Escherichia coli H591 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].4918687, GC%: 50.71%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 51 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1666256..666270 attL    ACGCCGCATCCGGCA 0.0 Click
2complement(667704..668774) PHAGE_Entero_lambda: integration protein; PP_00693; phage(gi9626273) 0.0 Click
3669022..669192 hypothetical protein ETEC_0781 [Escherichia coli ETEC H10407] gi|387611256|ref|YP_006114372.1|; PP_00694 3e-27 Click
4669420..670022 putative transmembrane protein [Escherichia coli ETEC H10407] gi|387611257|ref|YP_006114373.1|; PP_00695 1e-114 Click
5complement(670553..670768) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_00696; phage(gi20065893) 2e-34 Click
6complement(670845..670958) PHAGE_Entero_lambda: hypothetical protein lambdap38; PP_00697; phage(gi9626278) 1e-13 Click
7complement(671188..671868) PHAGE_Entero_2008: putative exonuclease; PP_00698; phage(gi209427739) 7e-131 Click
8complement(671865..672650) PHAGE_Entero_lambda: bet; PP_00699; phage(gi9626281) 7e-151 Click
9complement(672656..672952) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_00700; phage(gi116222045) 3e-52 Click
10complement(673028..673186) PHAGE_Entero_HK225: Kil protein; PP_00701; phage(gi428782413) 1e-20 Click
11673545..673556 attL    AAAAGTTGTTTT 0.0 Click
12complement(673832..674587) PHAGE_Entero_ST104: CI; PP_00702; phage(gi46358671) 5e-94 Click
13674626..674856 PHAGE_Escher_HK639: cro; PP_00703; phage(gi356870651) 2e-19 Click
14674926..675465 PHAGE_Entero_mEp237: CII protein; PP_00704; phage(gi435439306) 3e-64 Click
15675462..676481 PHAGE_Entero_lambda: DNA replication protein; PP_00705; phage(gi9626295) 7e-112 Click
16676478..677179 PHAGE_Entero_lambda: DNA replication protein; PP_00706; phage(gi9626296) 3e-128 Click
17677176..677478 PHAGE_Entero_lambda: ren exclusion protein; PP_00707; phage(gi9626297) 2e-43 Click
18677546..677878 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; PP_00708; phage(gi311992758) 1e-10 Click
19677927..678076 hypothetical protein NRG857_05587 [Escherichia coli O83:H1 str. NRG 857C] gi|387616458|ref|YP_006119480.1|; PP_00709 2e-14 Click
20678134..679660 PHAGE_Bacill_WBeta: putative site-specific recombinase; PP_00710; phage(gi85701406) 3e-08 Click
21complement(679883..680020) hypothetical; PP_00711 0.0 Click
22680270..681052 hypothetical protein GFO_0889 [Gramella forsetii KT0803] gi|120435244|ref|YP_860930.1|; PP_00712 7e-48 Click
23681245..681700 PHAGE_Cronob_phiES15: hypothetical protein; PP_00713; phage(gi401817579) 2e-61 Click
24681863..682153 PHAGE_Entero_mEp237: hypothetical protein; PP_00714; phage(gi435439317) 6e-49 Click
25682150..682512 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_00715; phage(gi435439318) 9e-61 Click
26682509..682649 PHAGE_Entero_mEp237: hypothetical protein; PP_00716; phage(gi435439319) 1e-11 Click
27682735..683118 PHAGE_Entero_2008: antitermination protein Q; PP_00717; phage(gi209427762) 6e-57 Click
28complement(683308..684390) outer membrane porin, DLP12 prophage [Escherichia coli O104:H4 str. 2011C-3493] gi|407483057|ref|YP_006780206.1|; PP_00718 0.0 Click
29684979..685194 PHAGE_Stx2_c_II: holin; PP_00719; phage(gi302393164) 4e-28 Click
30685194..685691 PHAGE_Entero_cdtI: lysin; PP_00720; phage(gi148609440) 2e-91 Click
31685776..685982 PHAGE_Salmon_SPN9CC: phage lysozyme; PP_00721; phage(gi389060531) 2e-35 Click
32685979..686416 PHAGE_Escher_HK75: Rz; PP_00722; phage(gi356870731) 3e-73 Click
33686621..687142 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_00723; phage(gi399498859) 1e-100 Click
34complement(687959..688132) PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_00724; phage(gi209427772) 3e-10 Click
35688298..688441 hypothetical protein ECIAI1_1590 [Escherichia coli IAI1] gi|218554109|ref|YP_002387022.1|; PP_00725 5e-19 Click
36688581..689126 PHAGE_Entero_lambda: DNA packaging protein; PP_00726; phage(gi9626244) 7e-98 Click
37689101..691026 PHAGE_Entero_lambda: DNA packaging protein; PP_00727; phage(gi9626245) 0.0 Click
38691023..691229 PHAGE_Entero_lambda: head-tail joining protein; PP_00728; phage(gi9626246) 4e-32 Click
39691226..692827 PHAGE_Entero_lambda: capsid component; PP_00729; phage(gi9626247) 0.0 Click
40692808..694127 PHAGE_Entero_lambda: capsid component; PP_00730; phage(gi9626248) 0.0 Click
41694137..694469 PHAGE_Entero_lambda: head-DNA stabilization protein; PP_00731; phage(gi9626250) 2e-57 Click
42694525..695550 PHAGE_Entero_lambda: capsid component; PP_00732; phage(gi9626251) 0.0 Click
43695592..695987 PHAGE_Entero_lambda: DNA packaging protein; PP_00733; phage(gi9626252) 2e-57 Click
44695999..696352 PHAGE_Entero_lambda: head-tail joining protein; PP_00734; phage(gi9626253) 4e-61 Click
45696364..696942 PHAGE_Entero_lambda: tail component; PP_00735; phage(gi9626254) 1e-100 Click
46696939..697334 PHAGE_Entero_lambda: tail component; PP_00736; phage(gi9626255) 3e-71 Click
47697342..698082 PHAGE_Entero_lambda: tail component; PP_00737; phage(gi9626256) 3e-134 Click
48698098..698520 PHAGE_Entero_lambda: tail component; PP_00738; phage(gi9626257) 5e-64 Click
49698502..698936 PHAGE_Entero_lambda: tail component; PP_00739; phage(gi9626258) 4e-81 Click
50698929..701490 PHAGE_Entero_lambda: tail component; PP_00740; phage(gi9626259) 0.0 Click
51701487..701816 PHAGE_Entero_lambda: tail component; PP_00741; phage(gi9626260) 3e-58 Click
52701816..702310 PHAGE_Entero_lambda: tail component; PP_00742; phage(gi9626261) 9e-74 Click
53702315..702491 PHAGE_Entero_lambda: Putative fiber assembly protein; PP_00743; phage(gi9626269) 2e-26 Click
54704928..704939 attR    AAAAGTTGTTTT 0.0 Click
55713222..713236 attR    ACGCCGCATCCGGCA 0.0 Click

Region 2, total : 46 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1786667..786680 attL    AACAAAAAACCCAT 0.0 Click
2complement(786755..787807) PHAGE_Entero_2: P2 Int-like protein; PP_00826; phage(gi169936064) 1e-100 Click
3complement(787891..789567) PHAGE_Entero_ES18: gp19; PP_00827; phage(gi62362232) 9e-71 Click
4complement(789588..790184) PHAGE_Entero_2: P2 CI-like protein; PP_00828; phage(gi169936063) 1e-36 Click
5790280..790501 PHAGE_Pasteu_F108: Cox; PP_00829; phage(gi109302900) 1e-06 Click
6790534..791043 PHAGE_Entero_2: bacteriophage regulatory protein CII; PP_00830; phage(gi169936061) 1e-83 Click
7791051..791251 PHAGE_Entero_2: hypothetical protein STM2735.Fels2; PP_00831; phage(gi169936060) 8e-14 Click
8791215..791556 PHAGE_Entero_2: hypothetical protein STM2733.Fels2; PP_00832; phage(gi169936058) 8e-52 Click
9791624..791857 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; PP_00833; phage(gi169936057) 1e-27 Click
10791857..792084 PHAGE_Entero_2: P2 gpOrf82-like protein; PP_00834; phage(gi169936056) 7e-35 Click
11792081..792938 PHAGE_Entero_2: DNA adenine methylase-like protein; PP_00835; phage(gi169936055) 5e-117 Click
12792935..794788 PHAGE_Entero_2: P2 gpA-like protein; PP_00836; phage(gi169936054) 0.0 Click
13795051..795347 PHAGE_Entero_2: P2 gpA-like protein; PP_00837; phage(gi169936054) 3e-48 Click
14795501..795689 PHAGE_Entero_2: hypothetical protein STM2728.Fels2; PP_00838; phage(gi169936053) 5e-29 Click
15795700..795933 PHAGE_Entero_2: TumB protein; PP_00839; phage(gi169936052) 8e-38 Click
16796262..798154 KAP P-loop domain-containing protein [Desulfovibrio salexigens DSM 2638] gi|242280946|ref|YP_002993075.1|; PP_00840 1e-60 Click
17799169..800128 hypothetical protein E2348C_0815 [Escherichia coli O127:H6 str. E2348/69] gi|215485950|ref|YP_002328381.1|; PP_00841 5e-177 Click
18complement(800153..801178) PHAGE_Entero_2: P2 gpQ-like protein; PP_00842; phage(gi169936049) 3e-172 Click
19complement(801178..802944) PHAGE_Entero_2: P2 gpP-like protein; PP_00843; phage(gi169936048) 0.0 Click
20complement(802954..803088) hypothetical protein KO11_19445 [Escherichia coli KO11FL] gi|386702370|ref|YP_006166207.1|; PP_00844 7e-17 Click
21803087..803920 PHAGE_Entero_2: P2 gpO-like protein; PP_00845; phage(gi169936047) 1e-130 Click
22803937..804995 PHAGE_Entero_2: P2 gpN-like major capsid protein; PP_00846; phage(gi169936046) 4e-179 Click
23804999..805649 PHAGE_Entero_2: P2 gpM-like protein; PP_00847; phage(gi169936045) 3e-113 Click
24805745..806209 PHAGE_Entero_2: P2 gpL-like protein; PP_00848; phage(gi169936044) 2e-78 Click
25806209..806412 PHAGE_Entero_2: P2 gpX-like tail protein; PP_00849; phage(gi169936043) 1e-32 Click
26806416..806631 PHAGE_Entero_2: lysis protein; PP_00850; phage(gi169936042) 2e-28 Click
27806612..807124 PHAGE_Entero_2: endolysin; PP_00851; phage(gi169936041) 2e-80 Click
28807126..807503 hypothetical protein CE10_1736 [Escherichia coli O7:K1 str. CE10] gi|386624090|ref|YP_006143818.1|; PP_00852 9e-63 Click
29807500..807928 PHAGE_Entero_2: P2 LysB-like protein; PP_00853; phage(gi169936038) 1e-57 Click
30807888..808061 PHAGE_Entero_2: P2 LysC-like protein; PP_00854; phage(gi169936037) 2e-19 Click
31808024..808455 PHAGE_Entero_2: P2 gpR-like tail completion protein; PP_00855; phage(gi169936036) 1e-71 Click
32808448..808894 PHAGE_Entero_2: P2 gpS-like tail completion protein; PP_00856; phage(gi169936035) 4e-72 Click
33808963..809541 PHAGE_Entero_2: P2 gpV-like protein; PP_00857; phage(gi169936034) 4e-94 Click
34809538..809897 PHAGE_Entero_2: P2 gpW-like baseplate protein; PP_00858; phage(gi169936033) 1e-51 Click
35809884..810792 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; PP_00859; phage(gi169936032) 7e-148 Click
36810785..811390 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; PP_00860; phage(gi169936031) 2e-111 Click
37811387..812130 PHAGE_Entero_2: P2 gpH-like protein; PP_00861; phage(gi169936030) 5e-116 Click
38812386..812952 PHAGE_Entero_2: DNA-invertase; PP_00862; phage(gi169936026) 2e-88 Click
39complement(812910..813050) hypothetical; PP_00863 0.0 Click
40813095..814267 PHAGE_Entero_2: P2 gpFI-like protein; PP_00864; phage(gi169936025) 0.0 Click
41814277..814792 PHAGE_Entero_2: P2 gpFII-like protein; PP_00865; phage(gi169936024) 4e-91 Click
42814847..815149 PHAGE_Entero_2: P2 gpE-like tail protein; PP_00866; phage(gi169936023) 2e-44 Click
43815164..815283 PHAGE_Entero_2: P2 gpE-like protein; PP_00867; phage(gi169936022) 4e-15 Click
44815276..818353 PHAGE_Entero_2: P2 gpT-like tail protein; PP_00868; phage(gi169936021) 0.0 Click
45818350..818835 PHAGE_Entero_2: P2 gpU-like tail protein; PP_00869; phage(gi169936020) 1e-74 Click
46818832..819932 PHAGE_Entero_2: P2 gpD-like tail protein; PP_00870; phage(gi169936019) 0.0 Click
47820023..820241 PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); PP_00871; phage(gi169936018) 2e-22 Click
48820319..820332 attR    AACAAAAAACCCAT 0.0 Click

Region 3, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(800153..801178) PHAGE_Entero_2: P2 gpQ-like protein; PP_00842; phage(gi169936049) 3e-172 Click
2complement(801178..802944) PHAGE_Entero_2: P2 gpP-like protein; PP_00843; phage(gi169936048) 0.0 Click
3complement(802954..803088) hypothetical protein KO11_19445 [Escherichia coli KO11FL] gi|386702370|ref|YP_006166207.1|; PP_00844 7e-17 Click
4803087..803920 PHAGE_Entero_2: P2 gpO-like protein; PP_00845; phage(gi169936047) 1e-130 Click
5803937..804995 PHAGE_Entero_2: P2 gpN-like major capsid protein; PP_00846; phage(gi169936046) 4e-179 Click
6804999..805649 PHAGE_Entero_2: P2 gpM-like protein; PP_00847; phage(gi169936045) 3e-113 Click
7805745..806209 PHAGE_Entero_2: P2 gpL-like protein; PP_00848; phage(gi169936044) 2e-78 Click
8806209..806412 PHAGE_Entero_2: P2 gpX-like tail protein; PP_00849; phage(gi169936043) 1e-32 Click
9806416..806631 PHAGE_Entero_2: lysis protein; PP_00850; phage(gi169936042) 2e-28 Click
10806612..807124 PHAGE_Entero_2: endolysin; PP_00851; phage(gi169936041) 2e-80 Click
11807126..807503 hypothetical protein CE10_1736 [Escherichia coli O7:K1 str. CE10] gi|386624090|ref|YP_006143818.1|; PP_00852 9e-63 Click
12807500..807928 PHAGE_Entero_2: P2 LysB-like protein; PP_00853; phage(gi169936038) 1e-57 Click
13807888..808061 PHAGE_Entero_2: P2 LysC-like protein; PP_00854; phage(gi169936037) 2e-19 Click
14808024..808455 PHAGE_Entero_2: P2 gpR-like tail completion protein; PP_00855; phage(gi169936036) 1e-71 Click
15808448..808894 PHAGE_Entero_2: P2 gpS-like tail completion protein; PP_00856; phage(gi169936035) 4e-72 Click
16808963..809541 PHAGE_Entero_2: P2 gpV-like protein; PP_00857; phage(gi169936034) 4e-94 Click
17809538..809897 PHAGE_Entero_2: P2 gpW-like baseplate protein; PP_00858; phage(gi169936033) 1e-51 Click
18809884..810792 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; PP_00859; phage(gi169936032) 7e-148 Click
19810785..811390 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; PP_00860; phage(gi169936031) 2e-111 Click
20811387..812130 PHAGE_Entero_2: P2 gpH-like protein; PP_00861; phage(gi169936030) 5e-116 Click
21812386..812952 PHAGE_Entero_2: DNA-invertase; PP_00862; phage(gi169936026) 2e-88 Click
22complement(812910..813050) hypothetical; PP_00863 0.0 Click
23813095..814267 PHAGE_Entero_2: P2 gpFI-like protein; PP_00864; phage(gi169936025) 0.0 Click
24814277..814792 PHAGE_Entero_2: P2 gpFII-like protein; PP_00865; phage(gi169936024) 4e-91 Click
25814847..815149 PHAGE_Entero_2: P2 gpE-like tail protein; PP_00866; phage(gi169936023) 2e-44 Click
26815164..815283 PHAGE_Entero_2: P2 gpE-like protein; PP_00867; phage(gi169936022) 4e-15 Click
27815276..818353 PHAGE_Entero_2: P2 gpT-like tail protein; PP_00868; phage(gi169936021) 0.0 Click
28818350..818835 PHAGE_Entero_2: P2 gpU-like tail protein; PP_00869; phage(gi169936020) 1e-74 Click
29818832..819932 PHAGE_Entero_2: P2 gpD-like tail protein; PP_00870; phage(gi169936019) 0.0 Click
30820023..820241 PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); PP_00871; phage(gi169936018) 2e-22 Click

Region 4, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11310499..1310511 attL    CCCTTTAAGAGTC 0.0 Click
2complement(1312239..1313174) PHAGE_Parame_FR483: hypothetical protein FR483_N404R; PP_01372; phage(gi155370502) 3e-08 Click
3complement(1313226..1314404) PROPHAGE_Escher_Sakai: putative integrase; PP_01373; phage(gi15832267) 4e-85 Click
4complement(1314463..1314678) hypothetical protein SSON53_10525 [Shigella sonnei 53G] gi|383178640|ref|YP_005456645.1|; PP_01374 3e-36 Click
5complement(1315210..1316019) PHAGE_Entero_epsilon15: RecT; PP_01375; phage(gi30387413) 1e-81 Click
6complement(1316012..1318612) PHAGE_Erwini_phiEt88: exodeoxyribonuclease; PP_01376; phage(gi327198600) 1e-83 Click
7complement(1318714..1319037) hypothetical protein ECO26_1920 [Escherichia coli O26:H11 str. 11368] gi|260855049|ref|YP_003228940.1|; PP_01377 3e-54 Click
8complement(1319064..1319240) PHAGE_Gifsy_1: hypothetical protein STM2630.Gifsy1; PP_01378; phage(gi169257260) 4e-06 Click
9complement(1319234..1319455) PHAGE_Escher_P13374: host killing protein; PP_01379; phage(gi410491620) 8e-06 Click
101319957..1320385 hypothetical protein ECBD_2263 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773646|ref|YP_003036477.1|; PP_01380 5e-77 Click
11complement(1320382..1320537) PHAGE_Salico_CGphi29: hypothetical protein; PP_01381; phage(gi472340166) 7e-10 Click
12complement(1320548..1320682) hypothetical protein Z2402 [Escherichia coli O157:H7 str. EDL933] gi|15801810|ref|NP_287828.1|; PP_01382 3e-19 Click
13complement(1320969..1321388) PHAGE_Escher_HK75: cI repressor; PP_01383; phage(gi356870714) 6e-21 Click
141321468..1321722 PHAGE_Escher_HK75: regulatory protein cro; PP_01384; phage(gi356870715) 2e-18 Click
151321719..1322144 PHAGE_Escher_HK639: cII; PP_01385; phage(gi356870652) 8e-06 Click
16complement(1322155..1322358) hypothetical; PP_01386 0.0 Click
171322408..1323286 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_01387; phage(gi18249881) 3e-29 Click
181330212..1330224 attR    CCCTTTAAGAGTC 0.0 Click

Region 5, total : 53 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11332498..1332788 PHAGE_Erwini_phiEt88: hypothetical protein; PP_01397; phage(gi327198620) 2e-33 Click
21332785..1333327 bacteriophage protein [Shigella flexneri 2a str. 301] gi|24112742|ref|NP_707252.1|; PP_01398 6e-89 Click
31334370..1334843 TolA protein (fragment) of prophage, partial [Escherichia coli 55989] gi|218695119|ref|YP_002402786.1|; PP_01399 1e-65 Click
41334948..1335343 tolA protein (fragment) of prophage, partial [Escherichia coli 55989] gi|218695118|ref|YP_002402785.1|; PP_01400 8e-75 Click
51335595..1335810 PHAGE_Entero_cdtI: lysis protein; PP_01401; phage(gi148609439) 1e-33 Click
61335810..1336259 PHAGE_Entero_cdtI: lysin; PP_01402; phage(gi148609440) 9e-64 Click
71336284..1336559 PHAGE_Entero_cdtI: lysin; PP_01403; phage(gi148609440) 2e-49 Click
81336556..1337020 PHAGE_Entero_cdtI: lysin; PP_01404; phage(gi148609441) 2e-60 Click
91337140..1338615 Rac prophage; potassium transporter subunit [Escherichia coli DH1] gi|387621082|ref|YP_006128709.1|; PP_01405 0.0 Click
101338753..1339547 PHAGE_Lactob_c5: putative ParB nuclease; PP_01406; phage(gi418488153) 6e-50 Click
111339540..1340472 PHAGE_Lactob_c5: hypothetical protein; PP_01407; phage(gi418488154) 3e-51 Click
121340450..1340659 putative phage protein [Escherichia coli ETEC H10407] gi|387611289|ref|YP_006114405.1|; PP_01408 2e-30 Click
131340663..1341757 PHAGE_Burkho_BcepMigl: terminase small subunit; PP_01409; phage(gi431809885) 3e-29 Click
141341738..1343039 PHAGE_Pseudo_H105/1: phage terminase large subunit; PP_01410; phage(gi327198525) 1e-111 Click
151343042..1344448 PHAGE_Escher_HK639: hypothetical protein; PP_01411; phage(gi356870603) 0.0 Click
161344432..1345544 PHAGE_Pseudo_MP1412: head morphogenesis/minor structural protein; PP_01412; phage(gi399529016) 1e-55 Click
171345649..1346413 PHAGE_Escher_HK639: hypothetical protein; PP_01413; phage(gi356870605) 8e-91 Click
181346512..1347651 PHAGE_Vibrio_vB_VpaS_MAR10: major capsid protein; PP_01414; phage(gi428782119) 7e-35 Click
191347694..1347870 PHAGE_Escher_HK639: hypothetical protein; PP_01415; phage(gi356870607) 4e-14 Click
201347874..1348269 putative phage protein [Escherichia coli ETEC H10407] gi|387611297|ref|YP_006114413.1|; PP_01416 2e-67 Click
211348653..1349033 PHAGE_Salmon_SE2: hypothetical protein; PP_01417; phage(gi375267267) 3e-14 Click
221349030..1349422 PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_01418; phage(gi423262013) 2e-10 Click
231349449..1350336 PHAGE_Xantho_Xp15: possible phage minor tail protein; PP_01419; phage(gi66392066) 9e-05 Click
241350492..1350941 putative phage protein [Escherichia coli ETEC H10407] gi|387611302|ref|YP_006114418.1|; PP_01420 4e-79 Click
251351118..1351249 putative phage protein [Escherichia coli ETEC H10407] gi|387611303|ref|YP_006114419.1|; PP_01421 3e-17 Click
261351415..1354648 PHAGE_Entero_cdtI: putative tail protein; PP_01422; phage(gi148609395) 3e-104 Click
271354683..1354979 PHAGE_Entero_4795: putative minor tail protein; PP_01423; phage(gi157166053) 3e-25 Click
281354979..1355389 PHAGE_Entero_cdtI: putative minor tail protein; PP_01424; phage(gi148609397) 2e-66 Click
291355487..1355975 PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_01425; phage(gi29143754) 2e-32 Click
301355977..1356405 PHAGE_Bacter_2: tail fiber; PP_01426; phage(gi212499733) 4e-23 Click
31complement(1356377..1356970) PHAGE_Entero_HK106: tail fiber assembly protein; PP_01427; phage(gi428783304) 3e-61 Click
32complement(1356970..1357533) PHAGE_Entero_mEp213: tail fiber; PP_01428; phage(gi428782611) 1e-48 Click
331357533..1358240 PHAGE_Erwini_ENT90: phage tail collar domain protein; PP_01429; phage(gi431810938) 1e-41 Click
341358245..1358688 PHAGE_Bacter_2: tail fiber; PP_01430; phage(gi212499733) 1e-24 Click
35complement(1358660..1359253) PHAGE_Entero_HK106: tail fiber assembly protein; PP_01431; phage(gi428783304) 2e-63 Click
36complement(1359253..1360026) PHAGE_Entero_mEp213: tail fiber; PP_01432; phage(gi428782611) 1e-83 Click
37complement(1360469..1360603) hypothetical protein Z1989 [Escherichia coli O157:H7 str. EDL933] gi|15801446|ref|NP_287463.1|; PP_01433 1e-18 Click
381360805..1361884 PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_01434; phage(gi148609400) 2e-141 Click
391361952..1362551 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_01435; phage(gi148609401) 5e-111 Click
401362704..1363369 PHAGE_Entero_mEp460: side tail fiber protein; PP_01436; phage(gi428782336) 3e-107 Click
411363445..1363771 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_01437; phage(gi148609401) 3e-60 Click
421363836..1364615 PHAGE_Entero_mEp460: side tail fiber protein; PP_01438; phage(gi428782336) 2e-91 Click
43complement(1364766..1365503) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01439; phage(gi9626267) 2e-58 Click
44complement(1365555..1365980) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01440; phage(gi9626267) 7e-12 Click
45complement(1366232..1366396) hypothetical; PP_01442 0.0 Click
46complement(1366377..1367096) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01443; phage(gi9626267) 4e-43 Click
471367072..1367206 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_01441 5e-15 Click
481367167..1367499 PHAGE_Entero_HK629: tail fiber protein; PP_01444; phage(gi428782034) 1e-11 Click
491367460..1369094 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01445; phage(gi16129506) 2e-38 Click
501369132..1369737 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01446; phage(gi16129506) 2e-69 Click
511369775..1370557 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01447; phage(gi16129506) 1e-99 Click
521370857..1371084 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_01448; phage(gi16129506) 2e-31 Click
531371084..1371590 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_01449; phage(gi16129505) 5e-63 Click

Region 6, total : 28 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2098625..2098879) PHAGE_Yersin_413C: Ogr; PP_02206; phage(gi30065732) 3e-44 Click
2complement(2098925..2100088) PHAGE_Yersin_413C: gpD; PP_02207; phage(gi30065731) 0.0 Click
3complement(2100088..2100567) PHAGE_Yersin_413C: gpU; PP_02208; phage(gi30065730) 4e-85 Click
4complement(2100582..2103029) PHAGE_Yersin_413C: gpT; PP_02209; phage(gi30065729) 0.0 Click
5complement(2103146..2103448) PHAGE_Yersin_413C: gpE; PP_02210; phage(gi30065727) 3e-40 Click
6complement(2103505..2104023) PHAGE_Yersin_413C: FII; PP_02211; phage(gi30065726) 2e-92 Click
7complement(2104036..2105226) PHAGE_Yersin_413C: gpFI; PP_02212; phage(gi30065725) 0.0 Click
8complement(2105286..2105879) PHAGE_Entero_2: DNA-invertase; PP_02213; phage(gi169936026) 4e-88 Click
9complement(2106307..2107008) PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_02214; phage(gi29143754) 3e-94 Click
10complement(2107005..2107616) PHAGE_Yersin_413C: gpI; PP_02215; phage(gi30065721) 2e-81 Click
11complement(2107609..2108517) PHAGE_Yersin_413C: gpJ; PP_02216; phage(gi30065720) 1e-165 Click
12complement(2108522..2108869) PHAGE_Yersin_413C: gpW; PP_02217; phage(gi30065719) 1e-58 Click
13complement(2108866..2109501) PHAGE_Yersin_413C: gpV; PP_02218; phage(gi30065718) 4e-113 Click
14complement(2109568..2110020) PHAGE_Yersin_413C: gpS; PP_02219; phage(gi30065717) 2e-79 Click
15complement(2110013..2110480) PHAGE_Yersin_413C: gpR; PP_02220; phage(gi30065716) 7e-83 Click
16complement(2110443..2110601) PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_02221; phage(gi431810968) 7e-10 Click
17complement(2110588..2111013) PHAGE_Yersin_413C: LysB; PP_02222; phage(gi30065715) 2e-71 Click
18complement(2111001..2111426) PHAGE_Yersin_413C: LysA; PP_02223; phage(gi30065714) 6e-67 Click
19complement(2111441..2111938) PHAGE_Yersin_413C: gpK; PP_02224; phage(gi30065713) 3e-94 Click
20complement(2111938..2112219) PHAGE_Yersin_413C: gpY; PP_02225; phage(gi30065712) 2e-45 Click
21complement(2112223..2112426) PHAGE_Yersin_413C: gpX; PP_02226; phage(gi30065711) 4e-32 Click
22complement(2112426..2112899) PHAGE_Yersin_413C: gpL; PP_02227; phage(gi30065710) 2e-84 Click
23complement(2113035..2113778) PHAGE_Yersin_413C: gpM; PP_02228; phage(gi30065709) 2e-133 Click
24complement(2113782..2114855) PHAGE_Yersin_413C: gpN; PP_02229; phage(gi30065708) 0.0 Click
25complement(2114914..2115768) PHAGE_Yersin_413C: gpO; PP_02230; phage(gi30065707) 1e-159 Click
262115942..2117714 PHAGE_Yersin_413C: gpP; PP_02231; phage(gi30065706) 0.0 Click
272117714..2118733 PHAGE_Yersin_413C: gpQ; PP_02232; phage(gi30065705) 0.0 Click
28complement(2119479..2120663) PHAGE_Burkho_KS5: gp44; PP_02233; phage(gi327198042) 5e-10 Click

Region 7, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12098496..2098523 attL    AATCTCCCTTACACGGGCTTATTTTTTA 0.0 Click
2complement(2098625..2098879) PHAGE_Yersin_413C: Ogr; PP_02206; phage(gi30065732) 3e-44 Click
3complement(2098925..2100088) PHAGE_Yersin_413C: gpD; PP_02207; phage(gi30065731) 0.0 Click
4complement(2100088..2100567) PHAGE_Yersin_413C: gpU; PP_02208; phage(gi30065730) 4e-85 Click
5complement(2100582..2103029) PHAGE_Yersin_413C: gpT; PP_02209; phage(gi30065729) 0.0 Click
6complement(2103146..2103448) PHAGE_Yersin_413C: gpE; PP_02210; phage(gi30065727) 3e-40 Click
7complement(2103505..2104023) PHAGE_Yersin_413C: FII; PP_02211; phage(gi30065726) 2e-92 Click
8complement(2104036..2105226) PHAGE_Yersin_413C: gpFI; PP_02212; phage(gi30065725) 0.0 Click
9complement(2105286..2105879) PHAGE_Entero_2: DNA-invertase; PP_02213; phage(gi169936026) 4e-88 Click
10complement(2106307..2107008) PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_02214; phage(gi29143754) 3e-94 Click
11complement(2107005..2107616) PHAGE_Yersin_413C: gpI; PP_02215; phage(gi30065721) 2e-81 Click
12complement(2107609..2108517) PHAGE_Yersin_413C: gpJ; PP_02216; phage(gi30065720) 1e-165 Click
13complement(2108522..2108869) PHAGE_Yersin_413C: gpW; PP_02217; phage(gi30065719) 1e-58 Click
14complement(2108866..2109501) PHAGE_Yersin_413C: gpV; PP_02218; phage(gi30065718) 4e-113 Click
15complement(2109568..2110020) PHAGE_Yersin_413C: gpS; PP_02219; phage(gi30065717) 2e-79 Click
16complement(2110013..2110480) PHAGE_Yersin_413C: gpR; PP_02220; phage(gi30065716) 7e-83 Click
17complement(2110443..2110601) PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_02221; phage(gi431810968) 7e-10 Click
18complement(2110588..2111013) PHAGE_Yersin_413C: LysB; PP_02222; phage(gi30065715) 2e-71 Click
19complement(2111001..2111426) PHAGE_Yersin_413C: LysA; PP_02223; phage(gi30065714) 6e-67 Click
20complement(2111441..2111938) PHAGE_Yersin_413C: gpK; PP_02224; phage(gi30065713) 3e-94 Click
21complement(2111938..2112219) PHAGE_Yersin_413C: gpY; PP_02225; phage(gi30065712) 2e-45 Click
22complement(2112223..2112426) PHAGE_Yersin_413C: gpX; PP_02226; phage(gi30065711) 4e-32 Click
23complement(2112426..2112899) PHAGE_Yersin_413C: gpL; PP_02227; phage(gi30065710) 2e-84 Click
24complement(2113035..2113778) PHAGE_Yersin_413C: gpM; PP_02228; phage(gi30065709) 2e-133 Click
25complement(2113782..2114855) PHAGE_Yersin_413C: gpN; PP_02229; phage(gi30065708) 0.0 Click
26complement(2114914..2115768) PHAGE_Yersin_413C: gpO; PP_02230; phage(gi30065707) 1e-159 Click
272115942..2117714 PHAGE_Yersin_413C: gpP; PP_02231; phage(gi30065706) 0.0 Click
282117714..2118733 PHAGE_Yersin_413C: gpQ; PP_02232; phage(gi30065705) 0.0 Click
29complement(2119479..2120663) PHAGE_Burkho_KS5: gp44; PP_02233; phage(gi327198042) 5e-10 Click
302121094..2122608 reverse transcriptase [Vibrio fischeri MJ11] gi|197334826|ref|YP_002156157.1|; PP_02234 5e-72 Click
312123149..2123265 hypothetical; PP_02235 0.0 Click
32complement(2123251..2125527) PHAGE_Yersin_413C: gpA; PP_02236; phage(gi30065742) 0.0 Click
33complement(2125517..2125792) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; PP_02237; phage(gi30065741) 8e-46 Click
34complement(2125789..2126013) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; PP_02238; phage(gi30065740) 3e-35 Click
35complement(2126016..2126315) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; PP_02239; phage(gi30065739) 7e-48 Click
36complement(2126315..2126539) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; PP_02240; phage(gi30065738) 1e-33 Click
37complement(2126603..2127103) PHAGE_Yersin_413C: gpB; PP_02241; phage(gi30065737) 8e-94 Click
38complement(2127100..2127270) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; PP_02242; phage(gi30065736) 1e-26 Click
39complement(2127281..2127466) PHAGE_Yersin_413C: Cox; PP_02243; phage(gi30065735) 8e-12 Click
402128086..2129099 PHAGE_Yersin_413C: Int; PP_02244; phage(gi30065733) 1e-91 Click
412129179..2129206 attR    AATCTCCCTTACACGGGCTTATTTTTTA 0.0 Click
42complement(2129432..2129695) hypothetical protein ECSF_1970 [Escherichia coli SE15] gi|387830023|ref|YP_003349960.1|; PP_02245 3e-41 Click
432130095..2130994 phosphatidylglycerol kinase, metal-dependent [Escherichia coli W] gi|386609485|ref|YP_006124971.1|; PP_02246 2e-170 Click
44complement(2131076..2131792) hypothetical protein i02_2416 [Escherichia coli str. 'clone D i2'] gi|386629878|ref|YP_006149598.1|; PP_02247 9e-126 Click
45complement(2131955..2132995) PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; PP_02248; phage(gi326781942) 8e-11 Click

Region 8, total : 59 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12409420..2409435 attL    TTGCAGGTTCGATTCC 0.0 Click
22409611..2410768 PHAGE_Entero_HK620: integrase; PP_02502; phage(gi13559824) 0.0 Click
32411146..2412186 PHAGE_Acidia_virus: hypothetical protein ATV_gp34; PP_02503; phage(gi75750403) 8e-10 Click
42412879..2413574 G-D-S-L family lipolytic protein [Haliangium ochraceum DSM 14365] gi|262195434|ref|YP_003266643.1|; PP_02504 5e-09 Click
5complement(2413600..2415837) PHAGE_Entero_HK620: tail spike protein; PP_02505; phage(gi13559880) 1e-58 Click
6complement(2415938..2416840) PHAGE_Salmon_epsilon34: Ant; PP_02506; phage(gi221328691) 2e-173 Click
7complement(2416909..2417052) PHAGE_Salmon_epsilon34: Arc; transcriptional repressor; PP_02507; phage(gi221328635) 9e-21 Click
8complement(2417429..2417860) PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp15; PP_02508; phage(gi221328633) 6e-75 Click
92418041..2418355 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_02509; phage(gi399498805) 4e-55 Click
10complement(2418380..2420218) PHAGE_Entero_P22: injection protein; PP_02510; phage(gi51236731) 0.0 Click
11complement(2420218..2421633) PHAGE_Entero_HK620: DNA transfer protein; PP_02511; phage(gi13559876) 7e-120 Click
12complement(2421644..2422336) PHAGE_Entero_HK620: DNA transfer protein; PP_02512; phage(gi13559875) 5e-126 Click
13complement(2422339..2422662) PHAGE_Entero_HK620: head assembly protein; PP_02513; phage(gi13559874) 6e-60 Click
14complement(2422794..2423495) PHAGE_Entero_HK620: DNA stabilization protein; PP_02514; phage(gi13559873) 5e-118 Click
15complement(2423495..2424913) PHAGE_Entero_HK620: DNA stabilization protein; PP_02515; phage(gi13559872) 0.0 Click
16complement(2424922..2425404) PHAGE_Entero_HK620: DNA stabilization protein; PP_02516; phage(gi13559871) 4e-89 Click
17complement(2425379..2425564) PHAGE_Entero_HK620: hypothetical protein HK620p47; PP_02517; phage(gi13559870) 7e-29 Click
18complement(2425607..2426878) PHAGE_Entero_HK620: capsid protein; PP_02518; phage(gi13559869) 0.0 Click
19complement(2426890..2427774) PHAGE_Entero_HK620: scaffold protein; PP_02519; phage(gi13559868) 5e-168 Click
20complement(2427788..2429914) PHAGE_Entero_HK620: portal protein; PP_02520; phage(gi13559867) 0.0 Click
21complement(2429917..2431329) PHAGE_Entero_HK620: terminase large subunit; PP_02521; phage(gi13559866) 0.0 Click
22complement(2431326..2431751) PHAGE_Entero_HK620: terminase small subunit; PP_02522; phage(gi13559865) 8e-67 Click
23complement(2431831..2432073) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_02523; phage(gi399498861) 8e-38 Click
24complement(2432177..2432701) PHAGE_Escher_HK639: rha protein; PP_02524; phage(gi356870673) 4e-90 Click
25complement(2432904..2433056) PHAGE_Entero_Sf6: gene 65 protein; PP_02525; phage(gi41057338) 3e-23 Click
26complement(2433097..2433282) PHAGE_Escher_HK75: Rz1; PP_02526; phage(gi356870732) 2e-26 Click
27complement(2433478..2433951) PHAGE_Escher_HK75: lysozyme; PP_02527; phage(gi356870730) 3e-88 Click
28complement(2433938..2434261) PHAGE_Entero_mEp213: holin protein; PP_02528; phage(gi428782657) 1e-55 Click
292434396..2434554 hypothetical protein NRG857_04685 [Escherichia coli O83:H1 str. NRG 857C] gi|387616276|ref|YP_006119298.1|; PP_02529 8e-19 Click
30complement(2434695..2435318) PHAGE_Entero_mEpX1: late gene regulator Q; PP_02530; phage(gi428781929) 7e-118 Click
31complement(2435500..2435862) PHAGE_Entero_HK542: Holliday-junction resolvase; PP_02531; phage(gi428783393) 8e-65 Click
32complement(2435859..2436149) PHAGE_Salmon_SPN9CC: hypothetical protein; PP_02532; phage(gi389060524) 2e-52 Click
33complement(2436149..2436871) PHAGE_Entero_HK620: DNA-binding protein Roi; PP_02533; phage(gi13559853) 2e-131 Click
34complement(2437033..2437422) PHAGE_Entero_HK446: NinX protein; PP_02534; phage(gi428782242) 7e-47 Click
35complement(2437598..2438038) PHAGE_Entero_HK446: NinB protein; PP_02535; phage(gi428782241) 3e-82 Click
36complement(2438112..2439488) PHAGE_Entero_mEp213: replicative DNA helicase; PP_02536; phage(gi428782646) 0.0 Click
37complement(2439485..2440372) PHAGE_Entero_HK544: DNA replication protein O; PP_02537; phage(gi428783261) 9e-68 Click
38complement(2440730..2440867) PHAGE_Entero_HK633: CII protein; PP_02538; phage(gi428782569) 1e-18 Click
39complement(2441143..2441358) PHAGE_Entero_HK633: prophage antirepressor; PP_02539; phage(gi428782568) 9e-34 Click
402442184..2442495 PHAGE_Entero_HK633: hypothetical protein; PP_02540; phage(gi428782566) 3e-54 Click
412442549..2442680 hypothetical; PP_02541 0.0 Click
422442799..2443125 PHAGE_Entero_HK633: anti-termination protein N; PP_02542; phage(gi428782565) 2e-56 Click
432443137..2443760 PHAGE_Entero_mEp235: hypothetical protein; PP_02543; phage(gi428781847) 1e-109 Click
442443934..2444350 PHAGE_Entero_vB_EcoM_FV3: hypothetical protein; PP_02544; phage(gi422936515) 1e-55 Click
452444435..2444569 PHAGE_Entero_mEpX2: CIII protein; PP_02545; phage(gi428765650) 1e-18 Click
462444554..2444706 PHAGE_Escher_HK75: kil protein; PP_02546; phage(gi356870711) 4e-23 Click
472444703..2444873 PHAGE_Escher_HK75: hypothetical protein; PP_02547; phage(gi356870710) 4e-28 Click
482444827..2444952 PHAGE_Entero_mEp234: hypothetical protein; PP_02548; phage(gi428782284) 7e-18 Click
492444961..2445668 PHAGE_Entero_Sf6: gene 28 protein; PP_02549; phage(gi41057306) 6e-140 Click
502445669..2446175 PHAGE_Escher_HK75: single-stranded DNA binding protein; PP_02550; phage(gi356870708) 2e-95 Click
512446189..2446482 PHAGE_Escher_HK75: anti-RecBCD protein 2; PP_02551; phage(gi356870707) 4e-53 Click
522446493..2446657 PHAGE_Entero_HK106: hypothetical protein; PP_02552; phage(gi428783313) 1e-25 Click
532446654..2447193 PHAGE_Entero_HK629: hypothetical protein; PP_02553; phage(gi428782046) 2e-43 Click
542447190..2447741 PHAGE_Entero_HK620: hypothetical protein HK620p07; PP_02554; phage(gi13559830) 4e-60 Click
552447743..2448264 PHAGE_Entero_HK620: hypothetical protein HK620p05; PP_02555; phage(gi13559828) 5e-50 Click
562448409..2448540 PHAGE_Entero_HK620: hypothetical protein HK620p04; PP_02556; phage(gi13559827) 4e-20 Click
572448637..2448652 attR    TTGCAGGTTCGATTCC 0.0 Click
582448672..2448872 PHAGE_Entero_HK620: hypothetical protein HK620p03; PP_02557; phage(gi13559826) 3e-34 Click
59complement(2449402..2450649) sucrose transport protein [Escherichia coli O103:H2 str. 12009] gi|260845009|ref|YP_003222787.1|; PP_02558 0.0 Click
60complement(2450721..2451635) aminoimidazole riboside kinase [Escherichia coli O104:H4 str. 2011C-3493] gi|407481071|ref|YP_006778220.1|; PP_02559 2e-174 Click
612451851..2453284 PHAGE_Bacill_SP10: levanase; PP_02560; phage(gi418489513) 2e-28 Click

Region 9, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14597465..4598142 PHAGE_Strept_VWB: hypothetical protein VWBp55; PP_04649; phage(gi41057269) 9e-06 Click
24598284..4598297 attL    ATTATTTCTCACCC 0.0 Click
34598528..4599751 PHAGE_Entero_cdtI: Phage integrase; PP_04650; phage(gi148609414) 0.0 Click
4complement(4600012..4600344) hypothetical protein EFER_4417 [Escherichia fergusonii ATCC 35469] gi|218551625|ref|YP_002385417.1|; PP_04651 3e-53 Click
5complement(4601057..4601593) PHAGE_Entero_mEp460: hypothetical protein; PP_04652; phage(gi428782349) 8e-99 Click
6complement(4601722..4602546) PHAGE_Entero_mEp460: hypothetical protein; PP_04653; phage(gi428782350) 1e-149 Click
7complement(4602612..4602974) PHAGE_Entero_mEp460: hypothetical protein; PP_04654; phage(gi428782351) 3e-63 Click
84603682..4603876 hypothetical protein EFER_0579 [Escherichia fergusonii ATCC 35469] gi|218547974|ref|YP_002381765.1|; PP_04655 3e-31 Click
9complement(4603848..4604054) hypothetical protein EFER_0580 [Escherichia fergusonii ATCC 35469] gi|218547975|ref|YP_002381766.1|; PP_04656 1e-30 Click
10complement(4604394..4605041) PHAGE_Entero_mEp460: prophage repressor; PP_04657; phage(gi428782354) 9e-114 Click
114605229..4605444 PHAGE_Entero_mEp460: putative antirepressor Cro; PP_04658; phage(gi428782355) 1e-32 Click
124605437..4605988 PHAGE_Entero_mEp460: hypothetical protein; PP_04659; phage(gi428782356) 4e-93 Click
134606333..4607274 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_04660; phage(gi18249881) 1e-41 Click
144607369..4608022 PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; PP_04661; phage(gi428782361) 1e-125 Click
154608019..4608408 PHAGE_Entero_mEp460: holliday junction resolvase; PP_04662; phage(gi428782363) 1e-70 Click
164608428..4609225 PHAGE_Entero_mEp460: KilA-N domain protein; PP_04663; phage(gi428782364) 7e-131 Click
174609233..4610222 PHAGE_Entero_mEp460: hypothetical protein; PP_04664; phage(gi428782365) 0.0 Click
184610236..4610988 PHAGE_Entero_mEp460: late gene regulator; PP_04665; phage(gi428782366) 3e-145 Click
19complement(4611404..4611616) cold shock protein; Qin prophage [Escherichia fergusonii ATCC 35469] gi|218551642|ref|YP_002385434.1|; PP_04666 5e-32 Click
204611917..4612132 PHAGE_Lactoc_bIL312: Csp; PP_04667; phage(gi13095918) 2e-16 Click
214612894..4613100 PHAGE_Entero_mEp460: porin; PP_04668; phage(gi428782370) 4e-30 Click
224613105..4613656 PHAGE_Entero_mEp460: hypothetical protein; PP_04669; phage(gi428782371) 1e-35 Click
234613978..4614511 PHAGE_Entero_mEp460: endolysin; PP_04670; phage(gi428782372) 7e-97 Click
244614508..4615005 PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; PP_04671; phage(gi16765210) 1e-53 Click
254615369..4615581 PHAGE_Lactoc_bIL312: Csp; PP_04672; phage(gi13095918) 1e-15 Click
264616255..4616386 hypothetical protein EFER_4444 [Escherichia fergusonii ATCC 35469] gi|218551650|ref|YP_002385442.1|; PP_04673 9e-07 Click
274617482..4617976 PHAGE_Entero_mEp460: terminase small subunit; PP_04674; phage(gi428782317) 7e-85 Click
284617976..4620078 PHAGE_Entero_mEp460: terminase large subunit; PP_04675; phage(gi428782318) 0.0 Click
294620075..4620287 PHAGE_Entero_mEp460: hypothetical protein; PP_04676; phage(gi428782319) 8e-35 Click
304620287..4621795 PHAGE_Entero_mEp460: portal protein; PP_04677; phage(gi428782320) 0.0 Click
314621809..4623767 PHAGE_Entero_mEp460: putative protease/scaffold protein; PP_04678; phage(gi428782321) 0.0 Click
324623854..4624177 PHAGE_Entero_mEp460: hypothetical protein; PP_04679; phage(gi428782322) 1e-54 Click
334624170..4624445 PHAGE_Entero_mEp460: hypothetical protein; PP_04680; phage(gi428782323) 2e-46 Click
344624457..4625035 PHAGE_Entero_mEp460: minor tail protein; PP_04681; phage(gi428782324) 7e-104 Click
354625032..4625433 PHAGE_Entero_mEp460: minor tail protein; PP_04682; phage(gi428782325) 7e-74 Click
364625444..4626187 PHAGE_Entero_mEp460: major tail protein; PP_04683; phage(gi428782326) 2e-134 Click
374626245..4626634 PHAGE_Entero_mEp460: minor tail protein; PP_04684; phage(gi428782327) 6e-67 Click
384626697..4626972 PHAGE_Entero_mEp460: tail assembly protein; PP_04685; phage(gi428782328) 5e-48 Click
394626944..4630009 PHAGE_Entero_mEp460: tail length tape measure protein; PP_04686; phage(gi428782329) 0.0 Click
404630009..4630338 PHAGE_Entero_mEp460: minor tail protein; PP_04687; phage(gi428782330) 2e-61 Click
414630348..4631046 PHAGE_Entero_mEp460: minor tail protein; PP_04688; phage(gi428782331) 3e-133 Click
424631196..4631795 PHAGE_Entero_mEp460: tail fiber component; PP_04689; phage(gi428782332) 5e-119 Click
434631828..4632346 PHAGE_Entero_mEp460: tail assembly protein; PP_04690; phage(gi428782333) 2e-84 Click
444632339..4633943 PHAGE_Entero_mEp460: host specificity protein; PP_04691; phage(gi428782334) 0.0 Click
454634010..4635290 PHAGE_Entero_mEp460: Lom protein; PP_04692; phage(gi428782335) 1e-102 Click
464635290..4635865 PHAGE_Entero_HK630: tail fiber assembly protein; PP_04693; phage(gi428782810) 9e-107 Click
47complement(4635963..4636490) PHAGE_Escher_D108: G region invertase; PP_04694; phage(gi281199698) 2e-20 Click
48complement(4636494..4636811) PHAGE_Entero_mEpX1: DNA invertase Pin-like protein; PP_04695; phage(gi428781898) 4e-11 Click
49complement(4637191..4637424) hypothetical protein EFER_4469 [Escherichia fergusonii ATCC 35469] gi|218551674|ref|YP_002385466.1|; PP_04696 6e-37 Click
50complement(4637493..4637606) hypothetical; PP_04697 0.0 Click
51complement(4638033..4638281) PHAGE_Entero_mEp460: DinI-like protein; PP_04698; phage(gi428782337) 5e-41 Click
52complement(4638396..4638560) hypothetical protein ECOK1_4938 [Escherichia coli IHE3034] gi|386602474|ref|YP_006103980.1|; PP_04699 8e-27 Click
534638513..4640087 PHAGE_Lausan: putative translation elongation factor 1-alpha; PP_04700; phage(gi327409596) 8e-05 Click
544638549..4638562 attR    ATTATTTCTCACCC 0.0 Click
554640480..4641085 hypothetical protein SSON_4526 [Shigella sonnei Ss046] gi|74314810|ref|YP_313229.1|; PP_04701 1e-103 Click
564641212..4641373 PHAGE_Salmon_PVP_SE1: hypothetical membrane protein; PP_04702; phage(gi363539602) 1e-13 Click
574641495..4642568 PHAGE_Parame_1: hypothetical protein; PP_04703; phage(gi9631742) 9e-05 Click

Region 10, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4892743..4893774) PHAGE_Plankt_PaV_LD: ABC transporter; PP_04934; phage(gi371496158) 6e-38 Click
24893962..4894534 D,D-heptose 1,7-bisphosphate phosphatase [Escherichia fergusonii ATCC 35469] gi|218547656|ref|YP_002381447.1|; PP_04935 6e-107 Click
3complement(4894914..4895516) PHAGE_Entero_mEp460: Lom protein; PP_04936; phage(gi428782335) 1e-91 Click
4complement(4895586..4896809) PHAGE_Entero_mEp460: host specificity protein; PP_04937; phage(gi428782334) 1e-155 Click
5complement(4896870..4897442) PHAGE_Entero_mEp460: tail assembly protein; PP_04938; phage(gi428782333) 8e-73 Click
6complement(4897439..4898038) PHAGE_Entero_mEp460: tail fiber component; PP_04939; phage(gi428782332) 1e-118 Click
7complement(4898188..4898685) PHAGE_Entero_mEp460: minor tail protein; PP_04940; phage(gi428782331) 2e-91 Click
8complement(4899208..4899987) PROPHAGE_Escher_CFT073: transposase/IS protein; PP_04941; phage(gi26248359) 1e-142 Click
9complement(4899987..4901009) PROPHAGE_Escher_CFT073: transposase; PP_04942; phage(gi26248360) 0.0 Click
10complement(4901023..4901151) hypothetical protein y2741 [Yersinia pestis KIM10+] gi|22126619|ref|NP_670042.1|; PP_04943 5e-06 Click
11complement(4901459..4901782) hypothetical protein ECED1_2273 [Escherichia coli ED1a] gi|218690000|ref|YP_002398212.1|; PP_04944 2e-07 Click
124902022..4903032 PROPHAGE_Escher_CFT073: transposase; PP_04945; phage(gi26248352) 1e-09 Click