Lachnospiraceae oral taxon 107 str. F0167 .1, whole genome [asmbl_id: NC_000000].3279855, GC%: 35.69%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1343708..343721 attL    AAGGCATCACTGGA 0.0 Click
2357981..359258 PHAGE_Thermo_THSA_485A: Recombinase; HMPREF0491_00319; phage(gi397912662) 1e-10 Click
3359354..359761 hypothetical protein; HMPREF0491_00320 0.0 Click
4359879..360217 hypothetical protein; HMPREF0491_00321 0.0 Click
5360407..360787 hypothetical protein; HMPREF0491_00322 0.0 Click
6360890..361156 hypothetical protein; HMPREF0491_00323 0.0 Click
7361563..362009 hypothetical protein; HMPREF0491_00324 0.0 Click
8362211..363224 hypothetical protein; HMPREF0491_00325 0.0 Click
9363408..364133 PHAGE_Lactob_LF1: DNA replication protein; HMPREF0491_00326; phage(gi418489431) 6e-43 Click
10364358..364804 PHAGE_Lactob_LF1: GNAT family acetyltransferase; HMPREF0491_00327; phage(gi418489409) 7e-13 Click
11364836..365012 hypothetical protein; HMPREF0491_00328 0.0 Click
12365031..365321 hypothetical protein; HMPREF0491_00329 0.0 Click
13365437..365700 hypothetical protein; HMPREF0491_00330 0.0 Click
14365648..366130 hypothetical protein; HMPREF0491_00331 0.0 Click
15366234..366662 hypothetical protein; HMPREF0491_00332 0.0 Click
16366915..367046 hypothetical protein; HMPREF0491_00333 0.0 Click
17367112..368650 hypothetical protein; HMPREF0491_00334 0.0 Click
18368659..369453 PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF0491_00335; phage(gi371496158) 2e-27 Click
19369658..369870 hypothetical protein; HMPREF0491_00336 0.0 Click
20complement(369949..370296) PHAGE_Entero_mEp234: HicB protein; HMPREF0491_00337; phage(gi428782291) 6e-22 Click
21complement(370293..370547) PHAGE_Entero_mEp234: HicA protein; HMPREF0491_00338; phage(gi428782292) 4e-08 Click
22370769..370930 hypothetical protein; HMPREF0491_00339 0.0 Click
23371055..372110 hypothetical protein; HMPREF0491_00340 0.0 Click
24372171..372680 PHAGE_Lactoc_bIL311: Orf17; HMPREF0491_00341; phage(gi13095675) 5e-07 Click
25complement(372806..373027) PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; HMPREF0491_00342; phage(gi397912660) 1e-06 Click
26complement(373041..373556) hypothetical protein; HMPREF0491_00343 0.0 Click
27373797..374603 hypothetical protein; HMPREF0491_00344 0.0 Click
28374613..375002 hypothetical protein; HMPREF0491_00345 0.0 Click
29375551..382471 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; HMPREF0491_00346; phage(gi414087138) 6e-10 Click
30381854..381867 attR    AAGGCATCACTGGA 0.0 Click

Region 2, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3128384..3129265) PHAGE_Cyanop_S_TIM5: virion structural protein; HMPREF0491_02948; phage(gi422936221) 9e-07 Click
2complement(3129246..3129542) PHAGE_Human__8: LANA; HMPREF0491_02949; phage(gi139472804) 2e-06 Click
33129570..3129601 attL    ACTCTACCTTATCAGTAAAATAGAGTTATCAG 0.0 Click
4complement(3130033..3137628) PHAGE_Vibrio_VvAW1: DNA methylase; HMPREF0491_02950; phage(gi460042889) 8e-142 Click
5complement(3137628..3138431) PHAGE_Strept_PH15: putative minor tail protein; HMPREF0491_02951; phage(gi190151462) 7e-08 Click
6complement(3138477..3139028) PHAGE_Rhizob_3: p096; HMPREF0491_02952; phage(gi195546626) 9e-21 Click
7complement(3139032..3140753) PHAGE_Acanth_moumouvirus: DNA topoisomerase 1; HMPREF0491_02953; phage(gi441432186) 1e-28 Click
8complement(3140963..3141316) hypothetical protein; HMPREF0491_02954 0.0 Click
9complement(3141319..3142752) PHAGE_Ostreo_2: Rhodanese domain protein; HMPREF0491_02955; phage(gi314055298) 5e-09 Click
10complement(3142853..3143617) PHAGE_Acanth_moumouvirus: Purine phosphorylase family 1 protein; HMPREF0491_02956; phage(gi441432733) 3e-09 Click
11complement(3143747..3143983) hypothetical protein; HMPREF0491_02957 0.0 Click
12complement(3143973..3144209) hypothetical protein; HMPREF0491_02958 0.0 Click
13complement(3144467..3145345) PHAGE_Atelin_3: orf 48; HMPREF0491_02959; phage(gi9631239) 6e-09 Click
14complement(3145326..3145622) PHAGE_Human__8: LANA; HMPREF0491_02960; phage(gi139472804) 3e-06 Click
153145643..3145674 attR    ACTCTACCTTATCAGTAAAATAGAGTTATCAG 0.0 Click
16complement(3145743..3146171) PHAGE_Yersin_413C: Int; HMPREF0491_02961; phage(gi30065733) 1e-05 Click
173146172..3146401 hypothetical protein; HMPREF0491_02962 0.0 Click
18complement(3146484..3147752) PHAGE_Bacill_36: baseplate hub protein; HMPREF0491_02963; phage(gi156564128) 2e-11 Click
19complement(3148121..3148831) PHAGE_Glossi_virus: hypothetical protein SGHV062; HMPREF0491_02964; phage(gi168804078) 9e-06 Click