Escherichia coli TA206 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].5055289, GC%: 50.53%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13546..4316 PHAGE_Microm_12T: hypothetical protein; PP_00004; phage(gi472342811) 7e-08 Click
2complement(4364..5584) PHAGE_Bacill_Eoghan: cell wall hydrolase/autolysin; PP_00005; phage(gi460041965) 4e-10 Click
3complement(5794..6549) hydroxyacylglutathione hydrolase [Escherichia coli str. 'clone D i2'] gi|386627732|ref|YP_006147452.1|; PP_00006 2e-146 Click
46583..7305 hypothetical protein i02_0232 [Escherichia coli str. 'clone D i2'] gi|386627733|ref|YP_006147453.1|; PP_00007 1e-140 Click
5complement(7302..7769) PHAGE_Salmon_SSU5: putative ribonuclease H; PP_00008; phage(gi410491500) 3e-52 Click
67834..8565 PHAGE_Salmon_SSU5: putative exonuclease; PP_00009; phage(gi410491496) 2e-09 Click
78698..8774 tRNA 0.0 Click
8complement(8895..9140) hypothetical protein c0254 [Escherichia coli CFT073] gi|26246161|ref|NP_752200.1|; PP_00010 1e-40 Click
9complement(9306..9752) hypothetical protein i02_0236 [Escherichia coli str. 'clone D i2'] gi|386627737|ref|YP_006147457.1|; PP_00011 7e-81 Click
1010136..10288 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF79; PP_00012; phage(gi157166064) 2e-14 Click
1110412..10708 PHAGE_Stx2_c_1717: transposase; PP_00013; phage(gi209447152) 3e-31 Click
1210739..11386 PHAGE_Stx2_c_1717: transposase; PP_00014; phage(gi209447153) 2e-42 Click
1311337..12332 PHAGE_Stx2_c_1717: transposase; PP_00015; phage(gi209447153) 9e-126 Click
1412480..12665 PROPHAGE_Escher_CFT073: putative transposase; PP_00016; phage(gi26246170) 5e-17 Click
1512904..13167 PROPHAGE_Escher_CFT073: putative transposase; PP_00017; phage(gi26246170) 2e-48 Click
1613122..13469 PROPHAGE_Escher_EDL933: putative transposase; PP_00018; phage(gi15803522) 1e-32 Click
17complement(13762..14040) hypothetical protein ECP_3017 [Escherichia coli 536] gi|110643171|ref|YP_670901.1|; PP_00019 8e-22 Click
18complement(14037..14414) hypothetical protein i02_0265 [Escherichia coli str. 'clone D i2'] gi|386627766|ref|YP_006147486.1|; PP_00020 2e-66 Click
19complement(14461..14760) hypothetical protein i02_0266 [Escherichia coli str. 'clone D i2'] gi|386627767|ref|YP_006147487.1|; PP_00021 3e-52 Click
20complement(14885..15529) PHAGE_Caulob_CcrColossus: hypothetical protein; PP_00022; phage(gi414088071) 6e-27 Click
21complement(15548..15769) hypothetical protein ECOK1_1130 [Escherichia coli IHE3034] gi|386598831|ref|YP_006100337.1|; PP_00023 1e-36 Click
22complement(15832..16308) radC-like protein yeeS [Escherichia coli CFT073] gi|26246178|ref|NP_752217.1|; PP_00024 4e-84 Click
23complement(16324..16797) PHAGE_Pseudo_YuA: hypothetical protein; PP_00025; phage(gi162135127) 4e-13 Click
24complement(16891..17136) hypothetical protein O3K_15435 [Escherichia coli O104:H4 str. 2011C-3493] gi|407482617|ref|YP_006779766.1|; PP_00026 4e-45 Click
25complement(17136..17957) PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; PP_00027; phage(gi414086954) 6e-45 Click

Region 2, total : 10 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1124236..124260 attL    GTTCGACTCCTATTATCGGCACCAT 0.0 Click
2124355..125614 PROPHAGE_Escher_CFT073: putative prophage integrase; PP_00126; phage(gi26250313) 2e-143 Click
3125611..126435 hypothetical protein ESA_03024 [Cronobacter sakazakii ATCC BAA-894] gi|156935173|ref|YP_001439089.1|; PP_00127 2e-23 Click
4127189..127365 PHAGE_Entero_P4: putative CI repressor; PP_00128; phage(gi9627516) 4e-07 Click
5127358..127717 hypothetical protein EFER_0811 [Escherichia fergusonii ATCC 35469] gi|218548194|ref|YP_002381985.1|; PP_00129 1e-67 Click
6127749..128033 hypothetical protein EFER_0810 [Escherichia fergusonii ATCC 35469] gi|218548193|ref|YP_002381984.1|; PP_00130 2e-47 Click
7128030..128413 PHAGE_Entero_P4: hypothetical protein P4p07; PP_00131; phage(gi9627513) 1e-09 Click
8128410..131082 PHAGE_Entero_P4: DNA primase; PP_00132; phage(gi9627512) 5e-47 Click
9131483..132226 PHAGE_Entero_P4: head size determination protein sid; PP_00133; phage(gi9627518) 7e-10 Click
10132223..132774 PHAGE_Entero_P4: amber mutation-suppressing protein; PP_00134; phage(gi9627520) 1e-12 Click
11132780..133052 PHAGE_Entero_PsP3: Pag; PP_00135; phage(gi41057379) 3e-10 Click
12137124..137148 attR    GTTCGACTCCTATTATCGGCACCAT 0.0 Click

Region 3, total : 5 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1121156..121169 attL    GCTTTATTACCGGC 0.0 Click
2134715..136331 PHAGE_Yersin_phiR1_37: hypothetical protein; PP_00137; phage(gi358356579) 8e-05 Click
3136734..136847 hypothetical; PP_00138 0.0 Click
4137464..137640 PROPHAGE_Escher_CFT073: putative prophage integrase; PP_00139; phage(gi26250313) 5e-11 Click
5complement(138075..138599) hypothetical protein i02_0371 [Escherichia coli str. 'clone D i2'] gi|386627870|ref|YP_006147590.1|; PP_00140 3e-94 Click
6complement(138725..142855) PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; PP_00141; phage(gi414087138) 3e-05 Click
7156490..156503 attR    GCTTTATTACCGGC 0.0 Click

Region 4, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1676318..676344 attL    ATAAATTTCAGGCAACAAAAAACCCAT 0.0 Click
2complement(676419..677471) PHAGE_Entero_2: P2 Int-like protein; PP_00656; phage(gi169936064) 7e-100 Click
3complement(677554..678885) putative KAP-NTPase protein [Escherichia coli ETEC H10407] gi|387610756|ref|YP_006113872.1|; PP_00657 6e-92 Click
4complement(679106..679546) PHAGE_Entero_2: P2 CI-like protein; PP_00658; phage(gi169936063) 7e-24 Click
5679891..680016 hypothetical protein KPN2242_07260 [Klebsiella pneumoniae KCTC 2242] gi|386034022|ref|YP_005953935.1|; PP_00659 3e-14 Click
6680049..680558 PHAGE_Entero_2: bacteriophage regulatory protein CII; PP_00660; phage(gi169936061) 2e-85 Click
7680733..680957 hypothetical protein ECS88_2846 [Escherichia coli S88] gi|218559578|ref|YP_002392491.1|; PP_00661 1e-35 Click
8680980..681321 PHAGE_Entero_2: hypothetical protein STM2733.Fels2; PP_00662; phage(gi169936058) 1e-51 Click
9681389..681622 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; PP_00663; phage(gi169936057) 1e-27 Click
10681622..681849 PHAGE_Entero_2: P2 gpOrf82-like protein; PP_00664; phage(gi169936056) 7e-35 Click
11681846..682703 PHAGE_Entero_2: DNA adenine methylase-like protein; PP_00665; phage(gi169936055) 7e-116 Click
12682700..685114 PHAGE_Entero_2: P2 gpA-like protein; PP_00666; phage(gi169936054) 0.0 Click
13685268..685456 PHAGE_Entero_2: hypothetical protein STM2728.Fels2; PP_00667; phage(gi169936053) 2e-28 Click
14685467..685700 PHAGE_Entero_2: TumB protein; PP_00668; phage(gi169936052) 2e-38 Click
15686015..687907 KAP P-loop domain-containing protein [Desulfovibrio salexigens DSM 2638] gi|242280946|ref|YP_002993075.1|; PP_00669 2e-59 Click
16688560..689393 hypothetical protein Sputw3181_0345 [Shewanella sp. W3-18-1] gi|120597176|ref|YP_961750.1|; PP_00670 2e-20 Click
17complement(689437..690462) PHAGE_Entero_2: P2 gpQ-like protein; PP_00671; phage(gi169936049) 6e-173 Click
18complement(690462..692057) PHAGE_Entero_2: P2 gpP-like protein; PP_00672; phage(gi169936048) 0.0 Click
19complement(692077..692226) PHAGE_Entero_2: P2 gpP-like protein; PP_00673; phage(gi169936048) 9e-21 Click
20complement(692236..692370) hypothetical protein KO11_19445 [Escherichia coli KO11FL] gi|386702370|ref|YP_006166207.1|; PP_00674 4e-17 Click
21692369..693202 PHAGE_Entero_2: P2 gpO-like protein; PP_00675; phage(gi169936047) 4e-131 Click
22693219..694277 PHAGE_Entero_2: P2 gpN-like major capsid protein; PP_00676; phage(gi169936046) 1e-178 Click
23694281..694931 PHAGE_Entero_2: P2 gpM-like protein; PP_00677; phage(gi169936045) 4e-113 Click
24695027..695491 PHAGE_Entero_2: P2 gpL-like protein; PP_00678; phage(gi169936044) 8e-79 Click
25695491..695694 PHAGE_Entero_2: P2 gpX-like tail protein; PP_00679; phage(gi169936043) 1e-32 Click
26695698..695913 PHAGE_Entero_2: lysis protein; PP_00680; phage(gi169936042) 4e-28 Click
27695894..696406 PHAGE_Entero_2: endolysin; PP_00681; phage(gi169936041) 1e-81 Click
28696408..696785 hypothetical protein CE10_1736 [Escherichia coli O7:K1 str. CE10] gi|386624090|ref|YP_006143818.1|; PP_00682 1e-64 Click
29696782..697210 PHAGE_Entero_2: P2 LysB-like protein; PP_00683; phage(gi169936038) 4e-56 Click
30697306..697737 PHAGE_Entero_2: P2 gpR-like tail completion protein; PP_00684; phage(gi169936036) 6e-72 Click
31697730..698176 PHAGE_Entero_2: P2 gpS-like tail completion protein; PP_00685; phage(gi169936035) 4e-72 Click
32698245..698823 PHAGE_Entero_2: P2 gpV-like protein; PP_00686; phage(gi169936034) 2e-96 Click
33698820..699179 PHAGE_Entero_2: P2 gpW-like baseplate protein; PP_00687; phage(gi169936033) 2e-51 Click
34699166..700074 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; PP_00688; phage(gi169936032) 4e-147 Click
35700067..700672 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; PP_00689; phage(gi169936031) 7e-110 Click
36700669..702093 PHAGE_Entero_2: P2 gpH-like protein; PP_00690; phage(gi169936030) 5e-118 Click
37702048..702494 PHAGE_Entero_HK106: side tail fiber protein; PP_00691; phage(gi428783303) 2e-40 Click
38702494..703096 PHAGE_Entero_HK106: tail fiber assembly protein; PP_00692; phage(gi428783304) 1e-93 Click
39complement(703068..703235) PHAGE_Entero_mEp213: tail fiber assembly protein; PP_00693; phage(gi428782612) 1e-21 Click
40complement(703507..704055) PHAGE_Entero_HK106: side tail fiber protein; PP_00694; phage(gi428783303) 3e-30 Click
41704086..704652 PHAGE_Entero_2: DNA-invertase; PP_00695; phage(gi169936026) 9e-88 Click
42complement(704610..704744) hypothetical; PP_00696 0.0 Click
43704795..705967 PHAGE_Entero_2: P2 gpFI-like protein; PP_00697; phage(gi169936025) 0.0 Click
44705977..706492 PHAGE_Entero_2: P2 gpFII-like protein; PP_00698; phage(gi169936024) 4e-91 Click
45706547..706849 PHAGE_Entero_2: P2 gpE-like tail protein; PP_00699; phage(gi169936023) 3e-45 Click
46706864..706983 PHAGE_Entero_2: P2 gpE-like protein; PP_00700; phage(gi169936022) 4e-15 Click
47706976..710053 PHAGE_Entero_2: P2 gpT-like tail protein; PP_00701; phage(gi169936021) 0.0 Click
48710050..710535 PHAGE_Entero_2: P2 gpU-like tail protein; PP_00702; phage(gi169936020) 1e-75 Click
49710532..711632 PHAGE_Entero_2: P2 gpD-like tail protein; PP_00703; phage(gi169936019) 0.0 Click
50711723..711941 PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); PP_00704; phage(gi169936018) 2e-22 Click
51712006..712032 attR    ATAAATTTCAGGCAACAAAAAACCCAT 0.0 Click

Region 5, total : 34 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(689437..690462) PHAGE_Entero_2: P2 gpQ-like protein; PP_00671; phage(gi169936049) 6e-173 Click
2complement(690462..692057) PHAGE_Entero_2: P2 gpP-like protein; PP_00672; phage(gi169936048) 0.0 Click
3complement(692077..692226) PHAGE_Entero_2: P2 gpP-like protein; PP_00673; phage(gi169936048) 9e-21 Click
4complement(692236..692370) hypothetical protein KO11_19445 [Escherichia coli KO11FL] gi|386702370|ref|YP_006166207.1|; PP_00674 4e-17 Click
5692369..693202 PHAGE_Entero_2: P2 gpO-like protein; PP_00675; phage(gi169936047) 4e-131 Click
6693219..694277 PHAGE_Entero_2: P2 gpN-like major capsid protein; PP_00676; phage(gi169936046) 1e-178 Click
7694281..694931 PHAGE_Entero_2: P2 gpM-like protein; PP_00677; phage(gi169936045) 4e-113 Click
8695027..695491 PHAGE_Entero_2: P2 gpL-like protein; PP_00678; phage(gi169936044) 8e-79 Click
9695491..695694 PHAGE_Entero_2: P2 gpX-like tail protein; PP_00679; phage(gi169936043) 1e-32 Click
10695698..695913 PHAGE_Entero_2: lysis protein; PP_00680; phage(gi169936042) 4e-28 Click
11695894..696406 PHAGE_Entero_2: endolysin; PP_00681; phage(gi169936041) 1e-81 Click
12696408..696785 hypothetical protein CE10_1736 [Escherichia coli O7:K1 str. CE10] gi|386624090|ref|YP_006143818.1|; PP_00682 1e-64 Click
13696782..697210 PHAGE_Entero_2: P2 LysB-like protein; PP_00683; phage(gi169936038) 4e-56 Click
14697306..697737 PHAGE_Entero_2: P2 gpR-like tail completion protein; PP_00684; phage(gi169936036) 6e-72 Click
15697730..698176 PHAGE_Entero_2: P2 gpS-like tail completion protein; PP_00685; phage(gi169936035) 4e-72 Click
16698245..698823 PHAGE_Entero_2: P2 gpV-like protein; PP_00686; phage(gi169936034) 2e-96 Click
17698820..699179 PHAGE_Entero_2: P2 gpW-like baseplate protein; PP_00687; phage(gi169936033) 2e-51 Click
18699166..700074 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; PP_00688; phage(gi169936032) 4e-147 Click
19700067..700672 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; PP_00689; phage(gi169936031) 7e-110 Click
20700669..702093 PHAGE_Entero_2: P2 gpH-like protein; PP_00690; phage(gi169936030) 5e-118 Click
21702048..702494 PHAGE_Entero_HK106: side tail fiber protein; PP_00691; phage(gi428783303) 2e-40 Click
22702494..703096 PHAGE_Entero_HK106: tail fiber assembly protein; PP_00692; phage(gi428783304) 1e-93 Click
23complement(703068..703235) PHAGE_Entero_mEp213: tail fiber assembly protein; PP_00693; phage(gi428782612) 1e-21 Click
24complement(703507..704055) PHAGE_Entero_HK106: side tail fiber protein; PP_00694; phage(gi428783303) 3e-30 Click
25704086..704652 PHAGE_Entero_2: DNA-invertase; PP_00695; phage(gi169936026) 9e-88 Click
26complement(704610..704744) hypothetical; PP_00696 0.0 Click
27704795..705967 PHAGE_Entero_2: P2 gpFI-like protein; PP_00697; phage(gi169936025) 0.0 Click
28705977..706492 PHAGE_Entero_2: P2 gpFII-like protein; PP_00698; phage(gi169936024) 4e-91 Click
29706547..706849 PHAGE_Entero_2: P2 gpE-like tail protein; PP_00699; phage(gi169936023) 3e-45 Click
30706864..706983 PHAGE_Entero_2: P2 gpE-like protein; PP_00700; phage(gi169936022) 4e-15 Click
31706976..710053 PHAGE_Entero_2: P2 gpT-like tail protein; PP_00701; phage(gi169936021) 0.0 Click
32710050..710535 PHAGE_Entero_2: P2 gpU-like tail protein; PP_00702; phage(gi169936020) 1e-75 Click
33710532..711632 PHAGE_Entero_2: P2 gpD-like tail protein; PP_00703; phage(gi169936019) 0.0 Click
34711723..711941 PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); PP_00704; phage(gi169936018) 2e-22 Click

Region 6, total : 59 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11455868..1455890 attL    ACACGAAAGATCACATACAAAGA 0.0 Click
2complement(1457078..1459810) PHAGE_Entero_HK620: tail spike protein; PP_01486; phage(gi13559880) 4e-58 Click
3complement(1460189..1461091) PHAGE_Salmon_epsilon34: Ant; PP_01487; phage(gi221328691) 6e-173 Click
4complement(1461160..1461303) PHAGE_Salmon_epsilon34: Arc; transcriptional repressor; PP_01488; phage(gi221328635) 9e-21 Click
5complement(1461681..1462112) PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp15; PP_01489; phage(gi221328633) 6e-75 Click
61462292..1462606 PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_01490; phage(gi399498805) 4e-55 Click
7complement(1462631..1464457) PHAGE_Entero_P22: injection protein; PP_01491; phage(gi51236731) 0.0 Click
8complement(1464457..1465842) PHAGE_Salmon_vB_SemP_Emek: injection protein; PP_01492; phage(gi399498803) 0.0 Click
9complement(1465853..1466548) PHAGE_Entero_IME10: DNA transfer protein; PP_01493; phage(gi422934288) 5e-115 Click
10complement(1466551..1467006) PHAGE_Entero_IME10: head assembly protein; PP_01494; phage(gi422934287) 1e-86 Click
11complement(1467006..1467707) PHAGE_Entero_IME10: DNA stabilization protein; PP_01495; phage(gi422934286) 1e-120 Click
12complement(1467707..1469125) PHAGE_Entero_IME10: DNA stabilization protein; PP_01496; phage(gi422934285) 0.0 Click
13complement(1469126..1469626) PHAGE_Entero_IME10: DNA stabilization protein; PP_01497; phage(gi422934284) 7e-93 Click
14complement(1469604..1469852) PHAGE_Salmon_SPN9CC: hypothetical protein; PP_01498; phage(gi389060541) 7e-05 Click
15complement(1469897..1471192) PHAGE_Entero_IME10: coat protein; PP_01499; phage(gi422934283) 0.0 Click
16complement(1471192..1472103) PHAGE_Entero_IME10: scaffolding protein; PP_01500; phage(gi422934282) 6e-169 Click
17complement(1472117..1474282) PHAGE_Entero_IME10: portal protein; PP_01501; phage(gi422934281) 0.0 Click
18complement(1474283..1475782) PHAGE_Entero_IME10: terminase large subunit; PP_01502; phage(gi422934280) 0.0 Click
19complement(1475760..1476254) PHAGE_Entero_P22: terminase small subunit; PP_01503; phage(gi51236745) 2e-91 Click
20complement(1476272..1476451) PHAGE_Entero_HK620: hypothetical protein HK620p41; PP_01504; phage(gi13559864) 4e-25 Click
21complement(1476453..1476695) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_01505; phage(gi399498861) 5e-30 Click
22complement(1476799..1477155) PHAGE_Entero_Sf6: hypothetical protein Sf6p66; PP_01506; phage(gi41057339) 3e-44 Click
23complement(1477314..1477856) PHAGE_Escher_P13374: regulatory protein; PP_01507; phage(gi410491650) 2e-61 Click
24complement(1478060..1478533) PHAGE_Escher_HK75: Rz; PP_01508; phage(gi356870731) 1e-75 Click
25complement(1478586..1479083) PHAGE_Stx2_c_1717: phage-related lysozyme; PP_01509; phage(gi209447172) 5e-92 Click
26complement(1479860..1480483) PHAGE_Entero_IME10: regulatory protein Q; PP_01510; phage(gi422934275) 3e-117 Click
27complement(1480665..1481027) PHAGE_Entero_mEpX2: endodeoxyribonuclease RusA; PP_01511; phage(gi428765669) 8e-65 Click
28complement(1481024..1481314) PHAGE_Salmon_SPN9CC: hypothetical protein; PP_01512; phage(gi389060524) 3e-52 Click
29complement(1481617..1481733) PHAGE_Entero_mEp235: NinF protein; PP_01513; phage(gi428781860) 1e-11 Click
30complement(1481813..1482214) PHAGE_Entero_mEpX2: hypothetical protein; PP_01514; phage(gi428765665) 7e-75 Click
31complement(1482390..1482800) PHAGE_Entero_mEpX1: NinB recombinase; PP_01515; phage(gi428781922) 3e-72 Click
32complement(1482803..1483006) PHAGE_Entero_mEp235: hypothetical protein; PP_01516; phage(gi428781857) 2e-32 Click
33complement(1483129..1483329) PHAGE_Entero_Sf6: gene 47 protein; PP_01517; phage(gi41057324) 5e-33 Click
34complement(1483326..1483652) PHAGE_Entero_Sf6: gene 46 protein; PP_01518; phage(gi41057323) 3e-60 Click
35complement(1483725..1484006) PHAGE_Entero_mEpX2: hypothetical protein; PP_01519; phage(gi428765662) 1e-45 Click
36complement(1484003..1485379) PHAGE_Entero_HK97: Gp55; PP_01520; phage(gi9634201) 0.0 Click
37complement(1485376..1486140) PHAGE_Salmon_SPN9CC: bacteriophage replication protein O; PP_01521; phage(gi389060512) 2e-144 Click
38complement(1486184..1486345) PHAGE_Escher_HK75: hypothetical protein; PP_01522; phage(gi356870717) 2e-24 Click
39complement(1486380..1486658) PHAGE_Entero_HK140: CII protein; PP_01523; phage(gi428781990) 2e-45 Click
40complement(1486767..1486952) PHAGE_Entero_mEp235: prophage antirepressor; PP_01524; phage(gi428781851) 4e-28 Click
411487324..1487683 PHAGE_Entero_IME10: repressor protein; PP_01525; phage(gi422934295) 4e-65 Click
421487995..1488267 PHAGE_Entero_HK140: anti-termination protein N; PP_01526; phage(gi428781985) 2e-41 Click
431488270..1488563 hypothetical; PP_01527 0.0 Click
44complement(1488564..1488728) hypothetical; PP_01528 0.0 Click
451489017..1489139 PHAGE_Entero_HK544: restriction alleviation protein; PP_01529; phage(gi428783253) 8e-17 Click
461489322..1489690 PHAGE_Entero_mEpX2: hypothetical protein; PP_01530; phage(gi428765651) 2e-68 Click
471489766..1489900 PHAGE_Entero_mEpX2: CIII protein; PP_01531; phage(gi428765650) 1e-18 Click
481489885..1490037 PHAGE_Escher_HK75: kil protein; PP_01532; phage(gi356870711) 4e-23 Click
491490034..1490192 PHAGE_Entero_Sf6: gene 30 protein; PP_01533; phage(gi41057308) 2e-25 Click
501490292..1490999 PHAGE_Entero_IME10: ORF252; PP_01534; phage(gi422934293) 1e-139 Click
511491000..1491506 PHAGE_Escher_HK75: single-stranded DNA binding protein; PP_01535; phage(gi356870708) 6e-93 Click
521491515..1492063 PHAGE_Entero_mEpX2: exonuclease; PP_01536; phage(gi428765644) 4e-104 Click
531492080..1492373 PHAGE_Escher_HK75: anti-RecBCD protein 2; PP_01537; phage(gi356870707) 1e-52 Click
541492384..1492548 PHAGE_Entero_HK620: hypothetical protein HK620p09; PP_01538; phage(gi13559832) 7e-26 Click
551492545..1493432 PHAGE_Salmon_ST64B: hypothetical protein sb31; PP_01539; phage(gi23505475) 5e-43 Click
561493508..1493882 PROPHAGE_Escher_CFT073: transposase insC; PP_01540; phage(gi26249447) 7e-45 Click
57complement(1493933..1494166) adhesin [Shigella sonnei 53G] gi|383179205|ref|YP_005457210.1|; PP_01541 1e-28 Click
581494277..1494444 PHAGE_Entero_HK633: hypothetical protein; PP_01542; phage(gi428782549) 2e-18 Click
591494992..1495222 hypothetical; PP_01543 0.0 Click
60complement(1495180..1496181) PHAGE_Salmon_vB_SosS_Oslo: integrase; PP_01544; phage(gi399528791) 1e-144 Click
611496569..1496591 attR    ACACGAAAGATCACATACAAAGA 0.0 Click

Region 7, total : 78 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12139205..2139224 attL    TTTTCATCAACAAGGATTTT 0.0 Click
2complement(2139407..2140411) PHAGE_Yersin_413C: Int; PP_02187; phage(gi30065733) 7e-97 Click
3complement(2140508..2140627) phage repressor protein [Citrobacter rodentium ICC168] gi|283787273|ref|YP_003367138.1|; PP_02188 7e-15 Click
42140944..2141231 PHAGE_Yersin_413C: Cox; PP_02189; phage(gi30065735) 2e-19 Click
52141238..2141444 prophage membrane protein [Citrobacter rodentium ICC168] gi|283787271|ref|YP_003367136.1|; PP_02190 6e-29 Click
62141564..2141914 hypothetical protein ROD_36951 [Citrobacter rodentium ICC168] gi|283787270|ref|YP_003367135.1|; PP_02191 2e-58 Click
72141925..2142203 hypothetical protein ECNA114_0922 [Escherichia coli NA114] gi|386618439|ref|YP_006138019.1|; PP_02192 6e-44 Click
82142215..2142457 hypothetical protein G2583_2115 [Escherichia coli O55:H7 str. CB9615] gi|291282848|ref|YP_003499666.1|; PP_02193 1e-38 Click
92142454..2142567 hypothetical protein SSON53_08340 [Shigella sonnei 53G] gi|383178213|ref|YP_005456218.1|; PP_02194 5e-11 Click
102142661..2143071 hypothetical protein G2583_2116 [Escherichia coli O55:H7 str. CB9615] gi|291282849|ref|YP_003499667.1|; PP_02195 7e-68 Click
112143095..2143298 hypothetical protein G2583_2117 [Escherichia coli O55:H7 str. CB9615] gi|291282850|ref|YP_003499668.1|; PP_02196 3e-32 Click
122143295..2143561 hypothetical protein G2583_2118 [Escherichia coli O55:H7 str. CB9615] gi|291282851|ref|YP_003499669.1|; PP_02197 1e-45 Click
132143558..2143857 PHAGE_Entero_mEp213: hypothetical protein; PP_02198; phage(gi428782624) 4e-08 Click
142144179..2144409 hypothetical protein ECNA114_0916 [Escherichia coli NA114] gi|386618433|ref|YP_006138013.1|; PP_02199 6e-35 Click
152144512..2144871 hypothetical protein O3K_11605 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481863|ref|YP_006779012.1|; PP_02200 4e-64 Click
162144868..2147708 PHAGE_Yersin_413C: gpA; PP_02201; phage(gi30065742) 1e-77 Click
172147785..2148744 plasmid partition protein [Escherichia coli O26:H11 str. 11368] gi|260855860|ref|YP_003229751.1|; PP_02202 0.0 Click
182148749..2149060 plasmid partition protein [Escherichia coli O26:H11 str. 11368] gi|260855861|ref|YP_003229752.1|; PP_02203 7e-52 Click
192149124..2149714 PHAGE_Salmon_ST64B: hypothetical protein sb32; PP_02204; phage(gi23505476) 7e-33 Click
202150008..2150136 hypothetical protein ECOK1_2572 [Escherichia coli IHE3034] gi|386600215|ref|YP_006101721.1|; PP_02205 4e-12 Click
21complement(2150205..2151251) PHAGE_Erwini_ENT90: phage portal protein; PP_02206; phage(gi431810941) 4e-92 Click
22complement(2151251..2153002) PHAGE_Yersin_413C: gpP; PP_02207; phage(gi30065706) 6e-132 Click
232153157..2153993 PHAGE_Salmon_RE_2010: capsid scaffolding protein; PP_02208; phage(gi418489698) 2e-46 Click
242154017..2155069 PHAGE_Yersin_413C: gpN; PP_02209; phage(gi30065708) 6e-74 Click
252155115..2155915 PHAGE_Ralsto_phiRSA1: terminase; PP_02210; phage(gi145708083) 6e-36 Click
262156018..2156512 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); PP_02211; phage(gi134288689) 9e-26 Click
272156512..2156712 PHAGE_Yersin_413C: gpX; PP_02212; phage(gi30065711) 1e-10 Click
282156715..2157038 PHAGE_Aeromo_phiO18P: putative holin; PP_02213; phage(gi148727161) 2e-09 Click
292157093..2157638 PHAGE_Erwini_vB_EamP_S6: endolysin; PP_02214; phage(gi422935930) 1e-68 Click
302157635..2158042 hypothetical protein ECOK1_2582 [Escherichia coli IHE3034] gi|386600225|ref|YP_006101731.1|; PP_02215 4e-70 Click
312158180..2158647 PHAGE_Yersin_413C: gpR; PP_02216; phage(gi30065716) 8e-19 Click
322158640..2159275 PHAGE_Pseudo_phiCTX: predicted tail completion; PP_02217; phage(gi17313233) 3e-19 Click
332159272..2159805 PHAGE_Yersin_413C: gpV; PP_02218; phage(gi30065718) 7e-31 Click
342159851..2160201 PHAGE_Yersin_413C: gpW; PP_02219; phage(gi30065719) 3e-21 Click
352160205..2161101 PHAGE_Yersin_413C: gpJ; PP_02220; phage(gi30065720) 2e-85 Click
362161094..2161624 PHAGE_Yersin_413C: gpI; PP_02221; phage(gi30065721) 3e-62 Click
372161627..2163213 PHAGE_Yersin_413C: gpH; PP_02222; phage(gi30065722) 2e-73 Click
382163263..2163628 PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; PP_02223; phage(gi17546153) 1e-45 Click
392163586..2164611 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; PP_02224; phage(gi16130763) 8e-178 Click
402164915..2165466 transporter [Escherichia coli str. 'clone D i2'] gi|386627960|ref|YP_006147680.1|; PP_02225 2e-83 Click
412165417..2165581 hypothetical protein EC042_0618 [Escherichia coli 042] gi|387606082|ref|YP_006094938.1|; PP_02226 1e-09 Click
422165765..2165917 regulatory peptide MokC [Shigella sonnei 53G] gi|383177147|ref|YP_005455152.1|; PP_02227 3e-20 Click
43complement(2166000..2166482) putative transcriptional regulator YcgE [Escherichia coli str. 'clone D i2'] gi|386628915|ref|YP_006148635.1|; PP_02228 4e-85 Click
44complement(2166687..2167319) hypothetical protein i02_1435 [Escherichia coli str. 'clone D i2'] gi|386628917|ref|YP_006148637.1|; PP_02229 1e-112 Click
452167367..2167774 nitrate reductase 1, cytochrome b(NR) subunit gamma [Shigella sonnei Ss046] gi|74312432|ref|YP_310851.1|; PP_02230 4e-71 Click
46complement(2168257..2169099) PHAGE_Prochl_P_SSM7: PRGA-formyltransferase; PP_02231; phage(gi326784531) 1e-17 Click
472169293..2169919 PHAGE_Burkho_phi1026b: gp58; PP_02232; phage(gi38707948) 9e-07 Click
482170011..2170559 PHAGE_Yersin_413C: gpH; PP_02233; phage(gi30065722) 7e-53 Click
492170562..2171095 PHAGE_Entero_Mu: tail fiber assembly protein; PP_02234; phage(gi19584573) 3e-99 Click
50complement(2171124..2171651) PHAGE_Yersin_413C: gpG; PP_02235; phage(gi30065723) 7e-91 Click
51complement(2171655..2172491) PHAGE_Yersin_413C: gpH; PP_02236; phage(gi30065722) 2e-53 Click
522172602..2172748 formate dehydrogenase-N subunit gamma [Escherichia coli S88] gi|218558398|ref|YP_002391311.1|; PP_02237 8e-22 Click
53complement(2172977..2173948) PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; PP_02238; phage(gi116326757) 4e-22 Click
54complement(2174322..2174663) PHAGE_Cronob_vB_CsaM_GAP32: translation initiation factor IF-3; PP_02239; phage(gi414087231) 1e-08 Click
55complement(2174868..2176595) threonyl-tRNA synthetase [Escherichia coli W] gi|386609107|ref|YP_006124593.1|; PP_02240 0.0 Click
562176617..2176970 hydroperoxidase II [Escherichia coli str. 'clone D i2'] gi|386629425|ref|YP_006149145.1|; PP_02241 1e-60 Click
57complement(2177017..2177775) hypothetical protein ECP_1679 [Escherichia coli 536] gi|110641853|ref|YP_669583.1|; PP_02242 6e-142 Click
58complement(2178026..2178280) PTS system N,N'-diacetylchitobiose-specific transporter subunit IIB [Shigella sonnei Ss046] gi|74311943|ref|YP_310362.1|; PP_02243 3e-39 Click
592178531..2179037 nucleotide excision repair endonuclease [Escherichia coli str. 'clone D i2'] gi|386629434|ref|YP_006149154.1|; PP_02244 2e-92 Click
60complement(2178997..2179140) hypothetical protein SSON_1416 [Shigella sonnei Ss046] gi|74311939|ref|YP_310358.1|; PP_02245 2e-21 Click
61complement(2179158..2179391) bifunctional succinylornithine transaminase/acetylornithine transaminase [Shigella sonnei Ss046] gi|74311933|ref|YP_310352.1|; PP_02246 6e-40 Click
622179654..2179824 hypothetical protein i02_1968 [Escherichia coli str. 'clone D i2'] gi|386629442|ref|YP_006149162.1|; PP_02247 4e-25 Click
632179837..2180073 exonuclease III [Shigella sonnei Ss046] gi|74311932|ref|YP_310351.1|; PP_02248 6e-17 Click
642180036..2180182 hypothetical protein CE10_2166 [Escherichia coli O7:K1 str. CE10] gi|386624509|ref|YP_006144237.1|; PP_02249 9e-21 Click
65complement(2180212..2180856) chemotaxis regulator CheZ [Shigella flexneri 5 str. 8401] gi|110805861|ref|YP_689381.1|; PP_02250 7e-115 Click
66complement(2180883..2181446) hypothetical protein SSON_2221 [Shigella sonnei Ss046] gi|74312687|ref|YP_311106.1|; PP_02251 6e-64 Click
67complement(2181434..2182639) PHAGE_Yersin_413C: gpH; PP_02252; phage(gi30065722) 4e-27 Click
682182867..2183454 PHAGE_Escher_D108: G region invertase; PP_02253; phage(gi281199698) 1e-84 Click
69complement(2183490..2183978) PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_02254; phage(gi29143763) 3e-39 Click
70complement(2183991..2186798) PHAGE_Yersin_413C: gpT; PP_02255; phage(gi30065729) 3e-108 Click
71complement(2186785..2186913) PHAGE_Yersin_413C: gpE+E'; PP_02256; phage(gi30065728) 1e-05 Click
72complement(2186949..2187314) PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_02257; phage(gi29143760) 2e-06 Click
73complement(2187369..2187881) PROPHAGE_Salmon_Ty2: major tail tube protein; PP_02258; phage(gi29143759) 5e-35 Click
74complement(2187881..2189065) PHAGE_Erwini_ENT90: tail sheath protein; PP_02259; phage(gi431810939) 2e-101 Click
752189045..2189176 hypothetical; PP_02260 0.0 Click
762189223..2190332 PHAGE_Yersin_413C: gpD; PP_02261; phage(gi30065731) 4e-95 Click
772190375..2190635 PHAGE_Yersin_413C: Ogr; PP_02262; phage(gi30065732) 1e-07 Click
782190826..2190966 PHAGE_Escher_P13374: prophage host toxic membrane protein; PP_02263; phage(gi410491667) 1e-15 Click
79complement(2190996..2191115) hypothetical; PP_02264 0.0 Click
802191350..2192135 PHAGE_Bordet_1: adenine DNA methyltransferase; PP_02265; phage(gi41179391) 7e-67 Click
812192244..2192263 attR    TTTTCATCAACAAGGATTTT 0.0 Click

Region 8, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14023581..4023594 attL    TTCGGCCTGCTGAC 0.0 Click
2complement(4030622..4031047) PHAGE_Pseudo_YuA: hypothetical protein; PP_04076; phage(gi162135127) 6e-14 Click
3complement(4031464..4032240) hypothetical protein SeHA_A0046 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447257|ref|YP_002043884.1|; PP_04077 5e-141 Click
4complement(4032286..4032720) hypothetical protein SeHA_A0045 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447297|ref|YP_002043883.1|; PP_04078 8e-70 Click
5complement(4032734..4032955) PHAGE_Entero_N15: gp50; PP_04079; phage(gi9630517) 4e-06 Click
6complement(4032956..4033639) PHAGE_Natria_PhiCh1: adenine methyltransferase; PP_04080; phage(gi22091198) 1e-22 Click
74033746..4033871 hypothetical protein ECH74115_B0049 [Escherichia coli O157:H7 str. EC4115] gi|209395539|ref|YP_002268431.1|; PP_04081 4e-13 Click
8complement(4034023..4034460) hypothetical protein SeHA_A0041 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447245|ref|YP_002043879.1|; PP_04082 4e-83 Click
9complement(4034611..4034925) hypothetical protein SeHA_A0041 [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447245|ref|YP_002043879.1|; PP_04083 5e-53 Click
104035123..4035413 PHAGE_Sodali_phiSG1: ImpC protein; PP_04084; phage(gi89886014) 4e-15 Click
114035410..4035601 PHAGE_Cronob_ENT39118: protein umuD; PP_04085; phage(gi431811072) 1e-05 Click
124035602..4035847 PHAGE_Cronob_ENT39118: protein umuD; PP_04086; phage(gi431811072) 3e-07 Click
134035847..4036473 PHAGE_Cronob_ENT39118: DNA polymerase; PP_04087; phage(gi431811050) 1e-63 Click
144036886..4037122 PHAGE_Cronob_ENT39118: DNA polymerase; PP_04088; phage(gi431811050) 1e-20 Click
15complement(4037124..4037420) plasmid stability protein [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447289|ref|YP_002043873.1|; PP_04089 1e-47 Click
16complement(4037533..4038513) plasmid segregation protein ParM [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447181|ref|YP_002043872.1|; PP_04090 0.0 Click
17complement(4038926..4039234) putative 60 kDa chaperonin [Salmonella enterica subsp. enterica serovar Heidelberg str. SL476] gi|194447247|ref|YP_002043871.1|; PP_04091 2e-48 Click
18complement(4039321..4039965) PHAGE_Burkho_2: gp12, partition protein; PP_04092; phage(gi134288738) 5e-06 Click
194040346..4040555 hypothetical; PP_04093 0.0 Click
204040815..4042350 colicin (partial), partial [Erwinia amylovora ATCC 49946] gi|292898771|ref|YP_003538140.1|; PP_04094 4e-49 Click
21complement(4042368..4042895) colicin immunity protein [Erwinia amylovora ATCC 49946] gi|292898770|ref|YP_003538139.1|; PP_04095 7e-20 Click
224043139..4044116 ferredoxin (2Fe-2S) [Pectobacterium carotovorum subsp. carotovorum PC1] gi|253688685|ref|YP_003017875.1|; PP_04096 8e-24 Click
23complement(4044517..4045299) PHAGE_Strept_6: putative integrase; PP_04097; phage(gi28876488) 7e-05 Click
244051111..4051124 attR    TTCGGCCTGCTGAC 0.0 Click