Escherichia coli H299 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].5248906, GC%: 50.75%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(87657..89615) PHAGE_Vibrio_vB_VpaS_MAR10: putative parB-like partitioning protein; PP_00100; phage(gi428782174) 9e-06 Click
289788..89985 hypothetical; PP_00101 0.0 Click
3complement(89965..90348) PHAGE_Xantho_vB_XveM_DIBBI: single-stranded DNA-binding protein; PP_00102; phage(gi389060431) 4e-28 Click
4complement(90503..90922) hypothetical protein SeHA_A0048 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447295|ref|YP_002043886.1|; PP_00103 3e-63 Click
5complement(90969..91394) PHAGE_Pseudo_YuA: hypothetical protein; PP_00104; phage(gi162135127) 3e-13 Click
6complement(91360..91872) hypothetical; PP_00105 0.0 Click
7complement(92010..92786) hypothetical protein ECH74115_B0053 [Escherichia coli O157:H7 str. EC4115] gi|209395636|ref|YP_002268435.1|; PP_00106 3e-136 Click
8complement(92832..93266) hypothetical protein UTI89_P077 [Escherichia coli UTI89] gi|91206322|ref|YP_538676.1|; PP_00107 1e-70 Click
9complement(93280..93501) PHAGE_Entero_N15: gp50; PP_00108; phage(gi9630517) 1e-05 Click
10complement(93502..93789) PHAGE_Natria_PhiCh1: adenine methyltransferase; PP_00109; phage(gi22091198) 1e-11 Click
11complement(93803..94111) hypothetical protein ECH74115_B0048 [Escherichia coli O157:H7 str. EC4115] gi|209395534|ref|YP_002268429.1|; PP_00110 2e-47 Click
12complement(94188..95912) PHAGE_Melano_entomopoxvirus: ORF MSV061 putative LINE reverse transcriptase, similar to Caenorhabditis elegans GB:U00063; PP_00111; phage(gi9631308) 9e-08 Click
1397119..97367 PHAGE_Sodali_phiSG1: ImpC protein; PP_00112; phage(gi89886014) 2e-16 Click
1497364..97801 PHAGE_Cronob_ENT39118: protein umuD; PP_00113; phage(gi431811072) 2e-21 Click
1597801..98694 PHAGE_Cronob_ENT39118: DNA polymerase; PP_00114; phage(gi431811050) 2e-98 Click
1698675..99295 PHAGE_Cronob_ENT39118: DNA polymerase; PP_00115; phage(gi431811050) 6e-69 Click
1799592..100125 PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0046; PP_00116; phage(gi89886027) 4e-18 Click
18100245..100424 hypothetical; PP_00117 0.0 Click
19complement(100888..101001) hypothetical; PP_00118 0.0 Click
20complement(100962..101171) hypothetical protein SSON_2658 [Shigella sonnei Ss046] gi|74313097|ref|YP_311516.1|; PP_00119 4e-32 Click
21101290..101637 colicin-Ib immunity protein [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447200|ref|YP_002043858.1|; PP_00120 1e-56 Click
22complement(101655..103550) PROPHAGE_Xantho_33913: Tn5041 transposase; PP_00121; phage(gi21231545) 2e-10 Click

Region 2, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1104288..104301 attL    ATCTGGTGGATGCG 0.0 Click
2complement(115795..116499) PROPHAGE_Brucel_1330: transposase, putative; PP_00137; phage(gi23502708) 6e-43 Click
3complement(116511..116627) hypothetical; PP_00138 0.0 Click
4complement(116845..117222) PROPHAGE_Escher_MG1655: IS1 transposase B; PP_00139; phage(gi16131317) 5e-70 Click
5complement(117267..117494) PHAGE_Entero_P1: InsA; PP_00140; phage(gi46401643) 3e-39 Click
6117584..117757 Insertion element protein [Escherichia coli P12b] gi|386704509|ref|YP_006168356.1|; PP_00141 4e-24 Click
7complement(118596..118769) PHAGE_Entero_HK630: tail fiber assembly protein; PP_00142; phage(gi428782810) 4e-23 Click
8complement(118753..118902) hypothetical; PP_00143 0.0 Click
9118867..119703 PHAGE_Entero_mEp460: tail length tape measure protein; PP_00144; phage(gi428782329) 3e-139 Click
10119703..120032 PHAGE_Entero_mEp460: minor tail protein; PP_00145; phage(gi428782330) 2e-61 Click
11120042..120776 PHAGE_Entero_mEp460: minor tail protein; PP_00146; phage(gi428782331) 4e-134 Click
12120787..122970 PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_00147; phage(gi148609400) 0.0 Click
13123038..123898 PHAGE_Entero_mEp460: Lom protein; PP_00148; phage(gi428782335) 9e-100 Click
14123963..126341 PHAGE_Entero_mEp460: side tail fiber protein; PP_00149; phage(gi428782336) 6e-105 Click
15126341..126622 hypothetical protein ECB_00514 [Escherichia coli B str. REL606] gi|254160630|ref|YP_003043738.1|; PP_00150 2e-44 Click
16126632..127672 PHAGE_Entero_mEp460: side tail fiber protein; PP_00151; phage(gi428782336) 8e-50 Click
17127751..128002 hypothetical protein CE10_5174 [Escherichia coli O7:K1 str. CE10] gi|386627388|ref|YP_006147116.1|; PP_00152 9e-44 Click
18complement(128120..128368) PHAGE_Entero_mEp460: DinI-like protein; PP_00153; phage(gi428782337) 5e-41 Click
19complement(128430..129527) PHAGE_Entero_mEp460: integrase; PP_00154; phage(gi428782338) 0.0 Click
20138905..138918 attR    ATCTGGTGGATGCG 0.0 Click

Region 3, total : 7 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1270526..270873 PHAGE_Stx2_c_1717: transposase; PP_00308; phage(gi209447152) 5e-62 Click
2complement(270969..271154) PHAGE_Stx2_c_1717: transposase; PP_00309; phage(gi209447153) 2e-21 Click
3complement(271364..271714) PHAGE_Stx2_c_1717: transposase; PP_00310; phage(gi209447152) 3e-41 Click
4complement(271711..272136) PHAGE_Stx2_c_1717: truncated transposase; PP_00311; phage(gi209447151) 1e-13 Click
5272306..273457 PROPHAGE_Escher_MG1655: IS150 transposase B; PP_00312; phage(gi16131429) 1e-58 Click
6273618..273764 putative IS91 transposase [Escherichia coli O111:H- str. 11128] gi|260870464|ref|YP_003236866.1|; PP_00313 1e-17 Click
7274349..277846 PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_00314; phage(gi414087138) 6e-15 Click

Region 4, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1780048..780818 PHAGE_Microm_12T: hypothetical protein; PP_00805; phage(gi472342811) 5e-09 Click
2complement(780867..782087) PHAGE_Bacill_Eoghan: cell wall hydrolase/autolysin; PP_00806; phage(gi460041965) 4e-10 Click
3complement(782297..783052) hydroxyacylglutathione hydrolase [Escherichia coli str. 'clone D i2'] gi|386627732|ref|YP_006147452.1|; PP_00807 2e-146 Click
4783086..783808 hypothetical protein i02_0232 [Escherichia coli str. 'clone D i2'] gi|386627733|ref|YP_006147453.1|; PP_00808 1e-140 Click
5complement(783805..784272) PHAGE_Salmon_SSU5: putative ribonuclease H; PP_00809; phage(gi410491500) 3e-52 Click
6784328..785068 PHAGE_Salmon_SSU5: putative exonuclease; PP_00810; phage(gi410491496) 2e-09 Click
7785201..785277 tRNA 0.0 Click
8complement(785398..785643) hypothetical protein c0254 [Escherichia coli CFT073] gi|26246161|ref|NP_752200.1|; PP_00811 1e-40 Click
9complement(785809..786255) hypothetical protein i02_0236 [Escherichia coli str. 'clone D i2'] gi|386627737|ref|YP_006147457.1|; PP_00812 7e-81 Click
10786639..786791 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF79; PP_00813; phage(gi157166064) 2e-14 Click
11786915..787211 PHAGE_Stx2_c_1717: transposase; PP_00814; phage(gi209447152) 3e-31 Click
12787400..787585 PHAGE_Stx2_c_1717: transposase; PP_00815; phage(gi209447153) 2e-22 Click
13787733..788419 PROPHAGE_Escher_CFT073: putative transposase; PP_00816; phage(gi26246170) 3e-135 Click
14788374..788721 PROPHAGE_Escher_EDL933: putative transposase; PP_00817; phage(gi15803522) 1e-32 Click
15complement(789014..789292) hypothetical protein ECP_3017 [Escherichia coli 536] gi|110643171|ref|YP_670901.1|; PP_00818 8e-22 Click
16complement(789289..789666) hypothetical protein i02_0265 [Escherichia coli str. 'clone D i2'] gi|386627766|ref|YP_006147486.1|; PP_00819 2e-66 Click
17complement(789713..789862) hypothetical protein i02_0266 [Escherichia coli str. 'clone D i2'] gi|386627767|ref|YP_006147487.1|; PP_00821 8e-22 Click
18789830..790024 hypothetical protein c3675 [Escherichia coli CFT073] gi|26249510|ref|NP_755550.1|; PP_00820 1e-21 Click
19complement(790137..790781) PHAGE_Caulob_CcrColossus: hypothetical protein; PP_00822; phage(gi414088071) 6e-27 Click
20complement(790800..791021) hypothetical protein ECOK1_1130 [Escherichia coli IHE3034] gi|386598831|ref|YP_006100337.1|; PP_00823 1e-36 Click
21complement(791084..791458) putative radC-like protein yeeS [Escherichia coli str. 'clone D i2'] gi|386628660|ref|YP_006148380.1|; PP_00824 5e-64 Click
22complement(791466..791906) PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_00825; phage(gi414086954) 7e-26 Click
23complement(792006..792131) hypothetical protein i02_0272 [Escherichia coli str. 'clone D i2'] gi|386627773|ref|YP_006147493.1|; PP_00826 1e-17 Click
24complement(792357..792809) hypothetical protein i02_0273 [Escherichia coli str. 'clone D i2'] gi|386627774|ref|YP_006147494.1|; PP_00827 2e-86 Click
25complement(792846..792965) hypothetical protein i02_0274 [Escherichia coli str. 'clone D i2'] gi|386627775|ref|YP_006147495.1|; PP_00828 1e-15 Click
26complement(792965..793222) PHAGE_Erwini_phiEaH2: hypothetical protein; PP_00829; phage(gi431810674) 2e-11 Click

Region 5, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11121963..1123348 PHAGE_Acanth_mimivirus: cysteinyl-tRNA synthetase; PP_01141; phage(gi311977536) 8e-44 Click
2complement(1123384..1123905) putative membrane-bound metal-dependent hydrolase [Escherichia coli 042] gi|387606037|ref|YP_006094893.1|; PP_01142 9e-100 Click
3complement(1124013..1124225) hypothetical protein SFV_0486 [Shigella flexneri 5 str. 8401] gi|110804537|ref|YP_688057.1|; PP_01143 1e-32 Click
4complement(1124227..1125093) bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase [Shigella sonnei Ss046] gi|74311080|ref|YP_309499.1|; PP_01144 7e-161 Click
51125143..1125265 hypothetical protein i02_0621 [Escherichia coli str. 'clone D i2'] gi|386628114|ref|YP_006147834.1|; PP_01145 3e-17 Click
61125364..1125440 tRNA 0.0 Click
71125396..1125443 attL    CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATTA 0.0 Click
8complement(1125456..1126619) PHAGE_Salmon_epsilon34: Tyrosine integrase; PP_01146; phage(gi221328640) 0.0 Click
9complement(1126846..1127151) PHAGE_Entero_mEp460: hypothetical protein; PP_01147; phage(gi428782343) 3e-20 Click
10complement(1127151..1127492) PHAGE_Entero_mEp460: hypothetical protein; PP_01148; phage(gi428782348) 6e-63 Click
11complement(1127522..1128040) PHAGE_Entero_mEp460: hypothetical protein; PP_01149; phage(gi428782349) 2e-96 Click
12complement(1128168..1128419) PHAGE_Entero_mEp460: hypothetical protein; PP_01150; phage(gi428782350) 6e-34 Click
131128380..1129240 PHAGE_Entero_HK630: HkaP protein; PP_01151; phage(gi428782827) 8e-13 Click
14complement(1129560..1130207) PHAGE_Entero_mEp460: prophage repressor; PP_01152; phage(gi428782354) 9e-114 Click
151130350..1130610 PHAGE_Entero_mEp460: putative antirepressor Cro; PP_01153; phage(gi428782355) 2e-42 Click
161130603..1131154 PHAGE_Entero_mEp460: hypothetical protein; PP_01154; phage(gi428782356) 1e-93 Click
171131151..1131765 e14 prophage protein [Escherichia coli O55:H7 str. CB9615] gi|291285764|ref|YP_003502582.1|; PP_01155 6e-57 Click
181131775..1132716 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_01156; phage(gi18249881) 1e-41 Click
191132956..1133207 PHAGE_Entero_mEp460: hypothetical protein; PP_01157; phage(gi428782360) 4e-40 Click
201133207..1133860 PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; PP_01158; phage(gi428782361) 2e-125 Click
211133857..1134183 PHAGE_Entero_mEp460: LexA DNA binding domain protein; PP_01159; phage(gi428782362) 2e-54 Click
221134180..1134569 PHAGE_Entero_mEp460: holliday junction resolvase; PP_01160; phage(gi428782363) 4e-71 Click
231134556..1134675 hypothetical; PP_01161 0.0 Click
241134696..1134857 PHAGE_Entero_mEp460: hypothetical protein; PP_01162; phage(gi428782365) 9e-24 Click
251134871..1135623 PHAGE_Entero_mEp460: late gene regulator; PP_01163; phage(gi428782366) 1e-142 Click
261135910..1136308 hypothetical protein ECOK1_0532 [Escherichia coli IHE3034] gi|386598265|ref|YP_006099771.1|; PP_01164 5e-75 Click
271136491..1136685 PHAGE_Entero_mEp460: hypothetical protein; PP_01165; phage(gi428782368) 3e-07 Click
281136835..1137896 PHAGE_Entero_mEp460: DNA methylase; PP_01166; phage(gi428782369) 0.0 Click
29complement(1138253..1138447) hypothetical protein ECOK1_0535 [Escherichia coli IHE3034] gi|386598268|ref|YP_006099774.1|; PP_01167 2e-31 Click
301138775..1138966 hypothetical protein ECOK1_0536 [Escherichia coli IHE3034] gi|386598269|ref|YP_006099775.1|; PP_01168 3e-29 Click
311138944..1139204 PHAGE_Entero_mEp460: porin; PP_01169; phage(gi428782370) 1e-29 Click
321139209..1139553 PHAGE_Entero_mEp460: hypothetical protein; PP_01170; phage(gi428782371) 3e-37 Click
33complement(1139519..1139671) hypothetical protein ECOK1_0538 [Escherichia coli IHE3034] gi|386598272|ref|YP_006099778.1|; PP_01171 1e-20 Click
341139939..1140430 PHAGE_Entero_mEp460: endolysin; PP_01172; phage(gi428782372) 2e-93 Click
351140427..1140687 PHAGE_Entero_HK630: cell lysis protein Rz; PP_01173; phage(gi428782852) 1e-38 Click
361140647..1140916 PHAGE_Entero_HK630: cell lysis protein Rz; PP_01174; phage(gi428782852) 3e-39 Click
37complement(1140948..1141241) PHAGE_Entero_HK630: Bor protein; PP_01175; phage(gi428782854) 2e-45 Click
381142255..1142437 hypothetical protein ECOK1_0543 [Escherichia coli IHE3034] gi|386598276|ref|YP_006099782.1|; PP_01176 2e-26 Click
391143008..1143166 PHAGE_Entero_HK630: cell lysis protein Rz; PP_01177; phage(gi428782852) 1e-23 Click
40complement(1143198..1143491) PHAGE_Entero_HK630: Bor protein; PP_01178; phage(gi428782854) 4e-46 Click
411144372..1144971 PHAGE_Entero_HK630: tail fiber assembly protein; PP_01179; phage(gi428782810) 4e-101 Click
42complement(1145026..1145838) hypothetical protein SSON53_12765 [Shigella sonnei 53G] gi|383179078|ref|YP_005457083.1|; PP_01180 1e-117 Click
43complement(1146082..1146642) exported protein; protease [Escherichia coli S88] gi|218557502|ref|YP_002390415.1|; PP_01181 5e-54 Click
44complement(1147202..1147564) outer membrane protease [Escherichia coli S88] gi|218557503|ref|YP_002390416.1|; PP_01182 7e-68 Click
451148216..1148368 regulatory peptide MokC [Shigella sonnei 53G] gi|383177147|ref|YP_005455152.1|; PP_01183 3e-20 Click
461148719..1148871 regulatory peptide MokC [Shigella sonnei 53G] gi|383177147|ref|YP_005455152.1|; PP_01184 3e-20 Click
471148911..1149063 regulatory peptide MokC [Shigella sonnei 53G] gi|383177147|ref|YP_005455152.1|; PP_01185 3e-20 Click
481149097..1149231 hypothetical protein EC042_0618 [Escherichia coli 042] gi|387606082|ref|YP_006094938.1|; PP_01186 1e-12 Click
491149415..1149567 regulatory peptide MokC [Shigella sonnei 53G] gi|383177147|ref|YP_005455152.1|; PP_01187 3e-20 Click
501149961..1150266 PHAGE_Entero_HK630: tail fiber assembly protein; PP_01188; phage(gi428782810) 1e-14 Click
51complement(1150450..1152078) hydrolase [Escherichia coli O26:H11 str. 11368] gi|260853810|ref|YP_003227701.1|; PP_01189 0.0 Click
521152182..1152295 hypothetical protein CE10_0563 [Escherichia coli O7:K1 str. CE10] gi|386622958|ref|YP_006142686.1|; PP_01190 9e-15 Click
531152501..1152548 attR    CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATTA 0.0 Click
541152519..1152540 attL    CAGGTTCGAATCCTGCAGGGCG 0.0 Click
55complement(1152881..1153027) PHAGE_Salmon_epsilon34: Tyrosine integrase; PP_01191; phage(gi221328640) 4e-13 Click
561154824..1154845 attR    CAGGTTCGAATCCTGCAGGGCG 0.0 Click

Region 6, total : 78 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11362417..1362431 attL    ACGCCGCATCCGGCA 0.0 Click
2complement(1363865..1364935) PHAGE_Entero_lambda: integration protein; PP_01397; phage(gi9626273) 0.0 Click
3complement(1365171..1365338) PHAGE_Entero_lambda: hypothetical protein lambdap35; PP_01398; phage(gi19263393) 4e-28 Click
41365507..1365519 attL    ACTGCTTATTACA 0.0 Click
5complement(1365575..1366273) PHAGE_Salmon_SSU5: hypothetical protein; PP_01399; phage(gi410491511) 3e-104 Click
6complement(1366404..1366952) PHAGE_Entero_mEp213: hypothetical protein; PP_01400; phage(gi428782624) 7e-49 Click
7complement(1367269..1367484) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_01401; phage(gi20065893) 2e-34 Click
8complement(1367561..1367674) PHAGE_Entero_lambda: hypothetical protein lambdap38; PP_01402; phage(gi9626278) 1e-13 Click
9complement(1367904..1368584) PHAGE_Entero_4795: putative exonuclease; PP_01403; phage(gi157165997) 9e-133 Click
10complement(1368581..1369366) PHAGE_Entero_lambda: bet; PP_01404; phage(gi9626281) 2e-150 Click
11complement(1369372..1369668) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_01405; phage(gi116222045) 9e-53 Click
12complement(1369743..1369886) PHAGE_Entero_lambda: host-killing protein; PP_01406; phage(gi9626283) 3e-19 Click
13complement(1370092..1370460) PHAGE_Entero_lambda: Putative single-stranded DNA binding protein; PP_01407; phage(gi9626285) 2e-67 Click
141370783..1371211 PHAGE_Entero_HK446: hypothetical protein; PP_01408; phage(gi428782230) 6e-78 Click
15complement(1371204..1371527) PHAGE_Entero_lambda: early gene regulator; PP_01409; phage(gi9626289) 1e-54 Click
16complement(1372009..1372866) PHAGE_Burkho_phiE202: gp9, Cpp15; PP_01410; phage(gi134288743) 2e-41 Click
17complement(1372994..1373707) PHAGE_Entero_lambda: repressor; PP_01411; phage(gi9626292) 4e-132 Click
181373808..1374008 PHAGE_Entero_lambda: antirepressor; PP_01412; phage(gi9626293) 7e-32 Click
191374283..1374420 PHAGE_Entero_lambda: cII protein; PP_01413; phage(gi9626294) 1e-18 Click
201374453..1375352 PHAGE_Entero_lambda: DNA replication protein; PP_01414; phage(gi9626295) 2e-176 Click
211375349..1376050 PHAGE_Entero_lambda: DNA replication protein; PP_01415; phage(gi9626296) 2e-131 Click
221376047..1376337 PHAGE_Entero_lambda: ren exclusion protein; PP_01416; phage(gi9626297) 4e-49 Click
231376848..1377375 PHAGE_Entero_HK544: putative N-6-adenine-methyltransferase; PP_01417; phage(gi428783266) 1e-100 Click
241378099..1378461 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_01418; phage(gi435439318) 3e-60 Click
251378458..1378598 PHAGE_Entero_mEp237: hypothetical protein; PP_01419; phage(gi435439319) 1e-10 Click
261378684..1379067 PHAGE_Entero_2008: antitermination protein Q; PP_01420; phage(gi209427762) 5e-56 Click
27complement(1379257..1380354) outer membrane porin protein [Escherichia coli ETEC H10407] gi|387611282|ref|YP_006114398.1|; PP_01421 0.0 Click
281380927..1381142 PHAGE_Stx2_c_II: holin; PP_01422; phage(gi302393164) 4e-28 Click
291381142..1381639 PHAGE_Stx2_c_1717: phage-related lysozyme; PP_01423; phage(gi209447172) 6e-90 Click
301381636..1381905 PHAGE_Entero_lambda: cell lysis protein; PP_01424; phage(gi9626310) 6e-42 Click
311381856..1382467 hypothetical protein NT01EI_3725 [Edwardsiella ictaluri 93-146] gi|238921572|ref|YP_002935087.1|; PP_01425 6e-09 Click
321384745..1384912 PHAGE_Entero_lambda: DNA packaging protein; PP_01426; phage(gi9626244) 9e-21 Click
331384866..1385291 PHAGE_Entero_lambda: DNA packaging protein; PP_01427; phage(gi9626244) 4e-70 Click
341385266..1387191 PHAGE_Entero_lambda: DNA packaging protein; PP_01428; phage(gi9626245) 0.0 Click
351387188..1387394 PHAGE_Entero_lambda: head-tail joining protein; PP_01429; phage(gi9626246) 4e-32 Click
361387391..1388992 PHAGE_Entero_lambda: capsid component; PP_01430; phage(gi9626247) 0.0 Click
371388973..1390292 PHAGE_Entero_lambda: capsid component; PP_01431; phage(gi9626248) 0.0 Click
381390342..1390617 PHAGE_Entero_lambda: capsid component; PP_01432; phage(gi9626251) 6e-42 Click
391390750..1391985 PHAGE_Entero_mEpX1: integrase; PP_01433; phage(gi428781899) 2e-53 Click
401391987..1392214 PHAGE_Entero_P4: transcriptional regulator; PP_01434; phage(gi9627517) 9e-05 Click
41complement(1393171..1393404) hypothetical protein NRG857_05725 [Escherichia coli O83:H1 str. NRG 857C] gi|387616486|ref|YP_006119508.1|; PP_01435 3e-32 Click
421393718..1393864 hypothetical protein S1212 [Shigella flexneri 2a str. 2457T] gi|30062661|ref|NP_836832.1|; PP_01436 2e-18 Click
431393857..1394042 hypothetical protein Z1840 [Escherichia coli O157:H7 str. EDL933] gi|15801308|ref|NP_287325.1|; PP_01437 1e-24 Click
441394042..1394233 PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; PP_01438; phage(gi169257169) 3e-08 Click
451394234..1394455 hypothetical; PP_01439 0.0 Click
461394473..1394772 hypothetical protein CE10_1216 [Escherichia coli O7:K1 str. CE10] gi|386623592|ref|YP_006143320.1|; PP_01440 2e-43 Click
471394769..1396520 PHAGE_Entero_P4: DNA primase; PP_01441; phage(gi9627512) 2e-95 Click
481396810..1397052 hypothetical protein CE10_1218 [Escherichia coli O7:K1 str. CE10] gi|386623594|ref|YP_006143322.1|; PP_01442 2e-30 Click
491397139..1397513 PHAGE_Pseudo_F116: single-stranded DNA-binding protein; PP_01443; phage(gi56692915) 7e-08 Click
501397731..1398771 PHAGE_Entero_lambda: capsid component; PP_01444; phage(gi9626251) 4e-66 Click
511398781..1399122 PHAGE_Entero_lambda: head-DNA stabilization protein; PP_01445; phage(gi9626250) 7e-10 Click
521399134..1399517 hypothetical protein NRG857_05770 [Escherichia coli O83:H1 str. NRG 857C] gi|387616495|ref|YP_006119517.1|; PP_01446 4e-68 Click
531399510..1399623 hypothetical; PP_01447 0.0 Click
541399604..1399798 hypothetical; PP_01448 0.0 Click
551400566..1400578 attR    ACTGCTTATTACA 0.0 Click
561400883..1401377 hypothetical protein Cag_0532 [Chlorobium chlorochromatii CaD3] gi|78188510|ref|YP_378848.1|; PP_01449 6e-12 Click
571401501..1402817 PHAGE_Entero_lambda: capsid component; PP_01450; phage(gi9626251) 0.0 Click
581402859..1403254 PHAGE_Entero_lambda: DNA packaging protein; PP_01451; phage(gi9626252) 3e-57 Click
591403266..1403640 PHAGE_Entero_lambda: head-tail joining protein; PP_01452; phage(gi9626253) 8e-62 Click
601403631..1404209 PHAGE_Entero_lambda: tail component; PP_01453; phage(gi9626254) 2e-100 Click
611404206..1404601 PHAGE_Entero_lambda: tail component; PP_01454; phage(gi9626255) 3e-71 Click
621404609..1405349 PHAGE_Entero_lambda: tail component; PP_01455; phage(gi9626256) 3e-135 Click
631405365..1405787 PHAGE_Entero_lambda: tail component; PP_01456; phage(gi9626257) 5e-64 Click
641405769..1406203 PHAGE_Entero_lambda: tail component; PP_01457; phage(gi9626258) 4e-81 Click
651406196..1408757 PHAGE_Entero_lambda: tail component; PP_01458; phage(gi9626259) 0.0 Click
661408754..1409083 PHAGE_Entero_lambda: tail component; PP_01459; phage(gi9626260) 2e-59 Click
671409083..1409781 PHAGE_Entero_lambda: tail component; PP_01460; phage(gi9626261) 9e-129 Click
681409840..1410178 PHAGE_Entero_lambda: tail component; PP_01461; phage(gi9626262) 6e-65 Click
691410175..1410717 PHAGE_Entero_lambda: tail component; PP_01462; phage(gi9626263) 6e-75 Click
701410778..1411371 PHAGE_Entero_lambda: tail:host specificity protein; PP_01463; phage(gi9626264) 1e-94 Click
711411401..1413257 PHAGE_Entero_lambda: tail:host specificity protein; PP_01464; phage(gi9626264) 0.0 Click
721413586..1415226 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01465; phage(gi16129506) 1e-48 Click
731415201..1415410 PROPHAGE_Escher_MG1655: IS1 transposase B; PP_01466; phage(gi16131317) 5e-35 Click
741415632..1416375 AraC family transcriptional regulator [Escherichia coli O157:H7 str. TW14359] gi|254791418|ref|YP_003076255.1|; PP_01467 2e-136 Click
75complement(1416417..1416770) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; PP_01468; phage(gi24111655) 2e-42 Click
761416933..1417148 PROPHAGE_Xantho_33913: ISxac3 transposase; PP_01469; phage(gi21231087) 5e-13 Click
77complement(1417478..1417954) putative kinase inhibitor protein [Escherichia coli str. 'clone D i2'] gi|386628309|ref|YP_006148029.1|; PP_01470 1e-91 Click
78complement(1418013..1419245) PHAGE_Mycoba_Myrna: gp183; PP_01471; phage(gi203454746) 5e-06 Click
791419389..1420429 biotin synthase [Escherichia coli str. 'clone D i2'] gi|386628312|ref|YP_006148032.1|; PP_01472 0.0 Click
801420426..1421580 PHAGE_Emilia_86: putative serine palmitoyltransferase; PP_01473; phage(gi73852520) 3e-28 Click
811421567..1422322 PHAGE_Ostreo_2: mRNA capping enzyme; PP_01474; phage(gi314055174) 1e-05 Click
821425713..1425727 attR    ACGCCGCATCCGGCA 0.0 Click

Region 7, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2060795..2062111) PHAGE_Entero_mEp460: putative exonuclease; PP_02097; phage(gi428782342) 1e-22 Click
2complement(2062102..2063778) PHAGE_Entero_mEp460: putative exonuclease; PP_02098; phage(gi428782342) 9e-29 Click
32063762..2064064 PHAGE_Entero_mEp460: Lom protein; PP_02099; phage(gi428782335) 4e-49 Click
42064129..2064674 PHAGE_Entero_mEp460: side tail fiber protein; PP_02100; phage(gi428782336) 7e-90 Click
52064674..2064976 PHAGE_Entero_mEp460: Lom protein; PP_02101; phage(gi428782335) 4e-53 Click
62065041..2065595 PHAGE_Entero_mEp460: side tail fiber protein; PP_02102; phage(gi428782336) 9e-90 Click
72065588..2065869 PHAGE_Entero_mEp460: Lom protein; PP_02103; phage(gi428782335) 2e-48 Click
82065934..2067103 PHAGE_Entero_mEp460: side tail fiber protein; PP_02104; phage(gi428782336) 7e-136 Click
9complement(2067255..2067770) PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_02105; phage(gi399528893) 1e-08 Click
10complement(2067798..2068313) PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_02106; phage(gi399528893) 7e-09 Click
112068286..2068432 hypothetical; PP_02107 0.0 Click
122068588..2068800 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_02108 2e-17 Click
132068761..2069030 PHAGE_Entero_P2: gpH; PP_02109; phage(gi9630346) 2e-30 Click
142069058..2070209 PROPHAGE_Escher_MG1655: IS30 transposase; PP_02110; phage(gi16132105) 0.0 Click

Region 8, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12165505..2165708 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; PP_02195; phage(gi410491512) 1e-13 Click
2complement(2165744..2167204) PHAGE_Microm_MpV1: hypothetical protein; PP_02196; phage(gi313768442) 6e-42 Click
3complement(2167293..2168576) PHAGE_Burkho_phi1026b: gp59; PP_02197; phage(gi38707949) 1e-33 Click
42169438..2169596 hypothetical protein ECBD_2249 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773632|ref|YP_003036463.1|; PP_02198 5e-22 Click
52169913..2170503 PHAGE_Escher_D108: G region invertase; PP_02199; phage(gi281199698) 7e-25 Click
6complement(2170601..2171176) PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_02200; phage(gi16129505) 2e-109 Click
7complement(2171176..2171385) PHAGE_Entero_HK630: tail fiber assembly protein; PP_02201; phage(gi428782810) 1e-15 Click
8complement(2171385..2173745) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_02202; phage(gi16129506) 3e-154 Click
9complement(2173815..2174579) PHAGE_Entero_mEp460: host specificity protein; PP_02203; phage(gi428782334) 7e-140 Click
10complement(2174552..2175940) PHAGE_Entero_mEp460: host specificity protein; PP_02204; phage(gi428782334) 0.0 Click
11complement(2175964..2176518) PHAGE_Entero_mEp460: minor tail protein; PP_02205; phage(gi428782331) 1e-93 Click
12complement(2176528..2176857) PHAGE_Entero_mEp460: minor tail protein; PP_02206; phage(gi428782330) 9e-61 Click
13complement(2176857..2177702) PHAGE_Entero_mEp460: tail length tape measure protein; PP_02207; phage(gi428782329) 5e-156 Click
142177667..2177819 hypothetical; PP_02208 0.0 Click
15complement(2177855..2178682) PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_02209; phage(gi16129505) 2e-103 Click
16complement(2178682..2178984) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_02210; phage(gi16129506) 4e-50 Click
17complement(2178968..2179585) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_02211; phage(gi16129506) 2e-98 Click
18complement(2179649..2179999) PHAGE_Entero_mEp460: hypothetical protein; PP_02212; phage(gi428782371) 3e-39 Click
19complement(2180134..2181144) PHAGE_Entero_mEp460: hypothetical protein; PP_02213; phage(gi428782365) 0.0 Click
20complement(2181152..2181442) PHAGE_Escher_HK75: RusA-like protein; PP_02214; phage(gi356870726) 5e-16 Click
21complement(2181455..2181787) PHAGE_Entero_mEp460: hypothetical protein; PP_02215; phage(gi428782365) 5e-54 Click
22complement(2181859..2182284) PHAGE_Entero_mEp460: tail length tape measure protein; PP_02216; phage(gi428782329) 5e-67 Click
23complement(2182256..2182573) PHAGE_Entero_mEp460: tail assembly protein; PP_02217; phage(gi428782328) 1e-56 Click
24complement(2182643..2182981) PHAGE_Entero_mEp460: minor tail protein; PP_02218; phage(gi428782327) 4e-50 Click
25complement(2183042..2183785) PHAGE_Entero_mEp460: major tail protein; PP_02219; phage(gi428782326) 7e-135 Click
26complement(2183796..2184197) PHAGE_Entero_mEp460: minor tail protein; PP_02220; phage(gi428782325) 6e-74 Click
27complement(2184194..2184430) PHAGE_Entero_mEp460: minor tail protein; PP_02221; phage(gi428782324) 9e-40 Click
28complement(2184423..2184980) PHAGE_Entero_mEp460: minor tail protein; PP_02222; phage(gi428782324) 4e-62 Click
29complement(2184992..2185267) PHAGE_Entero_mEp460: hypothetical protein; PP_02223; phage(gi428782323) 4e-47 Click
30complement(2185260..2185583) PHAGE_Entero_mEp460: hypothetical protein; PP_02224; phage(gi428782322) 1e-54 Click
31complement(2185670..2185810) PHAGE_Entero_mEp460: putative protease/scaffold protein; PP_02225; phage(gi428782321) 5e-21 Click
32complement(2185812..2187629) PHAGE_Entero_mEp460: putative protease/scaffold protein; PP_02226; phage(gi428782321) 0.0 Click
33complement(2187643..2189343) PHAGE_Entero_mEp460: portal protein; PP_02227; phage(gi428782320) 8e-174 Click
34complement(2189365..2189577) PHAGE_Entero_mEp460: hypothetical protein; PP_02228; phage(gi428782319) 8e-35 Click
35complement(2189574..2191676) PHAGE_Entero_mEp460: terminase large subunit; PP_02229; phage(gi428782318) 0.0 Click
36complement(2191676..2192644) PHAGE_Entero_mEp460: terminase small subunit; PP_02230; phage(gi428782317) 1e-75 Click
37complement(2193699..2193872) hypothetical protein ECS88_5024 [Escherichia coli S88] gi|218561577|ref|YP_002394490.1|; PP_02231 5e-23 Click
38complement(2194045..2194275) hypothetical protein ECS88_5023 [Escherichia coli S88] gi|218561576|ref|YP_002394489.1|; PP_02232 4e-36 Click
39complement(2194547..2194759) PHAGE_Lactoc_bIL312: Csp; PP_02233; phage(gi13095918) 1e-15 Click
40complement(2194781..2194912) hypothetical protein [Escherichia coli KO11FL] gi|378713017|ref|YP_005277910.1|; PP_02234 4e-15 Click
41complement(2195123..2195620) PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; PP_02235; phage(gi16765210) 2e-53 Click
42complement(2195617..2196150) PHAGE_Entero_mEp460: endolysin; PP_02236; phage(gi428782372) 3e-97 Click
43complement(2196147..2196458) PHAGE_Entero_mEp460: hypothetical protein; PP_02237; phage(gi428782371) 8e-28 Click
44complement(2196463..2196678) PHAGE_Entero_mEp460: porin; PP_02238; phage(gi428782370) 1e-33 Click
45complement(2196930..2197325) tolA protein (fragment) of prophage, partial [Escherichia coli 55989] gi|218695118|ref|YP_002402785.1|; PP_02239 8e-75 Click
46complement(2197476..2197904) TolA protein (fragment) of prophage, partial [Escherichia coli 55989] gi|218695119|ref|YP_002402786.1|; PP_02240 7e-76 Click
47complement(2198271..2198402) hypothetical protein SDY_1443 [Shigella dysenteriae Sd197] gi|82776726|ref|YP_403075.1|; PP_02241 3e-18 Click
482198731..2198847 hypothetical; PP_02242 0.0 Click
49complement(2198902..2198978) tRNA 0.0 Click
50complement(2199079..2199154) tRNA 0.0 Click
51complement(2199117..2199257) hypothetical; PP_02243 0.0 Click
52complement(2199298..2200119) PHAGE_Entero_HK225: late gene regulator Q; PP_02244; phage(gi428782441) 1e-88 Click

Region 9, total : 50 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12539301..2539380 attL    TTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA 0.0 Click
2complement(2539487..2540488) PHAGE_Haemop_HP2: integrase; PP_02600; phage(gi17981816) 3e-105 Click
3complement(2540494..2540841) hypothetical protein ECO26_2759 [Escherichia coli O26:H11 str. 11368] gi|260855847|ref|YP_003229738.1|; PP_02601 4e-62 Click
4complement(2540871..2541521) hypothetical protein ECSP_2484 [Escherichia coli O157:H7 str. TW14359] gi|254793534|ref|YP_003078371.1|; PP_02602 1e-118 Click
5complement(2541537..2541797) PHAGE_Burkho_phiE255: gp46; PP_02603; phage(gi134288790) 6e-10 Click
62542240..2542443 PHAGE_Vibrio_kappa: putative regulator; PP_02604; phage(gi165970239) 6e-10 Click
72542465..2542815 hypothetical protein ECSP_2487 [Escherichia coli O157:H7 str. TW14359] gi|254793537|ref|YP_003078374.1|; PP_02605 2e-63 Click
82542848..2543105 hypothetical protein ECSP_2488 [Escherichia coli O157:H7 str. TW14359] gi|254793538|ref|YP_003078375.1|; PP_02606 2e-25 Click
92543117..2543359 hypothetical protein SSON53_08345 [Shigella sonnei 53G] gi|383178214|ref|YP_005456219.1|; PP_02607 1e-38 Click
102543356..2543469 prophage membrane protein [Citrobacter rodentium ICC168] gi|283785691|ref|YP_003365556.1|; PP_02608 2e-11 Click
112543562..2543978 hypothetical protein ECSP_2490 [Escherichia coli O157:H7 str. TW14359] gi|254793540|ref|YP_003078377.1|; PP_02609 8e-69 Click
122544002..2544205 hypothetical protein G2583_2117 [Escherichia coli O55:H7 str. CB9615] gi|291282850|ref|YP_003499668.1|; PP_02610 3e-32 Click
132544465..2544764 PHAGE_Entero_mEp213: hypothetical protein; PP_02611; phage(gi428782624) 9e-08 Click
142545087..2545317 hypothetical protein Z2976 [Escherichia coli O157:H7 str. EDL933] gi|15802328|ref|NP_288354.1|; PP_02612 7e-36 Click
152545390..2545755 hypothetical protein ECSP_2493 [Escherichia coli O157:H7 str. TW14359] gi|254793543|ref|YP_003078380.1|; PP_02613 9e-63 Click
162545762..2548584 PHAGE_Yersin_413C: gpA; PP_02614; phage(gi30065742) 1e-78 Click
172548661..2549620 plasmid partition protein [Escherichia coli O26:H11 str. 11368] gi|260855860|ref|YP_003229751.1|; PP_02615 0.0 Click
182549625..2549936 plasmid partition protein [Escherichia coli O103:H2 str. 12009] gi|260844033|ref|YP_003221811.1|; PP_02616 4e-50 Click
192550000..2550248 PHAGE_Entero_ES18: gp41; PP_02617; phage(gi62362254) 3e-28 Click
20complement(2550474..2550860) hypothetical protein SSON53_14335 [Shigella sonnei 53G] gi|383179378|ref|YP_005457383.1|; PP_02618 2e-54 Click
21complement(2551535..2552581) PHAGE_Erwini_ENT90: phage portal protein; PP_02619; phage(gi431810941) 7e-92 Click
22complement(2552581..2554332) PHAGE_Yersin_413C: gpP; PP_02620; phage(gi30065706) 1e-131 Click
232554487..2555323 PHAGE_Salmon_RE_2010: capsid scaffolding protein; PP_02621; phage(gi418489698) 4e-46 Click
242555346..2556398 PHAGE_Yersin_413C: gpN; PP_02622; phage(gi30065708) 2e-72 Click
252556444..2557244 PHAGE_Ralsto_phiRSA1: terminase; PP_02623; phage(gi145708083) 5e-36 Click
262557346..2557840 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); PP_02624; phage(gi134288689) 1e-25 Click
272557840..2558040 PHAGE_Yersin_413C: gpX; PP_02625; phage(gi30065711) 9e-11 Click
282558043..2558366 PHAGE_Aeromo_phiO18P: putative holin; PP_02626; phage(gi148727161) 1e-09 Click
292558363..2558755 PHAGE_Entero_phiP27: putative endolysin; PP_02627; phage(gi18249894) 1e-53 Click
302558752..2559159 hypothetical protein ECO26_2463 [Escherichia coli O26:H11 str. 11368] gi|260855557|ref|YP_003229448.1|; PP_02628 6e-70 Click
312559297..2559764 PHAGE_Yersin_413C: gpR; PP_02629; phage(gi30065716) 1e-18 Click
322559757..2560392 PHAGE_Pseudo_phiCTX: predicted tail completion; PP_02630; phage(gi17313233) 6e-20 Click
332560389..2560970 PHAGE_Yersin_413C: gpV; PP_02631; phage(gi30065718) 1e-43 Click
342560967..2561317 PHAGE_Yersin_413C: gpW; PP_02632; phage(gi30065719) 1e-21 Click
352561321..2562217 PHAGE_Yersin_413C: gpJ; PP_02633; phage(gi30065720) 2e-84 Click
362562210..2562737 PHAGE_Yersin_413C: gpI; PP_02634; phage(gi30065721) 3e-72 Click
372562748..2565405 PHAGE_Yersin_413C: gpH; PP_02635; phage(gi30065722) 0.0 Click
382565405..2566022 PHAGE_Entero_HK630: tail fiber assembly protein; PP_02636; phage(gi428782810) 1e-87 Click
39complement(2565986..2566549) putative acetyltransferase with hexapeptide repeats [Escherichia coli ETEC H10407] gi|387615144|ref|YP_006118261.1|; PP_02637 5e-92 Click
40complement(2566720..2567208) PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_02638; phage(gi29143763) 3e-38 Click
41complement(2567221..2570028) PHAGE_Yersin_413C: gpT; PP_02639; phage(gi30065729) 1e-107 Click
42complement(2570015..2570170) PHAGE_Yersin_413C: gpE+E'; PP_02640; phage(gi30065728) 3e-07 Click
43complement(2570179..2570544) PHAGE_Mannhe_phiMHaA1: tail protein E; PP_02641; phage(gi109289962) 4e-08 Click
44complement(2570599..2571111) PROPHAGE_Salmon_Ty2: major tail tube protein; PP_02642; phage(gi29143759) 6e-36 Click
45complement(2571111..2572295) PHAGE_Erwini_ENT90: tail sheath protein; PP_02643; phage(gi431810939) 2e-100 Click
462572275..2572406 hypothetical; PP_02644 0.0 Click
472572453..2572785 PHAGE_Yersin_413C: gpD; PP_02645; phage(gi30065731) 2e-17 Click
482572782..2573027 PROPHAGE_Escher_EDL933: partial putative transposase; PP_02646; phage(gi15801060) 1e-35 Click
492573291..2574034 PHAGE_Yersin_413C: gpD; PP_02647; phage(gi30065731) 4e-59 Click
502574449..2575573 hypothetical protein ECO26_2801 [Escherichia coli O26:H11 str. 11368] gi|260855889|ref|YP_003229780.1|; PP_02648 0.0 Click
512576315..2576455 PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_02649; phage(gi410491667) 4e-16 Click
522577439..2577518 attR    TTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA 0.0 Click

Region 10, total : 52 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12681426..2682082 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_02769; phage(gi414086954) 3e-12 Click
22682164..2682643 PHAGE_Pseudo_YuA: hypothetical protein; PP_02770; phage(gi162135127) 2e-13 Click
32682655..2683029 hypothetical protein ECSF_1890 [Escherichia coli SE15] gi|387829943|ref|YP_003349880.1|; PP_02771 5e-53 Click
42683029..2683415 PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_02772; phage(gi414086954) 2e-10 Click
52683497..2683976 PHAGE_Pseudo_YuA: hypothetical protein; PP_02773; phage(gi162135127) 1e-13 Click
62683992..2684354 hypothetical protein ECSF_1890 [Escherichia coli SE15] gi|387829943|ref|YP_003349880.1|; PP_02774 8e-59 Click
7complement(2684358..2686526) PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_02775; phage(gi148609401) 4e-92 Click
8complement(2686594..2688825) PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_02776; phage(gi148609400) 0.0 Click
9complement(2688788..2689228) PHAGE_Entero_HK630: minor tail protein L; PP_02777; phage(gi428782805) 3e-66 Click
10complement(2689228..2689569) PHAGE_Stx2_c_1717: minor tail protein; PP_02778; phage(gi209447191) 8e-41 Click
11complement(2689562..2692801) PHAGE_Stx2_c_1717: tail tape measure protein; PP_02779; phage(gi209447190) 0.0 Click
12complement(2692847..2693137) PHAGE_Entero_HK544: tail protein; PP_02780; phage(gi428783227) 2e-29 Click
13complement(2693149..2693520) PHAGE_Stx2_c_1717: putative tail assembly chaperone; PP_02781; phage(gi209447188) 2e-42 Click
14complement(2693535..2694239) PHAGE_Entero_mEp234: major tail subunit; PP_02782; phage(gi428782264) 1e-93 Click
15complement(2694299..2694643) PHAGE_Cronob_ENT39118: putative minor tail protein; PP_02783; phage(gi431811079) 4e-32 Click
16complement(2694640..2695086) PHAGE_Entero_HK97: Gp10; PP_02784; phage(gi9634169) 7e-64 Click
17complement(2695433..2695663) PHAGE_Salmon_ST64B: hypothetical protein sb8; PP_02785; phage(gi23505453) 3e-05 Click
18complement(2695750..2695938) PHAGE_Salmon_ST64B: hypothetical protein sb7; PP_02786; phage(gi23505452) 2e-13 Click
19complement(2695990..2697195) PHAGE_Salmon_ST64B: Major capsid protein precursor; PP_02787; phage(gi23505451) 0.0 Click
20complement(2697210..2697860) PHAGE_Salmon_ST64B: Pro-head protease; PP_02788; phage(gi23505450) 5e-119 Click
21complement(2697838..2699079) PHAGE_Salmon_ST64B: Portal Protein; PP_02789; phage(gi23505449) 0.0 Click
22complement(2699079..2699261) PHAGE_Salmon_ST64B: putative integral membrane protein; PP_02790; phage(gi23505448) 4e-27 Click
23complement(2699273..2701030) PHAGE_Entero_mEp235: terminase large subunit; PP_02791; phage(gi428781812) 0.0 Click
24complement(2701030..2701350) PHAGE_Entero_mEp235: terminase small subunit; PP_02792; phage(gi428781811) 1e-47 Click
25complement(2701661..2702011) PHAGE_Salmon_ST64B: hypothetical protein sb56; PP_02793; phage(gi23505500) 7e-51 Click
26complement(2702019..2702219) hypothetical protein ESA_01023 [Cronobacter sakazakii ATCC BAA-894] gi|156933212|ref|YP_001437128.1|; PP_02794 1e-07 Click
272702575..2702949 hypothetical protein xccb100_1044 [Xanthomonas campestris pv. campestris str. B100] gi|188990440|ref|YP_001902450.1|; PP_02795 4e-22 Click
28complement(2703128..2703595) PHAGE_Entero_cdtI: lysin; PP_02796; phage(gi148609441) 2e-73 Click
29complement(2703791..2703925) PHAGE_Entero_mEp460: hypothetical protein; PP_02797; phage(gi428782371) 6e-10 Click
30complement(2703930..2704145) PHAGE_Escher_P13374: lysis protein, holin; PP_02798; phage(gi410491645) 2e-26 Click
31complement(2704260..2704376) hypothetical; PP_02799 0.0 Click
32complement(2704438..2704512) tRNA 0.0 Click
33complement(2704516..2704591) tRNA 0.0 Click
34complement(2704594..2704670) tRNA 0.0 Click
35complement(2704672..2704747) tRNA 0.0 Click
36complement(2704942..2705631) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_02800; phage(gi169257244) 3e-81 Click
37complement(2705628..2705987) PHAGE_Escher_HK75: RusA-like protein; PP_02801; phage(gi356870726) 4e-39 Click
38complement(2706046..2706792) PHAGE_Salmon_ST64B: hypothetical protein sb47; PP_02802; phage(gi23505491) 3e-53 Click
392707109..2707288 hypothetical protein ECNA114_48171 [Escherichia coli NA114] gi|386622361|ref|YP_006141941.1|; PP_02803 8e-27 Click
40complement(2707723..2708289) hypothetical protein CE10_1450 [Escherichia coli O7:K1 str. CE10] gi|386623816|ref|YP_006143544.1|; PP_02804 4e-111 Click
41complement(2708563..2708988) phage protein [Escherichia coli O104:H4 str. 2011C-3493] gi|407482397|ref|YP_006779546.1|; PP_02805 3e-73 Click
42complement(2709029..2710123) PHAGE_Salmon_ST64B: putative replication protein; PP_02806; phage(gi23505486) 1e-26 Click
43complement(2710195..2710620) PHAGE_Pectob_ZF40: putative cII repressor; PP_02807; phage(gi422936652) 3e-06 Click
442711151..2711405 hypothetical protein i02_1291 [Escherichia coli str. 'clone D i2'] gi|386628776|ref|YP_006148496.1|; PP_02808 2e-40 Click
452711590..2711826 PHAGE_Salico_CGphi29: hypothetical protein; PP_02809; phage(gi472340166) 2e-09 Click
462711828..2711956 hypothetical protein ECW_m1736 [Escherichia coli W] gi|386608962|ref|YP_006124448.1|; PP_02810 7e-15 Click
472711986..2712204 hypothetical protein i02_1288 [Escherichia coli str. 'clone D i2'] gi|386628773|ref|YP_006148493.1|; PP_02811 9e-34 Click
482712227..2712556 PHAGE_Escher_TL_2011c: hypothetical protein; PP_02812; phage(gi418487085) 2e-06 Click
49complement(2712525..2712962) hypothetical protein ECO26_1774 [Escherichia coli O26:H11 str. 11368] gi|260854921|ref|YP_003228812.1|; PP_02813 1e-18 Click
50complement(2713163..2713333) hypothetical protein ECNA114_4765 [Escherichia coli NA114] gi|386622308|ref|YP_006141888.1|; PP_02814 5e-28 Click
512713367..2713588 PHAGE_Escher_HK639: hypothetical protein; PP_02815; phage(gi356870641) 7e-05 Click
522713712..2714983 PHAGE_Salmon_ST64B: Endodeoxyribonuclease; PP_02816; phage(gi23505474) 5e-33 Click
532715042..2715245 hypothetical protein ECOK1_2138 [Escherichia coli IHE3034] gi|386599805|ref|YP_006101311.1|; PP_02817 4e-33 Click
542715245..2716270 PHAGE_Salmon_ST64B: Integrase protein; PP_02818; phage(gi23505472) 7e-105 Click
55complement(2716323..2716412) tRNA 0.0 Click
562716506..2717303 DgsA anti-repressor MtfA [Escherichia coli O104:H4 str. 2011C-3493] gi|407481496|ref|YP_006778645.1|; PP_02819 1e-154 Click
572717404..2717479 tRNA 0.0 Click
582717641..2718903 PROPHAGE_Escher_CFT073: prophage P4 integrase; PP_02820; phage(gi26248270) 0.0 Click

Region 11, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2826534..2826719) PROPHAGE_Escher_EDL933: putative transposase; PP_02922; phage(gi15803522) 4e-21 Click
2complement(2826873..2827037) PROPHAGE_Escher_CFT073: putative transposase; PP_02923; phage(gi26246170) 9e-11 Click
32827145..2827282 hypothetical; PP_02924 0.0 Click
4complement(2827897..2828676) PHAGE_Staphy_phiN315: probable ss-1,3-N-acetylglucosaminyltransferase; PP_02925; phage(gi30043988) 2e-12 Click
5complement(2828789..2828917) hypothetical; PP_02926 0.0 Click
6complement(2829008..2829901) PHAGE_Sphing_PAU: gp187; PP_02927; phage(gi435844690) 3e-12 Click
7complement(2830144..2831139) PHAGE_Canary_virus: CNPV063 hydroxysteroid dehydrogenase-like protein; PP_02928; phage(gi40556001) 2e-11 Click
8complement(2831297..2832691) PHAGE_Cronob_vB_CskP_GAP227: putative tail fiber protein; PP_02929; phage(gi448260265) 9e-19 Click

Region 12, total : 41 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15027395..5027568 PHAGE_Entero_mEp460: hypothetical protein; PP_05003; phage(gi428782340) 8e-25 Click
2complement(5027616..5027909) PHAGE_Entero_mEp460: hypothetical protein; PP_05004; phage(gi428782341) 3e-49 Click
3complement(5027934..5028506) PHAGE_Entero_mEp460: putative exonuclease; PP_05005; phage(gi428782342) 3e-107 Click
4complement(5028506..5029072) PHAGE_Entero_mEp460: hypothetical protein; PP_05006; phage(gi428782343) 2e-78 Click
5complement(5029075..5029263) PHAGE_Entero_mEp460: hypothetical protein; PP_05007; phage(gi428782344) 2e-24 Click
6complement(5029265..5029783) PHAGE_Entero_ES18: gp41; PP_05008; phage(gi62362254) 5e-33 Click
7complement(5029780..5030220) PHAGE_Pectob_ZF40: putative methylase; PP_05009; phage(gi422936660) 8e-62 Click
8complement(5030262..5030612) PHAGE_Entero_phiV10: eae-like protein; PP_05010; phage(gi89152462) 1e-37 Click
9complement(5030603..5031151) PHAGE_Entero_mEp460: hypothetical protein; PP_05011; phage(gi428782349) 4e-99 Click
105031261..5031428 hypothetical; PP_05012 0.0 Click
115031684..5031929 hypothetical; PP_05013 0.0 Click
12complement(5032478..5033164) PHAGE_Erwini_phiEt88: phage repressor protein; PP_05014; phage(gi327198606) 5e-27 Click
135033302..5033550 PHAGE_Aggreg_S1249: phage protein; PP_05015; phage(gi273809591) 7e-05 Click
145033573..5034130 PHAGE_Entero_mEp460: hypothetical protein; PP_05016; phage(gi428782356) 4e-94 Click
155034306..5034485 hypothetical protein APECO78_04710 [Escherichia coli APEC O78] gi|443616267|ref|YP_007380123.1|; PP_05017 2e-14 Click
165034472..5034684 hypothetical protein APECO78_04710 [Escherichia coli APEC O78] gi|443616267|ref|YP_007380123.1|; PP_05018 1e-28 Click
175034641..5035633 PHAGE_Erwini_PEp14: putative phage O family protein; PP_05019; phage(gi374531901) 2e-35 Click
185035630..5036124 PHAGE_Entero_mEp460: hypothetical protein; PP_05020; phage(gi428782360) 7e-90 Click
195036124..5036777 PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; PP_05021; phage(gi428782361) 2e-126 Click
205036774..5037100 PHAGE_Entero_mEp460: LexA DNA binding domain protein; PP_05022; phage(gi428782362) 3e-55 Click
215037097..5037486 PHAGE_Entero_mEp460: holliday junction resolvase; PP_05023; phage(gi428782363) 1e-70 Click
22complement(5037449..5037832) hypothetical; PP_05024 0.0 Click
235037961..5038164 PHAGE_Escher_TL_2011c: putative late gene regulator Q; PP_05025; phage(gi418487066) 5e-27 Click
24complement(5038230..5038364) hypothetical; PP_05026 0.0 Click
255038478..5038885 hypothetical protein YPK_3837 [Yersinia pseudotuberculosis YPIII] gi|170026050|ref|YP_001722555.1|; PP_05027 7e-34 Click
265038921..5039652 pertussis toxin s1 subunit [Salmonella bongori NCTC 12419] gi|339998915|ref|YP_004729798.1|; PP_05028 6e-82 Click
275040130..5040417 PHAGE_Entero_mEp460: porin; PP_05029; phage(gi428782370) 4e-30 Click
285040422..5040715 PHAGE_Entero_mEp460: endolysin; PP_05030; phage(gi428782372) 5e-45 Click
295040712..5041179 PHAGE_Entero_mEp460: Rz lysis protein; PP_05031; phage(gi428782373) 4e-82 Click
305041167..5041319 PHAGE_Entero_mEp460: hypothetical protein; PP_05032; phage(gi428782374) 7e-23 Click
31complement(5041461..5041637) arginyl-tRNA synthetase [Escherichia coli O7:K1 str. CE10] gi|386622925|ref|YP_006142653.1|; PP_05033 3e-18 Click
325041636..5042004 PHAGE_Entero_mEp460: hypothetical protein; PP_05034; phage(gi428782375) 2e-17 Click
335041994..5042230 PHAGE_Entero_mEp460: terminase small subunit; PP_05035; phage(gi428782317) 2e-18 Click
345042389..5042922 PHAGE_Entero_mEp460: endolysin; PP_05036; phage(gi428782372) 8e-101 Click
35complement(5042934..5043167) hypothetical; PP_05037 0.0 Click
365043382..5043543 hypothetical protein ECH74115_B0065 [Escherichia coli O157:H7 str. EC4115] gi|209395553|ref|YP_002268445.1|; PP_05038 3e-22 Click
375043569..5043877 PHAGE_Xantho_vB_XveM_DIBBI: single-stranded DNA-binding protein; PP_05039; phage(gi389060431) 1e-38 Click
385043846..5045204 hypothetical protein P12B_c2101 [Escherichia coli P12b] gi|386705271|ref|YP_006169118.1|; PP_05040 0.0 Click
395045270..5045482 hypothetical protein SDY_1664 [Shigella dysenteriae Sd197] gi|82776927|ref|YP_403276.1|; PP_05041 9e-34 Click
405045493..5045996 PROPHAGE_Escher_MG1655: IS1 transposase B; PP_05042; phage(gi16131317) 2e-87 Click
41complement(5046090..5046671) PHAGE_Entero_HK630: tail fiber assembly protein; PP_05043; phage(gi428782810) 3e-106 Click
42complement(5046671..5047099) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_05044; phage(gi16129506) 2e-14 Click

Region 13, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5210931..5211269) PHAGE_Entero_mEp460: tail fiber component; PP_05286; phage(gi428782332) 5e-65 Click
25211386..5212462 PHAGE_Vibrio_vB_VchM_138: putative helicase; PP_05287; phage(gi422936549) 2e-05 Click
35212531..5212851 type I restriction-modification system (hsdR-like) [Escherichia coli S88] gi|218561523|ref|YP_002394436.1|; PP_05288 5e-52 Click
45213674..5214204 hypothetical protein EC55989_4882 [Escherichia coli 55989] gi|218698072|ref|YP_002405739.1|; PP_05289 7e-95 Click
5complement(5214234..5215634) PHAGE_Stx2_c_1717: transposase; PP_05290; phage(gi209447153) 2e-146 Click
6complement(5215684..5216436) PHAGE_Stx2_c_1717: transposase; PP_05291; phage(gi209447153) 2e-87 Click
7complement(5216387..5217061) PHAGE_Stx2_c_1717: transposase; PP_05292; phage(gi209447153) 2e-42 Click
85217106..5217399 transposase [Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633] gi|194733801|ref|YP_002112915.1|; PP_05293 8e-51 Click
9complement(5217376..5217735) hypothetical; PP_05294 0.0 Click
105217748..5218566 colicin Ib protein [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447260|ref|YP_002043857.1|; PP_05295 1e-126 Click
115218541..5219581 PROPHAGE_Brucel_1330: transposase, putative; PP_05296; phage(gi23501616) 2e-31 Click
125219628..5220215 PROPHAGE_Brucel_1330: transposase, putative; PP_05297; phage(gi23502708) 2e-11 Click
135220197..5220634 hypothetical protein ECH74115_B0048 [Escherichia coli O157:H7 str. EC4115] gi|209395534|ref|YP_002268429.1|; PP_05298 3e-83 Click
14complement(5220787..5220912) hypothetical protein ECH74115_B0049 [Escherichia coli O157:H7 str. EC4115] gi|209395539|ref|YP_002268431.1|; PP_05299 2e-15 Click
15complement(5221093..5223588) PHAGE_Entero_mEp460: host specificity protein; PP_05300; phage(gi428782334) 0.0 Click

Region 14, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5228107..5229000) PHAGE_Entero_mEp460: host specificity protein; PP_05305; phage(gi428782334) 8e-141 Click
2complement(5229061..5229297) PHAGE_Entero_mEp460: tail assembly protein; PP_05306; phage(gi428782333) 4e-38 Click
3complement(5230328..5232337) PHAGE_Entero_mEp460: tail length tape measure protein; PP_05307; phage(gi428782329) 0.0 Click
4complement(5232342..5232557) PHAGE_Entero_mEp460: hypothetical protein; PP_05308; phage(gi428782365) 2e-21 Click
5complement(5232565..5233374) PHAGE_Entero_mEp460: KilA-N domain protein; PP_05309; phage(gi428782364) 6e-153 Click
65233413..5233967 PHAGE_Entero_mEp460: tail fiber component; PP_05310; phage(gi428782332) 1e-109 Click
75233964..5234578 PHAGE_Entero_mEp460: tail assembly protein; PP_05311; phage(gi428782333) 5e-73 Click
85234614..5235282 hypothetical protein STMDT12_C39340 [Salmonella enterica subsp. enterica serovar Typhimurium str. T000240] gi|378986474|ref|YP_005249630.1|; PP_05312 5e-126 Click
9complement(5235404..5235994) hypothetical protein SeHA_A0021 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447229|ref|YP_002043860.1|; PP_05313 1e-105 Click
10complement(5235991..5236293) hypothetical protein SSON_2656 [Shigella sonnei Ss046] gi|74313095|ref|YP_311514.1|; PP_05314 3e-43 Click
11complement(5236332..5236484) PHAGE_Entero_mEp460: hypothetical protein; PP_05315; phage(gi428782365) 3e-20 Click
12complement(5236492..5237133) PHAGE_Entero_mEp460: KilA-N domain protein; PP_05316; phage(gi428782364) 2e-120 Click
13complement(5237235..5237618) PHAGE_Entero_mEp460: host specificity protein; PP_05317; phage(gi428782334) 2e-63 Click
14complement(5237612..5238697) PHAGE_Entero_mEp460: host specificity protein; PP_05318; phage(gi428782334) 2e-101 Click
155238931..5239077 PHAGE_Entero_HK630: capsid assembly protein nu3; PP_05319; phage(gi428782793) 5e-14 Click
165239081..5239419 PHAGE_Entero_HK630: head decoration protein D; PP_05320; phage(gi428782794) 4e-57 Click
175239475..5239717 PHAGE_Entero_HK630: major head subunit E; PP_05321; phage(gi428782795) 1e-39 Click
18complement(5239822..5240280) PROPHAGE_Salmon_Ty2: transposase; PP_05322; phage(gi29143766) 3e-85 Click
19complement(5240237..5240425) hypothetical protein ECS88_0034 [Escherichia coli S88] gi|218556972|ref|YP_002389885.1|; PP_05323 2e-30 Click
20complement(5240401..5240622) PHAGE_Entero_mEp460: Lom protein; PP_05324; phage(gi428782335) 7e-29 Click
21complement(5240693..5240824) PHAGE_Entero_mEp460: host specificity protein; PP_05325; phage(gi428782334) 3e-17 Click
225241160..5241300 plasmid stability protein [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447289|ref|YP_002043873.1|; PP_05326 1e-18 Click
23complement(5241302..5241691) PHAGE_Cronob_ENT39118: DNA polymerase; PP_05327; phage(gi431811050) 3e-37 Click
24complement(5241672..5241824) PHAGE_Cronob_ENT39118: DNA polymerase; PP_05328; phage(gi431811050) 4e-10 Click
25complement(5241895..5242413) PHAGE_Entero_mEp460: host specificity protein; PP_05329; phage(gi428782334) 5e-92 Click
26complement(5242966..5243694) hypothetical protein P12B_c2101 [Escherichia coli P12b] gi|386705271|ref|YP_006169118.1|; PP_05330 3e-110 Click
27complement(5243718..5244344) PROPHAGE_Escher_CFT073: transposase insF; PP_05331; phage(gi26249410) 3e-27 Click
28complement(5244375..5244935) PHAGE_Entero_mEp460: host specificity protein; PP_05332; phage(gi428782334) 2e-83 Click
295245048..5245284 PHAGE_Entero_mEp460: tail assembly protein; PP_05333; phage(gi428782333) 4e-38 Click
305245345..5245563 PHAGE_Entero_mEp460: host specificity protein; PP_05334; phage(gi428782334) 1e-34 Click
31complement(5246119..5246637) PHAGE_Entero_mEp460: tail fiber component; PP_05335; phage(gi428782332) 5e-97 Click
325246628..5246792 hypothetical protein c1463 [Escherichia coli CFT073] gi|26247332|ref|NP_753372.1|; PP_05336 7e-09 Click
335246796..5247365 PHAGE_Entero_mEp460: host specificity protein; PP_05337; phage(gi428782334) 3e-92 Click
345247325..5247483 hypothetical protein SeHA_A0021 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447229|ref|YP_002043860.1|; PP_05338 3e-22 Click
35complement(5247503..5248402) PHAGE_Entero_mEp460: tail length tape measure protein; PP_05339; phage(gi428782329) 4e-89 Click
36complement(5248393..5248530) PHAGE_Entero_mEp460: tail fiber component; PP_05340; phage(gi428782332) 5e-20 Click