381..32539) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp27; PP_00059; phage(gi209901264) 2e-19 Click
8complement(32640..33251) PHAGE_Clostr_phiC2: putative tail fiber protein; PP_00060; phage(gi134287361) 6e-93 Click
9complement(33263..33880) PHAGE_Clostr_phiC2: hypothetical protein phiC2p26; PP_00061; phage(gi134287360) 6e-114 Click
10complement(33873..34223) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp22; PP_00062; phage(gi209901259) 1e-08 Click
11complement(34251..34574) PHAGE_Strept_1: tail protein; PP_00063; phage(gi39653735) 3e-20 Click
12complement(34655..34840) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp26; PP_00064; phage(gi209901263) 3e-14 Click
1334871..35542 PHAGE_Clostr_phiC2: putative hydrolase; PP_00065; phage(gi134287357) 2e-87 Click
14complement(35498..35707) phage protein [Clostridium difficile R20291] gi|260686817|ref|YP_003217950.1|; PP_00066 2e-30 Click
15complement(35777..35971) PHAGE_Clostr_phiC2: hypothetical protein phiC2p23; PP_00067; phage(gi134287358) 2e-23 Click
16complement(36025..37122) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp26; PP_00068; phage(gi209901263) 4e-22 Click
17complement(37135..37284) hypothetical protein CDR20291_1457 [Clostridium difficile R20291] gi|260686821|ref|YP_003217954.1|; PP_00069 3e-05 Click
18complement(37301..37441) PHAGE_Clostr_phiCD27: putative tail fiber protein; PP_00070; phage(gi209901262) 5e-06 Click
1937594..38052 exonuclease subunit C [Clostridium difficile R20291] gi|260686266|ref|YP_003217399.1|; PP_00071 7e-76 Click
2038094..38225 exonuclease subunit C [Clostridium difficile R20291] gi|260686266|ref|YP_003217399.1|; PP_00072 2e-15 Click
2138479..39594 PHAGE_Clostr_phiCD27: holin; PP_00073; phage(gi209901270) 9e-24 Click
2239594..40352 PHAGE_Clostr_phiCD27: endolysin; PP_00074; phage(gi209901271) 2e-44 Click
2340448..40795 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp35; PP_00075; phage(gi209901272) 9e-61 Click
2440962..41480 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp36; PP_00076; phage(gi209901273) 3e-92 Click
25complement(41544..42947) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp37; PP_00077; phage(gi209901274) 0.0 Click
26complement(42950..43111) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp37; PP_00078; phage(gi209901274) 2e-13 Click
27complement(43105..43362) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp38; PP_00079; phage(gi209901275) 1e-46 Click
28complement(43346..43627) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp38; PP_00080; phage(gi209901275) 3e-44 Click
29complement(44332..44520) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp40; PP_00081; phage(gi209901277) 5e-33 Click
30complement(44706..45140) oxygen-independent coproporphyrinogen III oxidase [Clostridium difficile R20291] gi|260687705|ref|YP_003218839.1|; PP_00082 5e-77 Click
3145664..45825 hypothetical protein CDR20291_2194 [Clostridium difficile R20291] gi|260687545|ref|YP_003218679.1|; PP_00083 1e-21 Click
3245827..46027 PHAGE_Lactoc_phiLC3: phage repressor; PP_00084; phage(gi45597387) 2e-05 Click

Region 2, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(106432..107412) PROPHAGE_Escher_Sakai: ATP-dependent protease ATP-binding subunit HslU; PP_00185; phage(gi15834112) 3e-17 Click
2complement(107520..108017) PHAGE_Gifsy_2: bacteriophage Clp protease involved in capsid processing; PP_00186; phage(gi169257302) 4e-11 Click
3complement(108167..109045) trigger factor [Clostridium difficile R20291] gi|260688508|ref|YP_003219642.1|; PP_00187 2e-151 Click
4complement(109807..109920) phosphoesterase [Clostridium difficile R20291] gi|260688509|ref|YP_003219643.1|; PP_00188 1e-06 Click
5complement(109898..110116) phosphoesterase [Clostridium difficile R20291] gi|260688509|ref|YP_003219643.1|; PP_00189 2e-34 Click
6complement(110235..110396) ribonuclease Ph [Clostridium difficile R20291] gi|260688510|ref|YP_003219644.1|; PP_00190 1e-17 Click
7complement(110402..111463) PHAGE_Yersin_phiR1_37: non-canonical purine NTP pyrophosphatase; PP_00191; phage(gi358356583) 3e-05 Click
8complement(111623..112459) PHAGE_Clostr_st: putative NAD-dependent DNA ligase; PP_00192; phage(gi80159718) 2e-39 Click
9complement(112551..112811) PHAGE_Pseudo_1: putative DNA ligase; PP_00193; phage(gi189490484) 2e-16 Click
10complement(112897..113181) PHAGE_Pseudo_1: putative DNA ligase; PP_00194; phage(gi189490484) 3e-08 Click
11complement(113236..113538) PHAGE_Pseudo_1: putative DNA ligase; PP_00195; phage(gi189490484) 9e-08 Click
12113851..114258 glutamate racemase [Clostridium difficile R20291] gi|260688740|ref|YP_003219874.1|; PP_00196 6e-69 Click
13114307..114678 PHAGE_Acanth_moumouvirus: collagen repeat protein with BclB C-terminal domain; PP_00197; phage(gi441432033) 2e-07 Click
14114933..115550 hypothetical protein CDR20291_3192 [Clostridium difficile R20291] gi|260688534|ref|YP_003219668.1|; PP_00198 3e-113 Click
15116009..116428 bifunctional acetyl-CoA decarbonylase/synthase complex subunit alpha/beta [Clostridium difficile R20291] gi|260686024|ref|YP_003217157.1|; PP_00199 2e-74 Click
16116398..116946 bifunctional acetyl-CoA decarbonylase/synthase complex subunit alpha/beta [Clostridium difficile R20291] gi|260686024|ref|YP_003217157.1|; PP_00200 2e-100 Click
17117035..117412 glycine cleavage system protein H [Clostridium difficile R20291] gi|260686025|ref|YP_003217158.1|; PP_00201 7e-66 Click
18117524..117880 PHAGE_Prochl_Syn33: ferredoxin; PP_00202; phage(gi326783336) 3e-06 Click

Region 3, total : 54 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1133781..133794 attL    AGGAGAATCAAAAT 0.0 Click
2147552..148487 PHAGE_Clostr_phiCD27: putative phage tail tape measure protein; PP_00254; phage(gi209901253) 6e-47 Click
3148569..149183 PHAGE_Clostr_phiMMP02: tail tape measure; PP_00255; phage(gi414090382) 9e-100 Click
4149164..150405 PHAGE_Clostr_phiCD27: putative phage tail tape measure protein; PP_00256; phage(gi209901253) 6e-43 Click
5150574..151230 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp17; PP_00257; phage(gi209901254) 2e-05 Click
6151299..151937 PHAGE_Clostr_phiCD27: putative peptidoglycan-binding LysM; PP_00258; phage(gi209901255) 5e-112 Click
7151968..152930 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp19; PP_00259; phage(gi209901256) 5e-177 Click
8152923..153288 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp20; PP_00260; phage(gi209901257) 6e-58 Click
9153333..153644 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp21; PP_00261; phage(gi209901258) 4e-50 Click
10complement(153860..154396) hypothetical protein CDR20291_1429 [Clostridium difficile R20291] gi|260686793|ref|YP_003217926.1|; PP_00262 4e-81 Click
11complement(154362..154544) hypothetical protein CDR20291_1429 [Clostridium difficile R20291] gi|260686793|ref|YP_003217926.1|; PP_00263 1e-27 Click
12154587..156386 phenylalanyl-tRNA synthetase subunit beta [Clostridium difficile R20291] gi|260685996|ref|YP_003217129.1|; PP_00264 0.0 Click
13complement(156525..157256) recombination factor protein RarA [Clostridium difficile R20291] gi|260686481|ref|YP_003217614.1|; PP_00265 6e-120 Click
14157614..158228 thiamine biosynthesis protein ThiC [Clostridium difficile R20291] gi|260686962|ref|YP_003218095.1|; PP_00266 4e-112 Click
15complement(158555..159220) hypothetical protein CDR20291_1221 [Clostridium difficile R20291] gi|260686586|ref|YP_003217719.1|; PP_00267 7e-58 Click
16159488..159793 cell wall hydrolase [Clostridium difficile R20291] gi|260685560|ref|YP_003216693.1|; PP_00268 2e-45 Click
17159882..160148 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp05; PP_00269; phage(gi209901242) 3e-44 Click
18160164..160547 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp06; PP_00270; phage(gi209901243) 3e-68 Click
19160566..161438 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp07; PP_00271; phage(gi209901244) 2e-157 Click
20161435..161602 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp07; PP_00272; phage(gi209901244) 2e-25 Click
21161642..161980 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp08; PP_00273; phage(gi209901245) 4e-60 Click
22161977..162354 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp09; PP_00274; phage(gi209901246) 4e-67 Click
23162408..162767 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp10; PP_00275; phage(gi209901247) 3e-66 Click
24162768..163589 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp11; PP_00276; phage(gi209901248) 2e-156 Click
25163602..163772 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp12; PP_00277; phage(gi209901249) 2e-20 Click
26163991..164776 transcriptional repressor CodY [Clostridium difficile R20291] gi|260686480|ref|YP_003217613.1|; PP_00278 8e-139 Click
27complement(164785..164958) PHAGE_Clostr_phiCD27: putative terminase small subunit; PP_00279; phage(gi209901238) 8e-20 Click
28complement(165140..165319) PHAGE_Clostr_phiCD27: putative terminase small subunit; PP_00280; phage(gi209901238) 2e-06 Click
29complement(165379..166011) hypothetical; PP_00281 0.0 Click
30complement(166441..166734) PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; PP_00282; phage(gi209901309) 2e-48 Click
31complement(166800..167300) PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; PP_00283; phage(gi209901309) 2e-69 Click
32complement(167390..167581) PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; PP_00284; phage(gi209901309) 1e-19 Click
33167736..168113 shikimate 5-dehydrogenase [Clostridium difficile R20291] gi|260687941|ref|YP_003219075.1|; PP_00285 5e-50 Click
34168368..168613 hypothetical protein Cbei_2847 [Clostridium beijerinckii NCIMB 8052] gi|150017697|ref|YP_001309951.1|; PP_00286 5e-07 Click
35168679..168897 hypothetical protein CDR20291_1270 [Clostridium difficile R20291] gi|260686635|ref|YP_003217768.1|; PP_00287 2e-15 Click
36169229..169549 PHAGE_Clostr_phiCD27: putative terminase small subunit; PP_00288; phage(gi209901238) 2e-52 Click
37169542..170951 PHAGE_Clostr_phiCD27: putative terminase B; PP_00289; phage(gi209901239) 0.0 Click
38170942..171547 PHAGE_Clostr_phiCD27: putative portal protein; PP_00290; phage(gi209901240) 4e-70 Click
39complement(171519..171665) PHAGE_Clostr_phiC2: putative main capsid protein; PP_00291; phage(gi134287342) 4e-18 Click
40complement(172054..172239) PHAGE_Clostr_phiC2: putative scaffold protein; PP_00292; phage(gi134287341) 5e-26 Click
41complement(172284..172478) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp07; PP_00293; phage(gi90592644) 2e-27 Click
42complement(172550..172780) hypothetical; PP_00294 0.0 Click
43complement(172758..173114) hypothetical protein M013TW_1264 [Staphylococcus aureus subsp. aureus M013] gi|379021033|ref|YP_005297695.1|; PP_00295 1e-09 Click
44173420..173581 PHAGE_Strept_SM1: gp36; PP_00296; phage(gi32469467) 9e-13 Click
45complement(173544..174347) amino acid permease [Clostridium difficile R20291] gi|260688273|ref|YP_003219407.1|; PP_00297 1e-133 Click
46174722..175177 tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase [Clostridium difficile R20291] gi|260686486|ref|YP_003217619.1|; PP_00298 1e-77 Click
47complement(175598..176065) conjugative transposon protein [Clostridium difficile R20291] gi|260688803|ref|YP_003219937.1|; PP_00299 2e-30 Click
48complement(176363..177004) chloramphenicol o-acetyltransferase [Clostridium difficile R20291] gi|260688802|ref|YP_003219936.1|; PP_00300 1e-115 Click
49complement(177435..177569) hypothetical protein SGPB_1616 [Streptococcus pasteurianus ATCC 43144] gi|336064868|ref|YP_004559727.1|; PP_00301 1e-15 Click
50complement(177582..177722) conjugative transposon replication initiation factor [Clostridium difficile R20291] gi|260688800|ref|YP_003219934.1|; PP_00302 1e-07 Click
51178277..178429 hypothetical; PP_00303 0.0 Click
52178778..178993 ferredoxin [Clostridium difficile R20291] gi|260685491|ref|YP_003216624.1|; PP_00304 2e-35 Click
53179022..180116 2-ketoisovalerate ferredoxin reductase [Clostridium difficile R20291] gi|260685492|ref|YP_003216625.1|; PP_00305 0.0 Click
54180100..180852 subunit of oxidoreductase [Clostridium difficile R20291] gi|260685493|ref|YP_003216626.1|; PP_00306 2e-129 Click
55180853..181143 subunit of oxidoreductase [Clostridium difficile R20291] gi|260685494|ref|YP_003216627.1|; PP_00307 3e-45 Click
56181106..181411 subunit of oxidoreductase [Clostridium difficile R20291] gi|260685494|ref|YP_003216627.1|; PP_00308 2e-46 Click
57181566..181579 attR    AGGAGAATCAAAAT 0.0 Click
58181943..182209 PHAGE_Clostr_phiC2: putative integrase; PP_00309; phage(gi134287379) 3e-26 Click

Region 4, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1569063..569428 PHAGE_Entero_phiEf11: conserved hypothetical protein; PP_00983; phage(gi282598728) 3e-05 Click
2complement(569739..569873) PHAGE_Clostr_phiC2: hypothetical protein phiC2p80; PP_00984; phage(gi134287412) 3e-19 Click
3complement(570370..571218) PHAGE_Clostr_phiCD27: putative antirepressor; PP_00985; phage(gi209901306) 2e-158 Click
4complement(571320..571667) PHAGE_Clostr_phiMMP02: RusA endonuclease; PP_00986; phage(gi414090438) 2e-31 Click
5complement(571709..571837) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp67; PP_00987; phage(gi209901304) 6e-17 Click
6complement(571853..572194) PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp66; PP_00988; phage(gi209901303) 1e-61 Click
7complement(572817..572981) hypothetical protein CDR20291_0944 [Clostridium difficile R20291] gi|260686310|ref|YP_003217443.1|; PP_00989 2e-19 Click
8complement(573767..573979) PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; PP_00990; phage(gi209901309) 8e-28 Click
9complement(574024..574413) hypothetical protein SOR_0094 [Streptococcus oralis Uo5] gi|331265523|ref|YP_004325153.1|; PP_00991 8e-29 Click
10574599..574922 PHAGE_Clostr_phiMMP02: DNA-cytosine methyltransferase; PP_00992; phage(gi414090431) 9e-58 Click
11575223..575699 PHAGE_Burkho_phi1026b: gp47; PP_00993; phage(gi38707937) 2e-07 Click
12575717..575938 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00994; phage(gi414090432) 1e-16 Click
13575935..576222 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00995; phage(gi414090433) 1e-46 Click
14complement(576488..576652) hypothetical protein [Clostridium difficile BI1] gi|384359027|ref|YP_006196882.1|; PP_00996 1e-05 Click
15complement(576645..576770) PHAGE_Clostr_phiMMP02: hypothetical protein; PP_00997; phage(gi414090429) 1e-07 Click
16complement(576767..577006) hypothetical; PP_00998 0.0 Click
17complement(577006..577179) PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp58; PP_00999; phage(gi90592694) 1e-29 Click
18complement(577211..577405) hypothetical; PP_01000 0.0 Click
19complement(577428..577580) PHAGE_Clostr_phiMMP02: hypothetical protein; PP_01001; phage(gi414090428) 7e-15 Click
20complement(577740..577904) PHAGE_Clostr_phiMMP02: hypothetical protein; PP_01002; phage(gi414090427) 3e-09 Click
21complement(577923..578174) PHAGE_Clostr_phiMMP02: hypothetical protein; PP_01003; phage(gi414090426) 2e-35 Click
22complement(578177..578293) PHAGE_Clostr_phiMMP02: YopX; PP_01004; phage(gi414090425) 4e-14 Click

Region 5, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1765728..765740 attL    AAATTAAAAGATT 0.0 Click
2766030..767307 PHAGE_Bacill_Gamma: site-specific recombinase; PP_01327; phage(gi77020163) 3e-35 Click
3767336..768052 cation transport protein [Clostridium difficile R20291] gi|260685992|ref|YP_003217125.1|; PP_01328 3e-119 Click
4768338..768484 cation transport protein [Clostridium difficile R20291] gi|260685993|ref|YP_003217126.1|; PP_01329 9e-18 Click
5768484..768618 cation transport protein [Clostridium difficile R20291] gi|260685993|ref|YP_003217126.1|; PP_01330 2e-15 Click
6768747..770090 D-ornithine aminomutase E component [Clostridium difficile R20291] gi|260685763|ref|YP_003216896.1|; PP_01331 0.0 Click
7770090..770992 component of D-ornithine aminomutase [Clostridium difficile R20291] gi|260685764|ref|YP_003216897.1|; PP_01332 1e-165 Click
8771007..771462 component of D-ornithine aminomutase [Clostridium difficile R20291] gi|260685764|ref|YP_003216897.1|; PP_01333 8e-77 Click
9771482..771658 amino acid racemase [Clostridium difficile R20291] gi|260685765|ref|YP_003216898.1|; PP_01334 1e-08 Click
10771880..772173 hypothetical protein CLH_2482 [Clostridium botulinum E3 str. Alaska E43] gi|188587908|ref|YP_001921863.1|; PP_01335 3e-14 Click
11772200..772412 hypothetical; PP_01336 0.0 Click
12772592..772747 hypothetical protein CLH_2483 [Clostridium botulinum E3 str. Alaska E43] gi|188588818|ref|YP_001921864.1|; PP_01337 4e-05 Click
13772822..773040 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp13; PP_01338; phage(gi90592649) 1e-08 Click
14773045..773764 PHAGE_Clostr_CD119: XkdK protein; PP_01339; phage(gi90592650) 1e-54 Click
15773808..773927 PHAGE_Clostr_CD119: XkdK protein; PP_01340; phage(gi90592650) 4e-05 Click
16774122..774550 PHAGE_Clostr_CD119: XkdM protein; PP_01341; phage(gi90592651) 8e-32 Click
17774676..775122 PHAGE_Clostr_CD119: XkdN protein; PP_01342; phage(gi90592652) 4e-15 Click
18complement(775293..775595) hypothetical protein CDR20291_1642 [Clostridium difficile R20291] gi|260687004|ref|YP_003218137.1|; PP_01343 5e-46 Click
19complement(775667..775939) adenosine deaminase [Clostridium difficile R20291] gi|260687003|ref|YP_003218136.1|; PP_01344 1e-44 Click
20complement(775894..776037) adenosine deaminase [Clostridium difficile R20291] gi|260687003|ref|YP_003218136.1|; PP_01345 1e-10 Click
21776068..776340 ABC transporter permease [Clostridium difficile R20291] gi|260687230|ref|YP_003218364.1|; PP_01346 7e-42 Click
22complement(776589..777197) PHAGE_Entero_2008: putative 2-component sensor protein YehU; PP_01347; phage(gi209427798) 6e-19 Click
23782261..782273 attR    AAATTAAAAGATT 0.0 Click

Region 6, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12858029..2858637 PHAGE_Cafete_BV_PW1: putative exodeoxyribonuclease VII large subunit; PP_05349; phage(gi310831037) 3e-12 Click
22858639..2858824 exodeoxyribonuclease VII small subunit [Clostridium difficile R20291] gi|260686408|ref|YP_003217541.1|; PP_05350 3e-24 Click
32858961..2859377 PHAGE_Africa_virus: prenyltransferase; PP_05351; phage(gi9628182) 3e-06 Click
42859389..2859742 geranyltranstransferase [Clostridium difficile R20291] gi|260686409|ref|YP_003217542.1|; PP_05352 1e-59 Click
52859772..2859936 hypothetical protein CDR20291_1044 [Clostridium difficile R20291] gi|260686410|ref|YP_003217543.1|; PP_05353 2e-20 Click
62860147..2860401 ABC transporter ATP-binding protein [Clostridium difficile R20291] gi|260686617|ref|YP_003217750.1|; PP_05354 4e-35 Click
72860690..2860824 ABC transporter ATP-binding protein [Clostridium difficile R20291] gi|260686617|ref|YP_003217750.1|; PP_05355 6e-11 Click
82860821..2861078 PHAGE_Parame_FR483: hypothetical protein FR483_N733R; PP_05356; phage(gi155370831) 3e-11 Click
92861050..2861259 ABC transporter ATP-binding protein [Clostridium difficile R20291] gi|260686617|ref|YP_003217750.1|; PP_05357 2e-24 Click
102861481..2861627 ATP-dependent DNA helicase [Clostridium difficile R20291] gi|260685708|ref|YP_003216841.1|; PP_05358 9e-10 Click
11complement(2861624..2862001) transcriptional regulator [Clostridium difficile R20291] gi|260685401|ref|YP_003216534.1|; PP_05359 1e-58 Click
122862277..2863035 PHAGE_Clostr_phiC2: putative sheath tail protein; PP_05360; phage(gi134287348) 8e-136 Click
132863056..2863208 PHAGE_Clostr_phiC2: putative core tail; PP_05361; phage(gi134287349) 3e-12 Click
142863196..2863531 PHAGE_Clostr_phiC2: putative core tail; PP_05362; phage(gi134287349) 3e-57 Click
152863585..2863842 PHAGE_Clostr_phiC2: hypothetical protein phiC2p15; PP_05363; phage(gi134287350) 5e-42 Click
162863906..2864286 PHAGE_Clostr_phiC2: hypothetical protein phiC2p16; PP_05364; phage(gi134287351) 3e-68 Click
172865143..2865454 AraC family transcriptional regulator [Clostridium difficile R20291] gi|260685397|ref|YP_003216530.1|; PP_05365 5e-50 Click
182865912..2866274 PHAGE_Clostr_phiMMP02: hypothetical protein; PP_05366; phage(gi414090391) 5e-18 Click
192866268..2866507 PHAGE_Clostr_phiC2: putative LysM; PP_05367; phage(gi134287356) 7e-27 Click
202866500..2866895 PHAGE_Clostr_phiC2: putative hydrolase; PP_05368; phage(gi134287357) 4e-08 Click
212866885..2867439 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp26; PP_05369; phage(gi209901263) 3e-97 Click
22complement(2867787..2868080) PHAGE_Clostr_phiC2: hypothetical protein phiC2p29; PP_05370; phage(gi134287362) 1e-28 Click
23complement(2868094..2868243) PHAGE_Clostr_phiCD6356: hypothetical protein; PP_05371; phage(gi326536869) 1e-06 Click
24complement(2868299..2868844) PHAGE_Bacill_BCP78: putative RNA polymerase sigma 28 subunit SigF; PP_05372; phage(gi410492877) 3e-09 Click
252869020..2869178 hypothetical; PP_05373 0.0 Click
26complement(2869214..2869435) hypothetical; PP_05374 0.0 Click
27complement(2869437..2869550) hypothetical; PP_05375 0.0 Click
282869513..2870292 PHAGE_Cafete_BV_PW1: putative Lon protease; PP_05376; phage(gi310831025) 1e-07 Click

Region 7, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13230303..3230357 attL    TAGCGCTGATGGTACTTGGTGGGAAACTGCCTGGGAGAGTAGGACGTAGCCACGT 0.0 Click
2complement(3232262..3232801) PHAGE_Clostr_phi3626: Gp34 protein; PP_06078; phage(gi20065997) 8e-19 Click
33232877..3233053 hypothetical; PP_06079 0.0 Click
4complement(3233126..3233584) hypothetical protein LCRIS_01650 [Lactobacillus crispatus ST1] gi|295693512|ref|YP_003602122.1|; PP_06080 1e-28 Click
53235586..3235753 PHAGE_Clostr_phiC2: putative sheath tail protein; PP_06081; phage(gi134287348) 5e-20 Click
6complement(3235883..3236263) PHAGE_Clostr_phiC2: putative tail fiber protein; PP_06082; phage(gi134287361) 5e-59 Click
7complement(3236223..3236372) PHAGE_Clostr_phiC2: putative terminase large subunit; PP_06083; phage(gi134287337) 5e-16 Click
8complement(3236379..3236561) PHAGE_Clostr_phiC2: putative terminase large subunit; PP_06084; phage(gi134287337) 1e-27 Click
9complement(3236540..3236884) PHAGE_Clostr_phiC2: putative terminase large subunit; PP_06085; phage(gi134287337) 5e-48 Click
10complement(3236868..3237011) PHAGE_Clostr_phiC2: putative terminase large subunit; PP_06086; phage(gi134287337) 3e-22 Click
113237410..3238117 PHAGE_Strept_1: portal protein; PP_06087; phage(gi39653714) 3e-08 Click
123238101..3238244 hydantoinase [Clostridium difficile R20291] gi|260686979|ref|YP_003218112.1|; PP_06088 5e-19 Click
133238217..3238624 hydantoinase [Clostridium difficile R20291] gi|260686979|ref|YP_003218112.1|; PP_06089 5e-66 Click
143238881..3239036 toxin A [Clostridium difficile R20291] gi|260685955|ref|YP_003217088.1|; PP_06090 6e-20 Click
15complement(3239105..3239180) tRNA 0.0 Click
16complement(3239693..3239977) PHAGE_Clostr_phiMMP02: baseplate J family protein; PP_06091; phage(gi414090388) 3e-40 Click
17complement(3239946..3240359) PHAGE_Clostr_phiC2: putative head morphogenesis protein; PP_06092; phage(gi134287339) 7e-68 Click
18complement(3240456..3240896) PHAGE_Clostr_phiC2: putative portal protein; PP_06093; phage(gi134287338) 9e-80 Click
19complement(3241178..3241291) PHAGE_Clostr_phiC2: putative portal protein; PP_06094; phage(gi134287338) 5e-09 Click
20complement(3241288..3241629) PHAGE_Clostr_phiC2: putative portal protein; PP_06095; phage(gi134287338) 2e-61 Click
213241810..3242895 PHAGE_Clostr_phiC2: putative sheath tail protein; PP_06096; phage(gi134287348) 1e-170 Click
22complement(3242892..3243005) hypothetical; PP_06097 0.0 Click
23complement(3243169..3243369) hypothetical protein CDR20291_0561 [Clostridium difficile R20291] gi|260685932|ref|YP_003217065.1|; PP_06098 3e-07 Click
24complement(3243594..3243678) tRNA 0.0 Click
25complement(3243694..3243768) tRNA 0.0 Click
26complement(3243778..3243853) tRNA 0.0 Click
27complement(3243859..3243934) tRNA 0.0 Click
283243908..3244021 hypothetical; PP_06099 0.0 Click
29complement(3243940..3244013) tRNA 0.0 Click
30complement(3243993..3244355) PHAGE_Clostr_phiC2: putative tail fiber protein; PP_06100; phage(gi134287361) 6e-15 Click
313244336..3244503 hypothetical; PP_06101 0.0 Click
32complement(3244656..3244958) PHAGE_Clostr_CD119: putative integrase; PP_06102; phage(gi90592679) 2e-14 Click
33complement(3245012..3245137) hypothetical; PP_06103 0.0 Click
34complement(3245116..3245574) PHAGE_Clostr_phiC2: hypothetical protein phiC2p25; PP_06104; phage(gi134287359) 5e-74 Click
353245740..3245919 PHAGE_Clostr_phiC2: putative head morphogenesis protein; PP_06105; phage(gi134287339) 6e-15 Click
363245932..3246045 PHAGE_Clostr_phiC2: putative head morphogenesis protein; PP_06106; phage(gi134287339) 2e-12 Click
37complement(3246746..3247417) carbamoyl phosphate synthase large subunit [Clostridium difficile R20291] gi|260688769|ref|YP_003219903.1|; PP_06107 4e-121 Click
38complement(3247516..3247746) carbamoyl phosphate synthase large subunit [Clostridium difficile R20291] gi|260688769|ref|YP_003219903.1|; PP_06108 6e-35 Click
39complement(3247722..3248210) carbamoyl phosphate synthase large subunit [Clostridium difficile R20291] gi|260688767|ref|YP_003219901.1|; PP_06109 1e-79 Click
40complement(3248295..3248654) carbamoyl phosphate synthase large subunit [Clostridium difficile R20291] gi|260688767|ref|YP_003219901.1|; PP_06110 8e-62 Click
41complement(3248660..3249709) carbamoyl phosphate synthase large subunit [Clostridium difficile R20291] gi|260688767|ref|YP_003219901.1|; PP_06111 0.0 Click
42complement(3249804..3250115) PHAGE_Clostr_phiC2: putative hydrolase; PP_06112; phage(gi134287357) 2e-43 Click
433250190..3250315 PHAGE_Clostr_phiC2: hypothetical protein phiC2p74; PP_06113; phage(gi134287406) 7e-16 Click
443250532..3250684 PHAGE_Clostr_phiC2: putative portal protein; PP_06114; phage(gi134287338) 2e-05 Click
45complement(3250790..3250984) PHAGE_Clostr_phiC2: hypothetical protein phiC2p09; PP_06115; phage(gi134287344) 6e-23 Click
46complement(3250994..3251287) PHAGE_Clostr_phiC2: hypothetical protein phiC2p08; PP_06116; phage(gi134287343) 1e-30 Click
47complement(3251287..3251892) PHAGE_Clostr_phiC2: putative main capsid protein; PP_06117; phage(gi134287342) 2e-109 Click
483251949..3252290 PHAGE_Clostr_phiC2: hypothetical protein phiC2p11; PP_06118; phage(gi134287346) 3e-56 Click
493252389..3252670 PHAGE_Clostr_phiC2: hypothetical protein phiC2p12; PP_06119; phage(gi134287347) 2e-43 Click
50complement(3252704..3253006) PHAGE_Clostr_phiC2: putative antirepressor; PP_06120; phage(gi134287387) 2e-37 Click
513253060..3254277 PTS system ascorbate-specific transporter subunit IIC [Clostridium difficile R20291] gi|260687785|ref|YP_003218919.1|; PP_06121 0.0 Click
523254280..3254666 hypothetical protein CDR20291_2438 [Clostridium difficile R20291] gi|260687784|ref|YP_003218918.1|; PP_06122 6e-62 Click
533254656..3254769 hypothetical protein CDR20291_2438 [Clostridium difficile R20291] gi|260687784|ref|YP_003218918.1|; PP_06123 2e-08 Click
543254769..3254966 hypothetical protein CDR20291_2438 [Clostridium difficile R20291] gi|260687784|ref|YP_003218918.1|; PP_06124 2e-29 Click
553255010..3255216 hypothetical; PP_06125 0.0 Click
563255380..3255652 iron ABC transporter solute-binding lipoprotein [Clostridium difficile R20291] gi|260688704|ref|YP_003219838.1|; PP_06126 4e-19 Click
57complement(3255755..3255922) PHAGE_Clostr_phiC2: hypothetical protein phiC2p75; PP_06127; phage(gi134287407) 2e-12 Click
583264023..3264077 attR    TAGCGCTGATGGTACTTGGTGGGAAACTGCCTGGGAGAGTAGGACGTAGCCACGT 0.0 Click