Neisseria elongata subsp. glycolytica ATCC 29315 [asmbl_id: NC_000000].2275949, GC%: 54.02%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1362835..362846 attL    CAGACGGCCTTC 0.0 Click
2364889..365452 PROPHAGE_Mesorh_MAFF303099: transposase; NEIELOOT_00520; phage(gi13474791) 3e-08 Click
3365531..365695 integrase, catalytic domain protein; NEIELOOT_00521 0.0 Click
4365815..365982 conserved hypothetical protein; NEIELOOT_00522 0.0 Click
5complement(366088..366603) PHAGE_Pseudo_MP22: virion morphogenesis protein; NEIELOOT_00523; phage(gi157835000) 2e-20 Click
6complement(366679..366861) PHAGE_Burkho_BcepMu: gp29; NEIELOOT_00524; phage(gi48696939) 4e-05 Click
7complement(366994..367338) PHAGE_Burkho_BcepMu: gp28; NEIELOOT_00525; phage(gi48696938) 6e-33 Click
8complement(367564..367737) conserved hypothetical phage-related protein; NEIELOOT_00526 0.0 Click
9367791..368231 PHAGE_Vibrio_VP882: DNA adenine methylase; NEIELOOT_00527; phage(gi126010878) 5e-09 Click
10376436..376447 attR    CAGACGGCCTTC 0.0 Click

Region 2, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1481415..481461 attL    GACTCATAATCCCTTGGTCGTGGGTTCGAACCCCACCGGACCCACCA 0.0 Click
2complement(481487..481765) PHAGE_Xylell_Xfas53: integrase; NEIELOOT_00673; phage(gi273810420) 6e-14 Click
3complement(481835..482569) PHAGE_Entero_PsP3: gp36; NEIELOOT_00674; phage(gi41057388) 4e-31 Click
4complement(482566..483165) conserved hypothetical protein; NEIELOOT_00675 0.0 Click
5complement(483249..483542) prophage P2 OGR protein; NEIELOOT_00676 0.0 Click
6complement(483532..484062) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp43; NEIELOOT_00678; phage(gi148609425) 1e-11 Click
7484061..484357 putative magnesium chelatase, ChlI subunit; NEIELOOT_00677 0.0 Click
8484901..485596 PHAGE_Burkho_KS14: gp5; NEIELOOT_00679; phage(gi327198274) 1e-26 Click
9485659..485877 conserved hypothetical protein; NEIELOOT_00680 0.0 Click
10485880..486797 PHAGE_Yersin_413C: hypothetical protein L-413Cp40; NEIELOOT_00681; phage(gi30065744) 6e-30 Click
11486807..487814 conserved hypothetical protein; NEIELOOT_00682 0.0 Click
12complement(487819..488760) PHAGE_Thermu_26: C5 cytosine-specific DNA methylase; NEIELOOT_00683; phage(gi157265426) 3e-39 Click
13complement(488844..489344) PHAGE_Mannhe_phiMHaA1: head completion protein L; NEIELOOT_00684; phage(gi109289942) 1e-14 Click
14complement(489452..490081) PHAGE_Burkho_2: gp1, phage small terminase subunit; NEIELOOT_00685; phage(gi134288705) 2e-27 Click
15complement(490164..491213) PHAGE_Yersin_413C: gpN; NEIELOOT_00686; phage(gi30065708) 9e-65 Click
16complement(491253..492005) PHAGE_Yersin_413C: gpO; NEIELOOT_00687; phage(gi30065707) 2e-22 Click
17492006..493091 PROPHAGE_Ralsto_GMI1000: terminase (ATPase subunit) related protein; NEIELOOT_00688; phage(gi17546658) 2e-65 Click
18493057..493593 PHAGE_Yersin_413C: gpP; NEIELOOT_00689; phage(gi30065706) 1e-41 Click
19493593..494069 PHAGE_Ralsto_phiRSA1: terminase; NEIELOOT_00690; phage(gi145708080) 5e-31 Click
20494083..495063 PHAGE_Burkho_2: gp5, phage portal protein, pbsx family; NEIELOOT_00691; phage(gi134288732) 2e-81 Click
21495470..495516 attR    GACTCATAATCCCTTGGTCGTGGGTTCGAACCCCACCGGACCCACCA 0.0 Click

Region 3, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1468926..1469729) PROPHAGE_Ralsto_GMI1000: isrso11-transposase orfb protein; NEIELOOT_02018; phage(gi17546155) 1e-59 Click
2complement(1469726..1470132) PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; NEIELOOT_02019; phage(gi17546156) 5e-06 Click
3complement(1470158..1470601) hypothetical protein; NEIELOOT_02020 0.0 Click
4complement(1470580..1471335) PHAGE_Pseudo_DMS3: putative c repressor; NEIELOOT_02021; phage(gi156523050) 2e-24 Click
51471570..1471824 PHAGE_Haemop_SuMu: Mu-like prophage FluMu DNA-binding protein Ner; NEIELOOT_02022; phage(gi418489037) 2e-18 Click
61471886..1472089 hypothetical protein; NEIELOOT_02023 0.0 Click
71472086..1472721 PROPHAGE_Escher_Sakai: phage transposase; NEIELOOT_02024; phage(gi15834199) 2e-33 Click
81472852..1473136 hypothetical protein; NEIELOOT_02025 0.0 Click
91473140..1474321 PHAGE_Haemop_SuMu: DNA circulation protein; NEIELOOT_02026; phage(gi418489067) 1e-22 Click
101474347..1474802 PHAGE_Haemop_SuMu: baseplate J family protein gp47; NEIELOOT_02027; phage(gi418489071) 4e-30 Click
111474799..1475362 PHAGE_Haemop_SuMu: hypothetical protein; NEIELOOT_02028; phage(gi418489072) 8e-28 Click
121475375..1475863 PHAGE_Haemop_SuMu: hypothetical protein; NEIELOOT_02029; phage(gi418489077) 9e-10 Click
13complement(1475919..1476125) hypothetical protein; NEIELOOT_02030 0.0 Click
14complement(1476201..1476467) hypothetical protein; NEIELOOT_02031 0.0 Click
151476468..1476941 hypothetical protein; NEIELOOT_02032 0.0 Click
161477086..1477619 PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; NEIELOOT_02033; phage(gi16131377) 8e-13 Click
17complement(1477780..1478538) hypothetical protein; NEIELOOT_02034 0.0 Click
181478632..1480080 hypothetical protein; NEIELOOT_02035 0.0 Click
19complement(1480238..1480786) PROPHAGE_Mesorh_MAFF303099: transposase; NEIELOOT_02036; phage(gi13474791) 6e-06 Click