Escherichia coli M605 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].5446689, GC%: 50.43%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(306922..307269) PHAGE_Rhodob_RcapNL: hypothetical protein; PP_00298; phage(gi461475014) 2e-14 Click
2complement(307233..307766) plasmid SOS inhibition protein A [Escherichia coli UTI89] gi|91206341|ref|YP_538695.1|; PP_00299 1e-96 Click
3complement(307780..307953) Putative SOS inhibition protein A [Escherichia coli NA114] gi|386622279|ref|YP_006141859.1|; PP_00300 4e-18 Click
4308095..308772 PHAGE_Stx2_c_1717: truncated transposase; PP_00301; phage(gi209447151) 3e-10 Click
5308769..309116 PHAGE_Stx2_c_1717: transposase; PP_00302; phage(gi209447152) 5e-43 Click
6309136..310737 PHAGE_Stx2_c_1717: transposase; PP_00303; phage(gi209447153) 8e-162 Click
7complement(312324..313292) PHAGE_Entero_HK022: IS903 transposase; PP_00304; phage(gi9634149) 3e-170 Click
8313272..313874 PHAGE_Entero_Mu: tail fiber; PP_00305; phage(gi9633540) 2e-91 Click
9complement(313871..314737) PROPHAGE_Escher_MG1655: IS3 transposase B; PP_00306; phage(gi16128284) 2e-172 Click
10complement(314734..315033) PROPHAGE_Escher_MG1655: IS3 transposase A; PP_00307; phage(gi226524700) 4e-49 Click
11315812..315888 tRNA 0.0 Click
12316051..316854 2,5-diketo-D-gluconate reductase B [Escherichia coli str. 'clone D i2'] gi|386627727|ref|YP_006147447.1|; PP_00308 2e-147 Click
13complement(316851..317765) PHAGE_Burkho_phi1026b: gp58; PP_00309; phage(gi38707948) 5e-16 Click

Region 2, total : 57 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1868570..868584 attL    GCTTTTTTATACTAA 0.0 Click
2complement(868658..869728) PHAGE_Entero_HK106: integrase; PP_00842; phage(gi428783305) 0.0 Click
3869976..870146 hypothetical protein ETEC_0781 [Escherichia coli ETEC H10407] gi|387611256|ref|YP_006114372.1|; PP_00843 3e-24 Click
4complement(870203..870487) PHAGE_Entero_ST104: ORF6; PP_00844; phage(gi46358654) 6e-51 Click
5complement(870480..871154) PHAGE_Entero_cdtI: Valyl-tRNA synthetase; PP_00845; phage(gi148609417) 7e-24 Click
6complement(871151..871747) PHAGE_Entero_HK140: hypothetical protein; PP_00846; phage(gi428781974) 9e-89 Click
7complement(871744..872064) hypothetical protein [Escherichia coli O55:H7 str. RM12579] gi|387504807|ref|YP_006157146.1|; PP_00847 7e-60 Click
8complement(872080..872388) PHAGE_Pseudo_phi297: hypothetical protein; PP_00848; phage(gi374531250) 1e-07 Click
9complement(872385..872552) PHAGE_Entero_Sf6: gene 23 protein; PP_00849; phage(gi41057301) 1e-25 Click
10complement(872549..872839) PHAGE_Entero_Sf6: gene 24 protein; PP_00850; phage(gi41057302) 1e-48 Click
11complement(872850..873146) PHAGE_Entero_mEp235: Abc2 protein; PP_00851; phage(gi428781839) 1e-53 Click
12complement(873163..873711) PHAGE_Entero_mEpX2: exonuclease; PP_00852; phage(gi428765644) 4e-104 Click
13complement(873720..874226) PHAGE_Escher_HK75: single-stranded DNA binding protein; PP_00853; phage(gi356870708) 5e-95 Click
14complement(874227..874934) PHAGE_Entero_mEpX2: Rad52/22 family double-strand break repair protein; PP_00854; phage(gi428765646) 6e-140 Click
15complement(875034..875192) PHAGE_Entero_Sf6: gene 30 protein; PP_00855; phage(gi41057308) 2e-25 Click
16complement(875189..875359) PHAGE_Salmon_SPN9CC: hypothetical protein; PP_00856; phage(gi389060502) 3e-26 Click
17complement(875599..876048) PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; PP_00857; phage(gi399528805) 1e-74 Click
18876172..876351 hypothetical; PP_00858 0.0 Click
19complement(876560..876901) PHAGE_Salmon_ST160: Gp24; PP_00859; phage(gi318065922) 1e-31 Click
20complement(877341..877463) hypothetical; PP_00860 0.0 Click
21complement(878276..878983) PHAGE_Stx2_c_I: CI protein; PP_00861; phage(gi20065916) 2e-134 Click
22879062..879289 PHAGE_Stx2_c_I: Cro protein; PP_00862; phage(gi20065917) 1e-37 Click
23879396..879695 PHAGE_Entero_Min27: regulatory protein CII; PP_00863; phage(gi170783637) 4e-51 Click
24880053..880940 PHAGE_Salmon_SPN9CC: bacteriophage replication protein O; PP_00864; phage(gi389060512) 5e-68 Click
25880937..882313 PHAGE_Entero_HK97: Gp55; PP_00865; phage(gi9634201) 0.0 Click
26883025..883552 PHAGE_Entero_HK544: putative N-6-adenine-methyltransferase; PP_00866; phage(gi428783266) 9e-102 Click
27884306..884437 PHAGE_Entero_mEp234: NinF protein; PP_00867; phage(gi428782303) 4e-06 Click
28884844..885041 PHAGE_Entero_Sf6: gene 54 protein; PP_00868; phage(gi41057342) 1e-32 Click
29885085..885573 PHAGE_Stx2_c_1717: antiterminator Q protein; PP_00869; phage(gi209447165) 2e-90 Click
30885665..885739 tRNA 0.0 Click
31885745..885820 tRNA 0.0 Click
32885940..886155 PHAGE_Escher_P13374: lysis protein, holin; PP_00870; phage(gi410491645) 7e-26 Click
33886155..886652 PHAGE_Entero_cdtI: lysin; PP_00871; phage(gi148609440) 9e-91 Click
34886848..887033 PHAGE_Entero_P22: hypothetical protein P22gp68; PP_00872; phage(gi51236746) 2e-27 Click
35887083..887226 PHAGE_Entero_mEp460: hypothetical protein; PP_00873; phage(gi428782374) 5e-21 Click
36887639..887764 hypothetical protein EcWSU1_02325 [Enterobacter cloacae EcWSU1] gi|365970620|ref|YP_004952181.1|; PP_00874 4e-11 Click
37888274..888738 PHAGE_Cronob_phiES15: terminase small subunit; PP_00875; phage(gi401817591) 1e-34 Click
38888692..890212 PHAGE_Haemop_Aaphi23: putative terminase large subunit TerL; PP_00876; phage(gi31544028) 3e-128 Click
39890272..891747 PHAGE_Burkho_Bcep1: gp18; PP_00877; phage(gi38638625) 2e-90 Click
40891800..892486 PHAGE_Burkho_Bcep1: gp17; PP_00878; phage(gi38638624) 2e-36 Click
41892620..893846 PHAGE_Burkho_Bcep1: gp15; PP_00879; phage(gi38638622) 1e-39 Click
42893850..894329 PHAGE_Burkho_Bcep1: gp14; PP_00880; phage(gi38638621) 7e-17 Click
43894333..895373 PHAGE_Burkho_Bcep1: gp13; PP_00881; phage(gi38638620) 8e-82 Click
44895542..895724 hypothetical; PP_00882 0.0 Click
45896570..896734 hypothetical; PP_00883 0.0 Click
46896709..897080 PHAGE_Burkho_Bcep1: gp06; PP_00884; phage(gi38638613) 1e-09 Click
47897077..897592 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; PP_00885; phage(gi422937548) 4e-17 Click
48897589..899079 PHAGE_Burkho_Bcep1: gp04; PP_00886; phage(gi38638611) 2e-61 Click
49899091..899525 PHAGE_Burkho_Bcep1: gp03; PP_00887; phage(gi38638610) 9e-13 Click
50899525..899932 PHAGE_Aeromo_vB_AsaM_56: hypothetical protein; PP_00888; phage(gi422937551) 2e-07 Click
51900001..900147 hypothetical; PP_00889 0.0 Click
52900144..901919 PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber/lysozyme protein; PP_00890; phage(gi422937553) 2e-20 Click
53902619..903434 PHAGE_Acinet_AP22: hypothetical protein; PP_00891; phage(gi388570812) 3e-05 Click
54903651..904607 PHAGE_Burkho_Bcep1: gp40; PP_00892; phage(gi38638648) 8e-07 Click
55904600..905292 PHAGE_Burkho_Bcep1: gp38; PP_00893; phage(gi38638646) 6e-21 Click
56905511..905648 hypothetical; PP_00894 0.0 Click
57905645..906874 PHAGE_Burkho_Bcep1: gp35; PP_00895; phage(gi38638643) 2e-60 Click
58907526..908308 PHAGE_Burkho_Bcep1: gp33; PP_00896; phage(gi38638641) 2e-17 Click
59complement(908967..910796) PHAGE_Salmon_c341: O-polysaccharide acetyltransferase protein; PP_00897; phage(gi255252697) 1e-67 Click
60complement(910807..910974) hypothetical; PP_00898 0.0 Click
61911090..911389 PHAGE_Entero_HK140: hypothetical protein; PP_00899; phage(gi428781967) 2e-45 Click
62912054..912068 attR    GCTTTTTTATACTAA 0.0 Click

Region 3, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1990543..990564 attL    ATAAATTTCAGGCAACAAAAAA 0.0 Click
2complement(990644..991681) PHAGE_Entero_2: P2 Int-like protein; PP_00974; phage(gi169936064) 1e-95 Click
3complement(992077..992646) PHAGE_Entero_2: P2 CI-like protein; PP_00975; phage(gi169936063) 1e-35 Click
4992792..992995 PHAGE_Pasteu_F108: Cox; PP_00976; phage(gi109302900) 8e-07 Click
5993060..993569 PHAGE_Entero_2: bacteriophage regulatory protein CII; PP_00977; phage(gi169936061) 8e-84 Click
6993577..993777 PHAGE_Entero_2: hypothetical protein STM2735.Fels2; PP_00978; phage(gi169936060) 3e-13 Click
7993741..994082 PHAGE_Entero_2: hypothetical protein STM2733.Fels2; PP_00979; phage(gi169936058) 3e-51 Click
8994150..994383 PHAGE_Entero_2: hypothetical protein STM2732.Fels2; PP_00980; phage(gi169936057) 8e-28 Click
9994383..994610 PHAGE_Entero_2: P2 gpOrf82-like protein; PP_00981; phage(gi169936056) 5e-35 Click
10994906..995763 PHAGE_Entero_2: DNA adenine methylase-like protein; PP_00982; phage(gi169936055) 1e-116 Click
11995760..998174 PHAGE_Entero_2: P2 gpA-like protein; PP_00983; phage(gi169936054) 0.0 Click
12998343..998516 PHAGE_Entero_2: hypothetical protein STM2728.Fels2; PP_00984; phage(gi169936053) 1e-25 Click
13998527..998760 PHAGE_Entero_2: TumB protein; PP_00985; phage(gi169936052) 8e-38 Click
14complement(998889..999629) hypothetical protein ECIAI1_0767 [Escherichia coli IAI1] gi|218553317|ref|YP_002386230.1|; PP_00986 5e-33 Click
151000000..1000800 TIR protein [Shewanella putrefaciens 200] gi|386315417|ref|YP_006011582.1|; PP_00987 7e-46 Click
16complement(1000845..1001870) PHAGE_Entero_2: P2 gpQ-like protein; PP_00988; phage(gi169936049) 2e-171 Click
17complement(1001870..1003636) PHAGE_Entero_2: P2 gpP-like protein; PP_00989; phage(gi169936048) 0.0 Click
181003779..1004612 PHAGE_Entero_2: P2 gpO-like protein; PP_00990; phage(gi169936047) 4e-131 Click
191004629..1005687 PHAGE_Entero_2: P2 gpN-like major capsid protein; PP_00991; phage(gi169936046) 1e-178 Click
201005691..1006341 PHAGE_Entero_2: P2 gpM-like protein; PP_00992; phage(gi169936045) 3e-113 Click
211006437..1006901 PHAGE_Entero_2: P2 gpL-like protein; PP_00993; phage(gi169936044) 2e-78 Click
221006901..1007101 PHAGE_Entero_2: P2 gpX-like tail protein; PP_00994; phage(gi169936043) 3e-31 Click
231007105..1007320 PHAGE_Entero_2: lysis protein; PP_00995; phage(gi169936042) 2e-28 Click
241007301..1007816 PHAGE_Entero_2: endolysin; PP_00996; phage(gi169936041) 5e-82 Click
251007813..1008241 PHAGE_Entero_2: P2 LysB-like protein; PP_00997; phage(gi169936038) 3e-59 Click
261008201..1008374 PHAGE_Entero_2: P2 LysC-like protein; PP_00998; phage(gi169936037) 2e-20 Click
271008337..1008768 PHAGE_Entero_2: P2 gpR-like tail completion protein; PP_00999; phage(gi169936036) 3e-72 Click
281008761..1009204 PHAGE_Entero_2: P2 gpS-like tail completion protein; PP_01000; phage(gi169936035) 9e-69 Click
29complement(1009222..1009959) hypothetical protein DAMO_2053 [Candidatus Methylomirabilis oxyfera] gi|392375101|ref|YP_003206934.1|; PP_01001 1e-12 Click
301010053..1010631 PHAGE_Entero_2: P2 gpV-like protein; PP_01002; phage(gi169936034) 2e-95 Click
311010628..1010987 PHAGE_Entero_2: P2 gpW-like baseplate protein; PP_01003; phage(gi169936033) 6e-51 Click
321010974..1011882 PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; PP_01004; phage(gi169936032) 7e-148 Click
331011875..1012480 PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; PP_01005; phage(gi169936031) 2e-109 Click
341012477..1013886 PHAGE_Entero_2: P2 gpH-like protein; PP_01006; phage(gi169936030) 1e-120 Click
351013858..1014310 PHAGE_Entero_2: P2 gpG-like protein; PP_01007; phage(gi169936028) 3e-18 Click
36complement(1014282..1014875) PHAGE_Entero_HK106: tail fiber assembly protein; PP_01008; phage(gi428783304) 3e-61 Click
371014901..1015158 PHAGE_Entero_2: DNA-invertase; PP_01009; phage(gi169936026) 1e-31 Click
381015310..1016482 PHAGE_Entero_2: P2 gpFI-like protein; PP_01010; phage(gi169936025) 0.0 Click
391016492..1017007 PHAGE_Entero_2: P2 gpFII-like protein; PP_01011; phage(gi169936024) 4e-91 Click
401017062..1017364 PHAGE_Entero_2: P2 gpE-like tail protein; PP_01012; phage(gi169936023) 2e-44 Click
411017379..1017498 PHAGE_Entero_2: P2 gpE-like protein; PP_01013; phage(gi169936022) 4e-15 Click
421017491..1020568 PHAGE_Entero_2: P2 gpT-like tail protein; PP_01014; phage(gi169936021) 0.0 Click
431020565..1021050 PHAGE_Entero_2: P2 gpU-like tail protein; PP_01015; phage(gi169936020) 4e-75 Click
441021047..1021790 PHAGE_Entero_2: P2 gpD-like tail protein; PP_01016; phage(gi169936019) 6e-118 Click
451021787..1022155 PHAGE_Entero_2: P2 gpD-like tail protein; PP_01017; phage(gi169936019) 1e-58 Click
461022246..1022464 PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); PP_01018; phage(gi169936018) 2e-22 Click
471022529..1022550 attR    ATAAATTTCAGGCAACAAAAAA 0.0 Click
48complement(1022700..1024385) putative transporter [Shigella sonnei 53G] gi|383177483|ref|YP_005455488.1|; PP_01019 0.0 Click
491024655..1025032 hypothetical protein i02_0897 [Escherichia coli str. 'clone D i2'] gi|386628388|ref|YP_006148108.1|; PP_01020 9e-69 Click
50complement(1025062..1025319) PHAGE_Cronob_vB_CsaM_GAP32: glutaredoxin; PP_01021; phage(gi414087106) 5e-13 Click

Region 4, total : 69 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1304574..1305035) PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; PP_01299; phage(gi34419395) 6e-05 Click
2complement(1305045..1305698) hypothetical protein ECSF_1035 [Escherichia coli SE15] gi|387829088|ref|YP_003349025.1|; PP_01300 2e-122 Click
31305870..1307120 isocitrate dehydrogenase [Shigella flexneri 5 str. 8401] gi|110805164|ref|YP_688684.1|; PP_01301 0.0 Click
41307128..1307171 attL    ATGTGTTAAATATTGAAACGGGCGTATAACACGCCCGTTGTTTT 0.0 Click
5complement(1307234..1308376) PHAGE_Entero_HK630: integrase; PP_01302; phage(gi428782814) 4e-50 Click
6complement(1308742..1308858) hypothetical protein ECS88_1154 [Escherichia coli S88] gi|218558021|ref|YP_002390934.1|; PP_01303 2e-14 Click
7complement(1308965..1309291) PHAGE_Entero_ST104: ORF6; PP_01304; phage(gi46358654) 2e-49 Click
81309330..1309473 hypothetical protein ECS88_1156 [Escherichia coli S88] gi|218558023|ref|YP_002390936.1|; PP_01305 5e-19 Click
9complement(1309611..1309826) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_01306; phage(gi20065893) 3e-32 Click
10complement(1309903..1310016) PHAGE_Entero_HK630: hypothetical protein; PP_01307; phage(gi428782820) 3e-13 Click
11complement(1310246..1310926) PHAGE_Stx2_c_1717: exonuclease; PP_01308; phage(gi209447136) 1e-132 Click
12complement(1310923..1311708) PHAGE_Entero_HK630: Bet protein; PP_01309; phage(gi428782823) 8e-150 Click
13complement(1311714..1312010) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_01310; phage(gi116222045) 7e-51 Click
14complement(1312086..1312292) PHAGE_Entero_HK225: Kil protein; PP_01311; phage(gi428782413) 6e-30 Click
15complement(1312844..1313083) hypothetical protein ECO26_0579 [Escherichia coli O26:H11 str. 11368] gi|260853762|ref|YP_003227653.1|; PP_01312 2e-29 Click
16complement(1313293..1313562) hypothetical protein ECO26_0580 [Escherichia coli O26:H11 str. 11368] gi|260853763|ref|YP_003227654.1|; PP_01313 4e-34 Click
17complement(1313642..1314280) PHAGE_Entero_ST104: CI; PP_01314; phage(gi46358671) 2e-102 Click
181314363..1314488 hypothetical; PP_01315 0.0 Click
191314445..1314672 PHAGE_Salmon_ST160: Cro; PP_01316; phage(gi318065926) 9e-24 Click
201314703..1315242 PHAGE_Entero_mEp237: CII protein; PP_01317; phage(gi435439306) 2e-64 Click
211315239..1316258 PHAGE_Entero_4795: putative replication protein O; PP_01318; phage(gi157166011) 5e-114 Click
221316255..1316956 PHAGE_Entero_lambda: DNA replication protein; PP_01319; phage(gi9626296) 7e-128 Click
231317206..1321120 PHAGE_Equid__9: envelope glycoprotein J; PP_01320; phage(gi216905924) 5e-09 Click
24complement(1321157..1322200) PHAGE_Mycoba_Omega: gp105; PP_01321; phage(gi29566839) 4e-13 Click
251322648..1323103 PHAGE_Cronob_phiES15: hypothetical protein; PP_01322; phage(gi401817579) 4e-60 Click
261323103..1323273 PHAGE_Escher_HK639: NinE; PP_01323; phage(gi356870663) 6e-15 Click
271323266..1323556 PHAGE_Entero_mEp237: hypothetical protein; PP_01324; phage(gi435439317) 7e-50 Click
281323553..1323915 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_01325; phage(gi435439318) 1e-60 Click
291323912..1324052 PHAGE_Entero_mEp237: hypothetical protein; PP_01326; phage(gi435439319) 3e-11 Click
301324049..1324738 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_01327; phage(gi169257244) 1e-83 Click
311325048..1325365 PHAGE_Salmon_ST160: Gp13; PP_01328; phage(gi318065943) 1e-39 Click
321325352..1325828 PHAGE_Escher_HK75: lysozyme; PP_01329; phage(gi356870730) 1e-84 Click
331325825..1326277 PHAGE_Entero_HK630: cell lysis protein Rz; PP_01330; phage(gi428782852) 3e-78 Click
34complement(1326318..1326611) PHAGE_Entero_HK630: Bor protein; PP_01331; phage(gi428782854) 4e-47 Click
351326937..1327074 hypothetical; PP_01332 0.0 Click
361327179..1327418 tonB-like membrane protein encoded [Escherichia coli str. 'clone D i2'] gi|386628883|ref|YP_006148603.1|; PP_01333 4e-40 Click
371327625..1327807 hypothetical protein ECS88_1189 [Escherichia coli S88] gi|218558054|ref|YP_002390967.1|; PP_01334 1e-26 Click
38complement(1327969..1328085) hypothetical protein ECIAI39_1981 [Escherichia coli IAI39] gi|218700323|ref|YP_002407952.1|; PP_01335 2e-14 Click
391328371..1328916 PHAGE_Entero_HK630: terminase small subunit nu1; PP_01336; phage(gi428782788) 9e-97 Click
401328891..1330816 PHAGE_Entero_HK630: terminase large subunit A; PP_01337; phage(gi428782789) 0.0 Click
411330813..1331019 PHAGE_Entero_HK630: head-tail connector W; PP_01338; phage(gi428782790) 4e-32 Click
421331016..1332617 PHAGE_Entero_HK630: portal protein B; PP_01339; phage(gi428782791) 0.0 Click
431332598..1333917 PHAGE_Entero_HK630: head maturation protease C; PP_01340; phage(gi428782792) 0.0 Click
441333927..1334259 PHAGE_Entero_HK630: head decoration protein D; PP_01341; phage(gi428782794) 7e-58 Click
451334288..1335340 PHAGE_Entero_HK630: major head subunit E; PP_01342; phage(gi428782795) 0.0 Click
461335382..1335780 PHAGE_Entero_HK630: DNA packaging protein Fi; PP_01343; phage(gi428782796) 5e-67 Click
471335792..1336145 PHAGE_Entero_HK630: head-tail connector Fii; PP_01344; phage(gi428782797) 8e-62 Click
481336157..1336735 PHAGE_Entero_HK630: minor tail protein Z; PP_01345; phage(gi428782798) 4e-100 Click
491336732..1337127 PHAGE_Entero_HK630: minor tail protein U; PP_01346; phage(gi428782799) 1e-70 Click
501337135..1337875 PHAGE_Entero_HK630: major tail protein V; PP_01347; phage(gi428782800) 3e-136 Click
511337891..1338313 PHAGE_Entero_HK630: minor tail protein G; PP_01348; phage(gi428782801) 5e-71 Click
521338295..1338729 PHAGE_Entero_HK630: tail assembly protein GT; PP_01349; phage(gi428782802) 4e-81 Click
531338722..1339696 PHAGE_Entero_HK630: tail length tape measure protein H; PP_01350; phage(gi428782803) 1e-169 Click
541339654..1341282 PHAGE_Entero_HK630: tail length tape measure protein H; PP_01351; phage(gi428782803) 0.0 Click
551341279..1341608 PHAGE_Entero_HK630: minor tail protein M; PP_01352; phage(gi428782804) 3e-60 Click
561341608..1342306 PHAGE_Entero_HK630: minor tail protein L; PP_01353; phage(gi428782805) 9e-136 Click
571342455..1343054 PHAGE_Entero_HK630: tail component K; PP_01354; phage(gi428782806) 1e-116 Click
581343018..1343623 PHAGE_Entero_HK630: tail component I; PP_01355; phage(gi428782807) 3e-108 Click
591343684..1347082 PHAGE_Entero_HK630: tail fiber J; PP_01356; phage(gi428782808) 0.0 Click
601347150..1347749 PHAGE_Entero_mEp460: Lom protein; PP_01357; phage(gi428782335) 1e-99 Click
611347814..1349565 PHAGE_Escher_bV_EcoS_AKFV33: putative tail fiber protein; PP_01358; phage(gi388570497) 5e-62 Click
621349562..1349840 PHAGE_Escher_bV_EcoS_AKFV33: hypothetical protein; PP_01359; phage(gi388570496) 1e-05 Click
631349853..1350146 PHAGE_Halomo_1: hypothetical protein HAPgp19; PP_01360; phage(gi167832364) 2e-07 Click
64complement(1350238..1351095) SitD protein [Escherichia coli str. 'clone D i2'] gi|386628909|ref|YP_006148629.1|; PP_01361 1e-155 Click
65complement(1351092..1351949) Iron transporter inner membrane component [Escherichia coli NA114] gi|386618821|ref|YP_006138401.1|; PP_01362 2e-157 Click
66complement(1351946..1352773) PHAGE_Plankt_PaV_LD: ABC transporter; PP_01363; phage(gi371496158) 9e-14 Click
67complement(1352773..1353687) SitA protein [Escherichia coli str. 'clone D i2'] gi|386628912|ref|YP_006148632.1|; PP_01364 6e-172 Click
681354758..1354913 hypothetical protein i02_1431 [Escherichia coli str. 'clone D i2'] gi|386628913|ref|YP_006148633.1|; PP_01365 3e-21 Click
691354980..1355417 PHAGE_Entero_HK022: IS903 transposase; PP_01366; phage(gi9634149) 4e-72 Click
701355375..1355839 PHAGE_Entero_HK022: IS903 transposase; PP_01367; phage(gi9634149) 3e-76 Click
711356778..1356821 attR    ATGTGTTAAATATTGAAACGGGCGTATAACACGCCCGTTGTTTT 0.0 Click

Region 5, total : 47 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1668430..1668705) PHAGE_Entero_M13: helix destabilising protein; PP_01690; phage(gi17426220) 2e-11 Click
2complement(1668722..1669999) PHAGE_Entero_M13: replication protein; PP_01691; phage(gi17426218) 2e-109 Click
31670124..1670384 PHAGE_Bacill_IEBH: prophage repressor; PP_01692; phage(gi197261591) 2e-06 Click
41670432..1670893 PHAGE_Vibrio_CTX: RstR; PP_01693; phage(gi332672299) 3e-06 Click
51671162..1671320 hypothetical; PP_01694 0.0 Click
61671536..1671919 bacteriophage protein [Escherichia coli O55:H7 str. CB9615] gi|291283793|ref|YP_003500611.1|; PP_01695 5e-67 Click
71671919..1672308 PHAGE_Entero_SfV: hypothetical protein SfVp21; PP_01696; phage(gi19548989) 1e-05 Click
8complement(1673030..1673641) PHAGE_Entero_HK106: tail fiber assembly protein; PP_01697; phage(gi428783304) 9e-81 Click
9complement(1674282..1676051) PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_01698; phage(gi29143754) 3e-42 Click
10complement(1676063..1676233) PHAGE_Entero_P1: gpR; PP_01699; phage(gi46401657) 7e-26 Click
11complement(1676576..1677412) PHAGE_Entero_P1: gp16; PP_01700; phage(gi46401658) 1e-153 Click
12complement(1677412..1678845) PHAGE_Synech_RSM4: baseplate wedge subunit; PP_01701; phage(gi255929074) 4e-10 Click
13complement(1678842..1679198) PHAGE_Entero_P1: PmgA; PP_01702; phage(gi46401660) 7e-64 Click
14complement(1679198..1682620) PHAGE_Burkho_BcepF1: SLT domain-containing tail protein; PP_01703; phage(gi126011036) 1e-10 Click
15complement(1682632..1682748) hypothetical; PP_01704 0.0 Click
16complement(1682702..1683583) PHAGE_Entero_P1: PmgB; PP_01705; phage(gi46401662) 2e-174 Click
17complement(1683598..1684209) PHAGE_Entero_P1: Tub; PP_01706; phage(gi46401663) 3e-111 Click
18complement(1684220..1684786) PHAGE_Entero_P1: PmgC; PP_01707; phage(gi46401664) 5e-101 Click
19complement(1684941..1685975) hypothetical protein NRG857_21005 [Escherichia coli O83:H1 str. NRG 857C] gi|387619521|ref|YP_006122543.1|; PP_01708 3e-16 Click
20complement(1686050..1686526) hypothetical; PP_01709 0.0 Click
21complement(1686549..1686899) hypothetical protein P9303_02721 [Prochlorococcus marinus str. MIT 9303] gi|124021985|ref|YP_001016292.1|; PP_01710 2e-16 Click
221687398..1687619 PHAGE_Entero_P1: Icd; PP_01711; phage(gi46401668) 4e-34 Click
231687616..1689019 PHAGE_Entero_P1: Ant1; PP_01712; phage(gi46401669) 2e-93 Click
241689184..1689984 PHAGE_Entero_P1: KilA; PP_01713; phage(gi46401671) 2e-150 Click
251690014..1690592 PHAGE_Entero_P1: RepL; PP_01714; phage(gi46401672) 2e-95 Click
261690993..1691154 hypothetical protein [Escherichia coli O55:H7 str. RM12579] gi|387504769|ref|YP_006157108.1|; PP_01715 1e-22 Click
27complement(1691337..1691933) PHAGE_Entero_P1: PmgF; PP_01716; phage(gi46401675) 6e-07 Click
28complement(1692105..1692614) PHAGE_Entero_P1: BplB; PP_01717; phage(gi46401676) 2e-93 Click
29complement(1692626..1692865) PHAGE_Entero_P1: PmgG; PP_01719; phage(gi46401677) 4e-38 Click
301692912..1693130 hypothetical; PP_01718 0.0 Click
31complement(1693243..1694058) PHAGE_Entero_P1: gp21; PP_01720; phage(gi46401678) 2e-144 Click
32complement(1694068..1695657) PHAGE_Entero_P1: gp22; PP_01721; phage(gi46401679) 0.0 Click
33complement(1695718..1697424) PHAGE_Entero_P1: gp23; PP_01722; phage(gi46401680) 0.0 Click
34complement(1697650..1698651) PHAGE_Entero_P1: ParB; PP_01723; phage(gi46401681) 0.0 Click
35complement(1698668..1699864) PHAGE_Entero_P1: ParA; PP_01724; phage(gi46401682) 0.0 Click
36complement(1700422..1701282) PHAGE_Entero_P1: RepA; PP_01725; phage(gi46401683) 6e-160 Click
37complement(1701600..1701992) PHAGE_Entero_P1: UpfA; PP_01726; phage(gi46401684) 4e-69 Click
38complement(1702004..1702135) PHAGE_Entero_P1: Mlp; PP_01727; phage(gi46401685) 2e-19 Click
39complement(1702170..1702592) PHAGE_Entero_P1: PpfA; PP_01728; phage(gi46401686) 6e-73 Click
40complement(1702632..1703420) PHAGE_Entero_P1: UpfB; PP_01729; phage(gi46401687) 4e-133 Click
41complement(1703429..1703608) PHAGE_Entero_P1: UpfC; PP_01730; phage(gi46401688) 2e-29 Click
421704160..1705065 PHAGE_Entero_P1: HrdC; PP_01731; phage(gi46401690) 1e-167 Click
431705062..1707650 PHAGE_Entero_P1: Dmt; PP_01732; phage(gi46401691) 0.0 Click
441708064..1708204 hypothetical; PP_01733 0.0 Click
451708326..1708401 tRNA 0.0 Click
461708404..1708479 tRNA 0.0 Click
471708901..1708987 tRNA 0.0 Click
481709341..1709580 transposase [Klebsiella pneumoniae NTUH-K2044] gi|168998730|ref|YP_001687998.1|; PP_01734 5e-08 Click
49complement(1709577..1709900) PHAGE_Entero_HK106: side tail fiber protein; PP_01735; phage(gi428783303) 1e-31 Click
50complement(1709941..1710444) PHAGE_Entero_HK97: tail fiber; PP_01736; phage(gi9634179) 2e-41 Click

Region 6, total : 36 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11716071..1716577 PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; PP_01745; phage(gi17546156) 8e-20 Click
21716610..1717416 PROPHAGE_Escher_MG1655: IS150 transposase B; PP_01746; phage(gi16131429) 2e-89 Click
31717575..1717778 transposase [Shigella boydii Sb227] gi|82524685|ref|YP_406246.1|; PP_01747 2e-17 Click
41717778..1718113 PHAGE_Stx2_c_1717: truncated transposase; PP_01748; phage(gi209447151) 6e-15 Click
5complement(1718194..1718373) hypothetical protein SFxv_4851 [Shigella flexneri 2002017] gi|384545988|ref|YP_005711900.1|; PP_01749 6e-22 Click
61718480..1718668 hypothetical protein ECO26_5473 [Escherichia coli O26:H11 str. 11368] gi|260858450|ref|YP_003232341.1|; PP_01750 5e-19 Click
71718688..1718927 hypothetical protein ECO26_5473 [Escherichia coli O26:H11 str. 11368] gi|260858450|ref|YP_003232341.1|; PP_01751 1e-32 Click
81718949..1720259 PHAGE_Stx2_c_1717: transposase; PP_01752; phage(gi209447153) 3e-155 Click
9complement(1720458..1720886) PROPHAGE_Shewan_MR-1: ISSod3, transposase; PP_01753; phage(gi24375070) 1e-13 Click
10complement(1720977..1721156) PROPHAGE_Xantho_33913: IS1481 transposase; PP_01754; phage(gi21229606) 3e-05 Click
111721433..1721744 PHAGE_Salmon_ST64B: lysis protein; PP_01755; phage(gi23505497) 4e-31 Click
121722185..1722394 hypothetical protein ECO26_1493 [Escherichia coli O26:H11 str. 11368] gi|260854643|ref|YP_003228534.1|; PP_01756 1e-19 Click
131722641..1722805 PHAGE_Entero_mEp460: hypothetical protein; PP_01757; phage(gi428782375) 4e-08 Click
141723023..1723148 PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; PP_01758; phage(gi169257236) 9e-08 Click
151723120..1723446 PHAGE_Gifsy_1: DNA packaging protein; small terminase subunit; Lambda Nu1 homolog; PP_01759; phage(gi169257236) 8e-30 Click
16complement(1723712..1724905) PROPHAGE_Escher_CFT073: transposase; PP_01760; phage(gi26248352) 0.0 Click
171725219..1725419 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; PP_01761; phage(gi169257235) 2e-19 Click
181725455..1725823 PHAGE_Entero_HK630: tail fiber J; PP_01762; phage(gi428782808) 2e-50 Click
191725792..1725932 PHAGE_Entero_mEp460: host specificity protein; PP_01763; phage(gi428782334) 8e-09 Click
201726017..1726190 PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; PP_01764; phage(gi209447197) 8e-15 Click
211726663..1727643 PHAGE_Vibrio_VHML: ORF37; PP_01765; phage(gi27311204) 2e-09 Click
221728060..1728452 PHAGE_Pseudo_Lu11: putative tail assembly protein; PP_01766; phage(gi388684690) 2e-11 Click
231729136..1729270 hypothetical; PP_01767 0.0 Click
24complement(1729436..1730404) hypothetical; PP_01768 0.0 Click
251730841..1731116 PHAGE_Stx2_c_1717: putative transposase; PP_01769; phage(gi209447180) 1e-44 Click
261731275..1731427 PHAGE_Stx2_c_1717: transposase; PP_01770; phage(gi209447179) 2e-16 Click
271731441..1731575 PHAGE_Entero_4795: putative transposase OrfB protein of IS629; PP_01771; phage(gi157166067) 5e-16 Click
281731708..1731842 IS1353 transposase family protein [Escherichia coli str. 'clone D i2'] gi|386630747|ref|YP_006150467.1|; PP_01772 7e-13 Click
29complement(1732324..1733262) putative targeted effector protein [Yersinia enterocolitica subsp. enterocolitica 8081] gi|122815854|ref|YP_001004120.1|; PP_01773 3e-133 Click
301733293..1733433 hypothetical; PP_01774 0.0 Click
31complement(1733913..1734038) hypothetical; PP_01775 0.0 Click
321734182..1734328 PROPHAGE_Salmon_LT2: transposase; PP_01776; phage(gi16766077) 8e-07 Click
331734325..1734450 PROPHAGE_Salmon_LT2: transposase; PP_01777; phage(gi16766077) 5e-08 Click
34complement(1734453..1734653) hypothetical protein SPUL_4482 [Salmonella enterica subsp. enterica serovar Gallinarum/pullorum str. RKS5078] gi|378958031|ref|YP_005215518.1|; PP_01778 3e-09 Click
351734661..1735014 PROPHAGE_Xantho_33913: ISxcC1 transposase; PP_01779; phage(gi21230085) 1e-27 Click
361735007..1735189 PROPHAGE_Xantho_33913: ISxcc1 transposase; PP_01780; phage(gi21232565) 2e-06 Click

Region 7, total : 37 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11751442..1751453 attL    TATATGCTAGGA 0.0 Click
21766121..1766276 PHAGE_Stx2_c_1717: transposase; PP_01817; phage(gi209447153) 2e-06 Click
31766453..1767463 PROPHAGE_Escher_CFT073: transposase/IS protein; PP_01818; phage(gi26248359) 8e-18 Click
41767447..1767764 PROPHAGE_Escher_CFT073: transposase/IS protein; PP_01819; phage(gi26248359) 4e-24 Click
51767881..1768063 PHAGE_Stx2_c_1717: transposase; PP_01820; phage(gi209447153) 2e-07 Click
6complement(1768092..1768205) hypothetical protein UMNK88_pK8832 [Escherichia coli UMNK88] gi|386612025|ref|YP_006131693.1|; PP_01821 3e-05 Click
71768360..1768740 hypothetical protein NT01EI_2355 [Edwardsiella ictaluri 93-146] gi|417359148|ref|YP_002933761.2|; PP_01822 2e-19 Click
81768758..1769126 hypothetical protein NT01EI_2355 [Edwardsiella ictaluri 93-146] gi|417359148|ref|YP_002933761.2|; PP_01823 3e-30 Click
9complement(1769197..1769442) PROPHAGE_Shewan_MR-1: ISSod4, transposase; PP_01824; phage(gi24373869) 2e-25 Click
101769726..1770154 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; PP_01825; phage(gi157166066) 3e-39 Click
111770172..1770729 PROPHAGE_Escher_Sakai: putative transposase; PP_01826; phage(gi15834498) 4e-70 Click
121771010..1771126 PROPHAGE_Salmon_Ty2: transposase; PP_01827; phage(gi29143766) 7e-16 Click
131771573..1771698 hypothetical; PP_01828 0.0 Click
14complement(1771797..1772018) PROPHAGE_Escher_MG1655: IS3 transposase A; PP_01829; phage(gi226524700) 1e-25 Click
15complement(1772216..1772419) hypothetical; PP_01830 0.0 Click
161773284..1774471 PHAGE_Lactob_AQ113: phosphoadenosine phosphosulfate reductase; PP_01831; phage(gi446730264) 4e-53 Click
171774456..1775094 PHAGE_Lactob_AQ113: co-activator of prophage gene expression; PP_01832; phage(gi446730265) 4e-32 Click
18complement(1775683..1777119) PHAGE_Campyl_CP21: radical SAM domain-containing protein; PP_01833; phage(gi422935302) 3e-06 Click
19complement(1777395..1778036) PHAGE_Staphy_StB27: integrase; PP_01834; phage(gi431809677) 4e-07 Click
201778203..1778505 Transposase for transposon Tn2501 [Erwinia tasmaniensis Et1/99] gi|188535878|ref|YP_001905938.1|; PP_01835 1e-42 Click
211778515..1779243 Transposase for transposon Tn2501 [Erwinia tasmaniensis Et1/99] gi|188535878|ref|YP_001905938.1|; PP_01836 2e-104 Click
221779213..1779500 Transposase for transposon Tn2501 [Erwinia tasmaniensis Et1/99] gi|188535878|ref|YP_001905938.1|; PP_01837 5e-31 Click
231779549..1779815 PROPHAGE_Ralsto_GMI1000: isrso12-transposase orfa protein; PP_01838; phage(gi17546157) 8e-33 Click
241780180..1780416 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; PP_01839; phage(gi17546158) 1e-19 Click
251780430..1780570 PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; PP_01840; phage(gi17546158) 1e-17 Click
261780703..1781482 PROPHAGE_Xantho_33913: Tn5041 transposase; PP_01841; phage(gi21231545) 4e-19 Click
271781840..1782034 PHAGE_Entero_Sf6: putative transposase OrfB; PP_01842; phage(gi41057343) 7e-11 Click
281782172..1782285 hypothetical; PP_01843 0.0 Click
29complement(1782588..1783289) PROPHAGE_Shewan_MR-1: ISSod3, transposase; PP_01844; phage(gi24375070) 1e-16 Click
30complement(1783295..1783666) PROPHAGE_Shewan_MR-1: ISSod3, transposase; PP_01845; phage(gi24375070) 3e-10 Click
31complement(1784207..1784368) hypothetical; PP_01846 0.0 Click
32complement(1784460..1784585) hypothetical; PP_01847 0.0 Click
331784719..1784847 hypothetical; PP_01848 0.0 Click
341784892..1785806 PHAGE_Parame_FR483: hypothetical protein FR483_N535L; PP_01849; phage(gi155370633) 2e-05 Click
351785772..1786296 putative autotransporter protein [Dechlorosoma suillum PS] gi|372488741|ref|YP_005028306.1|; PP_01850 3e-17 Click
361786425..1787060 AidA-I adhesin-like protein [Shigella sonnei 53G] gi|383176908|ref|YP_005454913.1|; PP_01851 7e-27 Click
37complement(1787030..1787566) PHAGE_Entero_Sf6: putative transposase OrfB; PP_01852; phage(gi41057343) 1e-57 Click
38complement(1787579..1787890) PROPHAGE_Xantho_33913: ISxac3 transposase; PP_01853; phage(gi21231087) 1e-06 Click
391788939..1788950 attR    TATATGCTAGGA 0.0 Click

Region 8, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11803719..1804324 PHAGE_Staphy_phiPVL108: putative transposase; PP_01879; phage(gi119443708) 4e-10 Click
2complement(1804474..1804698) transposase [Escherichia coli O127:H6 str. E2348/69] gi|215488278|ref|YP_002330709.1|; PP_01880 2e-36 Click
31804726..1804893 hypothetical; PP_01881 0.0 Click
4complement(1805165..1805425) hypothetical protein EC55989_4862 [Escherichia coli 55989] gi|218698052|ref|YP_002405719.1|; PP_01882 2e-43 Click
5complement(1805544..1805660) hypothetical; PP_01883 0.0 Click
61805789..1806253 hypothetical; PP_01884 0.0 Click
71806593..1806718 hypothetical; PP_01885 0.0 Click
8complement(1806854..1807153) PROPHAGE_Escher_MG1655: IS3 transposase A; PP_01886; phage(gi226524700) 4e-49 Click
91807410..1807550 PROPHAGE_Escher_MG1655: IS186 transposase; PP_01887; phage(gi90111427) 3e-18 Click
10complement(1807634..1807780) hypothetical; PP_01888 0.0 Click
111807843..1809048 PHAGE_Entero_N15: plasmid partition protein SopA; PP_01889; phage(gi9630492) 6e-16 Click
121809045..1810022 PHAGE_Entero_N15: ParB; PP_01890; phage(gi9630491) 9e-11 Click
131810075..1811142 PROPHAGE_Escher_CFT073: transposase; PP_01891; phage(gi26246249) 2e-151 Click
141811147..1811326 PROPHAGE_Escher_CFT073: transposase; PP_01892; phage(gi26246249) 7e-26 Click
15complement(1811442..1811558) PROPHAGE_Salmon_Ty2: transposase; PP_01893; phage(gi29143766) 7e-16 Click
16complement(1811612..1811779) PROPHAGE_Salmon_Ty2: transposase; PP_01894; phage(gi29143766) 4e-23 Click
171812541..1812789 hypothetical protein ECH74115_B0048 [Escherichia coli O157:H7 str. EC4115] gi|209395534|ref|YP_002268429.1|; PP_01895 4e-22 Click
181812886..1813215 hypothetical protein SFxv_5043 [Shigella flexneri 2002017] gi|384546180|ref|YP_005712092.1|; PP_01896 8e-48 Click
191813263..1814801 PROPHAGE_Escher_MG1655: IS150 transposase B; PP_01897; phage(gi16131429) 2e-53 Click
201814846..1815655 hypothetical protein Rahaq_3532 [Rahnella sp. Y9602] gi|322834224|ref|YP_004214251.1|; PP_01898 1e-31 Click
211815697..1816179 PHAGE_Cyprin_2: membrane protein ORF64; PP_01899; phage(gi422933831) 2e-05 Click

Region 9, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11840148..1840582 PHAGE_Pseudo_YuA: hypothetical protein; PP_01931; phage(gi162135127) 2e-13 Click
21840757..1840885 hypothetical; PP_01932 0.0 Click
3complement(1840882..1841013) hypothetical; PP_01933 0.0 Click
4complement(1841082..1841198) hypothetical; PP_01934 0.0 Click
51841277..1841447 hypothetical; PP_01935 0.0 Click
61841466..1841693 hypothetical; PP_01936 0.0 Click
71841784..1842014 hypothetical protein ECH74115_B0061 [Escherichia coli O157:H7 str. EC4115] gi|209395629|ref|YP_002268442.1|; PP_01937 2e-26 Click
81842066..1843430 hypothetical protein UTI89_P088 [Escherichia coli UTI89] gi|91206333|ref|YP_538687.1|; PP_01938 0.0 Click
91843453..1843998 PHAGE_Escher_D108: tail fiber protein; PP_01939; phage(gi281199694) 3e-89 Click
101844039..1845361 PHAGE_Entero_Mu: tail fiber; PP_01940; phage(gi9633540) 8e-62 Click
111845363..1845890 PHAGE_Escher_D108: probable tail fiber assembly protein; PP_01941; phage(gi281199695) 2e-74 Click
12complement(1845922..1846455) PHAGE_Entero_Mu: tail fiber assembly protein; PP_01942; phage(gi19584573) 1e-72 Click
13complement(1846459..1847703) PHAGE_Escher_D108: tail fiber protein; PP_01943; phage(gi281199694) 3e-152 Click
14complement(1847685..1847972) hypothetical protein i02_2691 [Escherichia coli str. 'clone D i2'] gi|386630146|ref|YP_006149866.1|; PP_01944 1e-24 Click
15complement(1848032..1848205) outer membrane autotransporter [Escherichia coli str. 'clone D i2'] gi|386630147|ref|YP_006149867.1|; PP_01945 2e-25 Click
16complement(1848456..1848614) outer membrane autotransporter [Escherichia coli str. 'clone D i2'] gi|386630147|ref|YP_006149867.1|; PP_01946 3e-18 Click
17complement(1848565..1849362) PHAGE_Human__1: large tegument protein; PP_01947; phage(gi155041490) 4e-08 Click
18complement(1849427..1849795) PHAGE_Burkho_BcepB1A: gp33 TerL; PP_01948; phage(gi48697520) 1e-27 Click
19complement(1849798..1850349) PHAGE_Cronob_phiES15: terminase small subunit; PP_01949; phage(gi401817591) 2e-57 Click
201850303..1850923 hypothetical protein VVMO6_01350 [Vibrio vulnificus MO6-24/O] gi|320156196|ref|YP_004188575.1|; PP_01950 3e-29 Click
21complement(1851049..1851234) hypothetical protein E2348C_2515 [Escherichia coli O127:H6 str. E2348/69] gi|215487588|ref|YP_002330019.1|; PP_01951 4e-27 Click
22complement(1851215..1851415) PHAGE_Entero_SfV: putative Rz1 lytic protein; PP_01952; phage(gi19549039) 6e-17 Click
23complement(1851378..1851770) PHAGE_Entero_SfV: putative Rz lytic protein; PP_01953; phage(gi19549038) 2e-54 Click
24complement(1851754..1852230) PHAGE_Entero_SfV: lysin; PP_01954; phage(gi19549037) 1e-85 Click
25complement(1852234..1852575) PHAGE_Entero_SfV: holin; PP_01955; phage(gi19549036) 4e-55 Click
261852793..1852954 hypothetical protein STY2046 [Salmonella enterica subsp. enterica serovar Typhi str. CT18] gi|16760789|ref|NP_456406.1|; PP_01956 5e-23 Click
27complement(1852923..1853492) hypothetical protein STY2047 [Salmonella enterica subsp. enterica serovar Typhi str. CT18] gi|16760790|ref|NP_456407.1|; PP_01957 4e-104 Click
281853621..1853737 hypothetical; PP_01958 0.0 Click
29complement(1853714..1854256) bacteriophage protein [Shigella flexneri 2a str. 301] gi|24112742|ref|NP_707252.1|; PP_01959 2e-92 Click
30complement(1854253..1854543) PHAGE_Erwini_phiEt88: hypothetical protein; PP_01960; phage(gi327198620) 1e-33 Click
31complement(1854543..1855142) PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; PP_01961; phage(gi169257286) 5e-54 Click
32complement(1855214..1855351) bacteriophage cohesive ends [Salmonella enterica subsp. enterica serovar Typhi str. CT18] gi|16760796|ref|NP_456413.1|; PP_01962 2e-18 Click
33complement(1856069..1856197) hypothetical protein ECB_01533 [Escherichia coli B str. REL606] gi|254161627|ref|YP_003044735.1|; PP_01963 3e-06 Click
341856293..1856430 hypothetical; PP_01964 0.0 Click
35complement(1856399..1856566) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; PP_01965; phage(gi20065868) 6e-17 Click
36complement(1856794..1857159) PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp44; PP_01966; phage(gi116222036) 2e-57 Click
37complement(1857172..1857447) hypothetical; PP_01967 0.0 Click
38complement(1857589..1857825) hypothetical; PP_01968 0.0 Click
39complement(1857826..1858032) hypothetical; PP_01969 0.0 Click
40complement(1858048..1858308) hypothetical; PP_01970 0.0 Click
41complement(1858321..1858668) PHAGE_Entero_M13: helix destabilising protein; PP_01971; phage(gi17426220) 5e-06 Click
42complement(1858685..1859809) PHAGE_Entero_If1: hypothetical protein If1p10; PP_01972; phage(gi9630757) 2e-94 Click

Region 10, total : 6 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2142734..2143390) PHAGE_Entero_HK446: NinI protein; PP_02269; phage(gi428782246) 8e-54 Click
2complement(2143855..2144409) PHAGE_Entero_2: DNA-invertase; PP_02270; phage(gi169936026) 1e-89 Click
3complement(2144832..2145371) PHAGE_Entero_HK022: IS903 transposase; PP_02271; phage(gi9634149) 2e-71 Click
42145574..2149056 PHAGE_Synech_RSM4: putative short tail fibre; PP_02272; phage(gi255929133) 3e-15 Click
5complement(2149096..2149233) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF79; PP_02273; phage(gi157166064) 4e-09 Click
62149424..2149630 PHAGE_Stx2_c_1717: transposase; PP_02274; phage(gi209447153) 2e-19 Click

Region 11, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12183351..2183362 attL    TCCGGAGGCTTT 0.0 Click
2complement(2191050..2191559) PHAGE_Escher_phAPEC8: hypothetical protein; PP_02344; phage(gi448260314) 4e-09 Click
3complement(2191657..2192076) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; PP_02345; phage(gi20065868) 1e-08 Click
4complement(2192063..2192557) PHAGE_Pectob_ZF40: putative methylase; PP_02346; phage(gi422936660) 1e-67 Click
5complement(2192554..2192976) phage protein [Escherichia coli 55989] gi|218694461|ref|YP_002402128.1|; PP_02347 2e-69 Click
6complement(2192991..2193752) hypothetical protein ECO26_1929 [Escherichia coli O26:H11 str. 11368] gi|260855058|ref|YP_003228949.1|; PP_02348 2e-130 Click
7complement(2193775..2194521) PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_02349; phage(gi169257280) 4e-76 Click
8complement(2194528..2195316) PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; PP_02350; phage(gi169257279) 3e-22 Click
9complement(2195394..2195816) PHAGE_Entero_mEp237: CII protein; PP_02351; phage(gi435439306) 6e-08 Click
102196404..2196571 PHAGE_Salmon_SPN3UB: putative CI; PP_02352; phage(gi423262424) 9e-08 Click
112196878..2197030 PHAGE_Salico_CGphi29: hypothetical protein; PP_02353; phage(gi472340166) 7e-10 Click
122197442..2197663 PHAGE_Escher_P13374: host killing protein; PP_02354; phage(gi410491620) 1e-05 Click
132197663..2197833 PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; PP_02355; phage(gi169257274) 3e-06 Click
142197908..2198183 hypothetical protein SSON53_10475 [Shigella sonnei 53G] gi|383178630|ref|YP_005456635.1|; PP_02356 2e-43 Click
152198284..2200302 PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; PP_02357; phage(gi169257272) 1e-42 Click
162200280..2200576 PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_02358; phage(gi116222045) 3e-42 Click
172200582..2201367 PHAGE_Entero_HK630: Bet protein; PP_02359; phage(gi428782823) 8e-145 Click
182201364..2202044 PHAGE_Stx2_c_1717: exonuclease; PP_02360; phage(gi209447136) 4e-130 Click
192202264..2202428 hypothetical protein STY2075 [Salmonella enterica subsp. enterica serovar Typhi str. CT18] gi|16760820|ref|NP_456437.1|; PP_02361 6e-08 Click
202202700..2202711 attR    TCCGGAGGCTTT 0.0 Click
212202807..2203883 PHAGE_Entero_mEp235: integrase; PP_02362; phage(gi428781836) 3e-70 Click
22complement(2204105..2204257) hypothetical protein ECSF_1696 [Escherichia coli SE15] gi|387829749|ref|YP_003349686.1|; PP_02363 7e-21 Click
23complement(2204275..2204616) PHAGE_Entero_PsP3: gp28; PP_02364; phage(gi41057381) 8e-09 Click
24complement(2204629..2205501) hypothetical protein ECS88_1894 [Escherichia coli S88] gi|218558704|ref|YP_002391617.1|; PP_02365 1e-165 Click
25complement(2205505..2205879) hypothetical protein SFV_1843 [Shigella flexneri 5 str. 8401] gi|110805786|ref|YP_689306.1|; PP_02366 7e-66 Click
262206018..2206248 PHAGE_Pectob_ZF40: putative DNA polymerase; PP_02367; phage(gi422936677) 6e-17 Click
272206350..2207006 hypothetical protein ECSF_1701 [Escherichia coli SE15] gi|387829754|ref|YP_003349691.1|; PP_02368 1e-124 Click
282207030..2207692 PHAGE_Cronob_vB_CsaM_GAP32: putative DNA polymerase III epsilon subunit; PP_02369; phage(gi414087193) 5e-17 Click

Region 12, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12790400..2790411 attL    GCGAGCAAAAAA 0.0 Click
22791516..2791539 attL    TTCGATTCCTGCAGGGGACACCAT 0.0 Click
32791652..2792989 PHAGE_Entero_P4: integrase; PP_02920; phage(gi9627511) 1e-135 Click
42792982..2793737 hypothetical protein S70_17365 [Providencia stuartii MRSN 2154] gi|386744795|ref|YP_006217974.1|; PP_02921 3e-13 Click
52794134..2794325 hypothetical; PP_02922 0.0 Click
62794407..2794601 hypothetical; PP_02923 0.0 Click
72795053..2796105 hypothetical protein G2583_2890 [Escherichia coli O55:H7 str. CB9615] gi|291283593|ref|YP_003500411.1|; PP_02924 4e-130 Click
8complement(2796812..2798080) hypothetical protein Nit79A3_2640 [Nitrosomonas sp. Is79A3] gi|339484020|ref|YP_004695806.1|; PP_02925 1e-78 Click
9complement(2798086..2799234) hypothetical protein Nit79A3_2640 [Nitrosomonas sp. Is79A3] gi|339484020|ref|YP_004695806.1|; PP_02926 6e-80 Click
10complement(2799330..2799470) PHAGE_Entero_HK022: IS903 transposase; PP_02927; phage(gi9634149) 5e-19 Click
11complement(2799536..2799820) PHAGE_Entero_HK022: IS903 transposase; PP_02928; phage(gi9634149) 6e-12 Click
12complement(2799777..2800205) PHAGE_Entero_HK022: IS903 transposase; PP_02929; phage(gi9634149) 4e-70 Click
13complement(2800788..2800964) hypothetical protein G2583_2892 [Escherichia coli O55:H7 str. CB9615] gi|291283595|ref|YP_003500413.1|; PP_02930 9e-18 Click
142801423..2801893 PHAGE_Sodali_phiSG1: resolvase; PP_02931; phage(gi89886020) 8e-08 Click
152802027..2802050 attR    TTCGATTCCTGCAGGGGACACCAT 0.0 Click
16complement(2802487..2803005) putative exported protein [Escherichia coli 042] gi|387608036|ref|YP_006096892.1|; PP_02932 3e-88 Click
17complement(2803065..2803238) outer membrane autotransporter [Escherichia coli str. 'clone D i2'] gi|386630147|ref|YP_006149867.1|; PP_02933 2e-25 Click
182803307..2804050 PHAGE_Entero_mEp213: tail fiber; PP_02934; phage(gi428782611) 6e-80 Click
192804047..2804643 PHAGE_Entero_HK106: tail fiber assembly protein; PP_02935; phage(gi428783304) 1e-62 Click
20complement(2804615..2805055) PHAGE_Entero_mEp213: tail fiber assembly protein; PP_02936; phage(gi428782612) 8e-28 Click
21complement(2805058..2805729) PHAGE_Erwini_ENT90: phage tail collar domain protein; PP_02937; phage(gi431810938) 3e-12 Click
22complement(2805778..2810652) PHAGE_Synech_Syn19: YadA domain-containing structural protein; PP_02938; phage(gi326783569) 2e-21 Click
23complement(2810797..2811417) hypothetical protein i02_2694 [Escherichia coli str. 'clone D i2'] gi|386630148|ref|YP_006149868.1|; PP_02939 4e-116 Click
24complement(2811736..2812365) PHAGE_Strept_MM1: integrase; PP_02940; phage(gi15088744) 3e-09 Click
252813114..2813683 PHAGE_Achole_L2: integrase; PP_02941; phage(gi9626516) 3e-10 Click
262821926..2821937 attR    GCGAGCAAAAAA 0.0 Click

Region 13, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12929289..2929301 attL    ACTGGCAGCAGAA 0.0 Click
2complement(2941311..2941463) PHAGE_Escher_TL_2011b: hypothetical protein; PP_03061; phage(gi418487684) 1e-19 Click
32941481..2941672 PHAGE_Escher_TL_2011b: hypothetical protein; PP_03062; phage(gi418487683) 1e-29 Click
42941977..2942492 PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; PP_03063; phage(gi418487638) 3e-93 Click
52942508..2943047 PHAGE_Escher_TL_2011b: hypothetical protein; PP_03064; phage(gi418487682) 3e-95 Click
6complement(2943265..2943732) PHAGE_Entero_phiV10: putative lysis accessory protein; PP_03065; phage(gi89152449) 6e-74 Click
7complement(2943729..2944358) PHAGE_Entero_phiV10: putative endolysin; PP_03066; phage(gi89152448) 5e-114 Click
82944482..2944616 hypothetical; PP_03067 0.0 Click
9complement(2944899..2945039) PHAGE_Entero_HK022: IS903 transposase; PP_03068; phage(gi9634149) 5e-19 Click
10complement(2945105..2945617) PHAGE_Entero_HK022: IS903 transposase; PP_03069; phage(gi9634149) 3e-50 Click
11complement(2945684..2946031) PHAGE_Entero_phiV10: putative tail fiber; PP_03070; phage(gi89152445) 5e-48 Click
122946422..2946586 PHAGE_Entero_phiV10: hypothetical protein PhiV10p24; PP_03071; phage(gi89152444) 7e-24 Click
132946902..2947597 PHAGE_Entero_phiV10: putative anti-immunity protein; PP_03072; phage(gi89152443) 2e-98 Click
14complement(2947659..2947781) hypothetical; PP_03073 0.0 Click
15complement(2948082..2950556) PHAGE_Entero_phiV10: hypothetical protein PhiV10p20; PP_03074; phage(gi89152441) 0.0 Click
16complement(2950562..2952364) PHAGE_Entero_phiV10: hypothetical protein PhiV10p19; PP_03075; phage(gi89152440) 0.0 Click
17complement(2952361..2954874) PHAGE_Entero_phiV10: hypothetical structural protein; PP_03076; phage(gi89152439) 0.0 Click
18complement(2954887..2955369) PHAGE_Entero_phiV10: hypothetical protein PhiV10p17; PP_03077; phage(gi89152438) 2e-54 Click
192955329..2955460 hypothetical protein ECOK1_2818 [Escherichia coli IHE3034] gi|386600449|ref|YP_006101955.1|; PP_03078 6e-19 Click
20complement(2955426..2955890) PHAGE_Entero_phiV10: hypothetical protein PhiV10p16; PP_03079; phage(gi89152437) 7e-86 Click
21complement(2955890..2958361) PHAGE_Entero_phiV10: hypothetical protein PhiV10p15; PP_03080; phage(gi89152436) 0.0 Click
22complement(2958361..2958966) PHAGE_Entero_phiV10: hypothetical protein PhiV10p14; PP_03081; phage(gi89152435) 8e-114 Click
23complement(2958966..2959289) PHAGE_Entero_phiV10: hypothetical protein PhiV10p13; PP_03082; phage(gi89152434) 1e-55 Click
24complement(2959340..2959675) PHAGE_Entero_phiV10: hypothetical protein PhiV10p12; PP_03083; phage(gi89152433) 2e-58 Click
25complement(2959686..2960123) PHAGE_Entero_phiV10: hypothetical protein PhiV10p11; PP_03084; phage(gi89152432) 1e-74 Click
26complement(2960175..2961161) PHAGE_Entero_phiV10: hypothetical protein PhiV10p10; PP_03085; phage(gi89152431) 0.0 Click
27complement(2961176..2961883) PHAGE_Entero_phiV10: hypothetical protein PhiV10p09; PP_03086; phage(gi89152430) 1e-94 Click
28complement(2961886..2962182) PHAGE_Entero_phiV10: hypothetical protein PhiV10p08; PP_03087; phage(gi89152429) 3e-50 Click
29complement(2962179..2963858) PHAGE_Entero_phiV10: putative head-to-tail-joining protein; PP_03088; phage(gi89152428) 0.0 Click
30complement(2963873..2964079) PHAGE_Entero_phiV10: hypothetical protein PhiV10p06; PP_03089; phage(gi89152427) 3e-32 Click
312964507..2964583 tRNA 0.0 Click
32complement(2964513..2964764) PHAGE_Entero_phiV10: hypothetical protein PhiV10p04; PP_03090; phage(gi155370094) 8e-44 Click
332964782..2965138 PHAGE_Entero_phiV10: hypothetical protein PhiV10p03; PP_03091; phage(gi89152424) 3e-42 Click
34complement(2965229..2966704) PHAGE_Entero_phiV10: putative terminase large subunit; PP_03092; phage(gi89152423) 0.0 Click
35complement(2966701..2967375) PHAGE_Entero_phiV10: putative terminase small subunit; PP_03093; phage(gi155370097) 2e-124 Click
36complement(2967372..2967584) PHAGE_Entero_RB69: UvsY.-1 conserved hypothetical protein; PP_03094; phage(gi32453680) 3e-15 Click
37complement(2967602..2967940) PHAGE_Entero_phiV10: hypothetical protein PhiV10p55; PP_03095; phage(gi89152469) 4e-61 Click
38complement(2967933..2968106) PHAGE_Entero_phiV10: hypothetical protein PhiV10p54; PP_03096; phage(gi89152468) 9e-24 Click
392968187..2969686 hypothetical protein c5144 [Escherichia coli CFT073] gi|26250952|ref|NP_756992.1|; PP_03097 0.0 Click
402969683..2970429 PROPHAGE_Escher_CFT073: transposase/IS protein; PP_03098; phage(gi26248359) 1e-06 Click
41complement(2970688..2971473) PHAGE_Entero_phiV10: putative replication protein p; PP_03099; phage(gi155370096) 2e-152 Click
42complement(2971470..2972285) PHAGE_Entero_phiV10: putative primosomal protein; PP_03100; phage(gi89152459) 4e-152 Click
43complement(2972301..2972501) PHAGE_Entero_phiV10: hypothetical protein PhiV10p42; PP_03101; phage(gi89152475) 6e-34 Click
44complement(2972651..2972881) PHAGE_Entero_phiV10: hypothetical protein PhiV10p41; PP_03102; phage(gi89152458) 4e-41 Click
452973036..2973620 PHAGE_Entero_phiV10: putative transcriptional repressor; PP_03103; phage(gi89152457) 3e-106 Click
462973774..2973926 PHAGE_Entero_phiV10: hypothetical protein PhiV10p39; PP_03104; phage(gi89152456) 1e-26 Click
472973929..2974228 PHAGE_Entero_phiV10: hypothetical protein PhiV10p38; PP_03105; phage(gi89152455) 2e-48 Click
482974225..2975046 PHAGE_Entero_phiV10: putative recET; PP_03106; phage(gi89152454) 3e-157 Click
492975043..2975924 PHAGE_Entero_phiV10: putative recET; PP_03107; phage(gi89152454) 4e-124 Click
502975974..2976222 PHAGE_Entero_phiV10: putative transcriptional regulator; PP_03108; phage(gi89152453) 3e-44 Click
512976380..2976631 PHAGE_Entero_phiV10: putative transcriptional activator; PP_03109; phage(gi155370095) 6e-42 Click
522976660..2977727 PHAGE_Salmon_SPN1S: putative bacteriophage protein; PP_03110; phage(gi374531224) 4e-144 Click
532977724..2978371 PHAGE_Entero_phiV10: putative adenine methylase; PP_03111; phage(gi89152451) 9e-125 Click
542978368..2978562 PHAGE_Entero_phiV10: hypothetical protein PhiV10p32; PP_03112; phage(gi89152473) 5e-30 Click
552978517..2978529 attR    ACTGGCAGCAGAA 0.0 Click
56complement(2978569..2979816) PHAGE_Entero_phiV10: putative integrase; PP_03113; phage(gi89152450) 0.0 Click
57complement(2980009..2981586) GMP synthase [Escherichia coli str. 'clone D i2'] gi|386630274|ref|YP_006149994.1|; PP_03114 0.0 Click
58complement(2981655..2983190) PHAGE_Staphy_42E: ORF012; PP_03115; phage(gi66395520) 4e-32 Click

Region 14, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13056223..3056489 PHAGE_Entero_mEp237: virulence protein MsgA; PP_03168; phage(gi435439290) 1e-41 Click
23056716..3057741 PHAGE_Acidia_virus: hypothetical protein ATV_gp34; PP_03169; phage(gi75750403) 1e-08 Click
3complement(3057753..3057962) PHAGE_Entero_mEp213: tail fiber assembly protein; PP_03170; phage(gi428782612) 1e-21 Click
43058109..3058975 hypothetical; PP_03171 0.0 Click
5complement(3058935..3059318) bacteriophage protein [Escherichia coli O55:H7 str. CB9615] gi|291283793|ref|YP_003500611.1|; PP_03173 2e-67 Click
63059460..3059597 hypothetical; PP_03172 0.0 Click
7complement(3059612..3060358) PHAGE_Vibrio_CP_T1: putative baseplate protein; PP_03174; phage(gi418489249) 6e-17 Click
8complement(3060358..3060711) PHAGE_Vibrio_vB_VchM_138: hypothetical protein; PP_03175; phage(gi422936599) 8e-15 Click
9complement(3060711..3061463) PHAGE_Haemop_Aaphi23: putative baseplate protein; PP_03176; phage(gi31544048) 2e-28 Click
10complement(3061523..3061762) hypothetical Protein PANA_1064 [Pantoea ananatis LMG 20103] gi|291616617|ref|YP_003519359.1|; PP_03177 8e-21 Click
11complement(3061902..3062135) hypothetical protein A225_1432 [Klebsiella oxytoca E718] gi|397656475|ref|YP_006497177.1|; PP_03179 4e-38 Click
123062165..3062278 hypothetical; PP_03178 0.0 Click
13complement(3062234..3063268) PHAGE_Psychr_pOW20_A: hypothetical protein; PP_03180; phage(gi472339843) 2e-20 Click
14complement(3063271..3063573) bacteriophage protein [Salmonella enterica subsp. enterica serovar Typhi str. Ty2] gi|29142304|ref|NP_805646.1|; PP_03181 2e-49 Click
15complement(3063577..3064227) PHAGE_Psychr_pOW20_A: hypothetical protein; PP_03182; phage(gi472339841) 7e-07 Click
16complement(3064227..3066233) PHAGE_Aggreg_S1249: putative tail length tape measure protein; PP_03183; phage(gi273809555) 7e-14 Click
17complement(3066411..3066572) bacteriophage protein [Salmonella enterica subsp. enterica serovar Typhi str. CT18] gi|16759921|ref|NP_455538.1|; PP_03184 1e-22 Click
18complement(3066887..3067339) bacteriophage protein [Salmonella enterica subsp. enterica serovar Typhi str. CT18] gi|16759921|ref|NP_455538.1|; PP_03185 7e-79 Click
19complement(3067343..3067783) PHAGE_Pseudo_vB_PaeM_C2_10_Ab1: hypothetical protein; PP_03186; phage(gi431809991) 8e-07 Click
20complement(3067794..3068939) PHAGE_Aggreg_S1249: hypothetical protein; PP_03187; phage(gi273809558) 2e-43 Click
21complement(3068943..3069491) hypothetical protein ECIAI1_2637 [Escherichia coli IAI1] gi|218555107|ref|YP_002388020.1|; PP_03188 1e-104 Click
22complement(3069481..3069870) bacteriophage protein [Salmonella enterica subsp. enterica serovar Typhi str. CT18] gi|16759917|ref|NP_455534.1|; PP_03189 1e-69 Click
23complement(3069857..3070411) PHAGE_Psychr_pOW20_A: hypothetical protein; PP_03190; phage(gi472339833) 1e-12 Click
24complement(3070408..3070785) bacteriophage protein [Shigella dysenteriae Sd197] gi|82777347|ref|YP_403696.1|; PP_03191 3e-57 Click
25complement(3070782..3071150) hypothetical protein ECO103_3109 [Escherichia coli O103:H2 str. 12009] gi|260845216|ref|YP_003222994.1|; PP_03192 4e-61 Click
26complement(3071191..3072132) PHAGE_Vibrio_CP_T1: putative major capsid protein; PP_03193; phage(gi418489228) 3e-16 Click
27complement(3072144..3072650) bacteriophage protein [Escherichia coli O55:H7 str. CB9615] gi|291283811|ref|YP_003500629.1|; PP_03194 3e-92 Click
28complement(3072654..3073874) PHAGE_Pectob_ZF40: putative head protein; PP_03195; phage(gi422936684) 1e-19 Click
29complement(3073889..3074419) PHAGE_Xantho_vB_XveM_DIBBI: head morphogenesis protein; PP_03196; phage(gi389060406) 1e-14 Click
30complement(3074514..3075980) PHAGE_Vibrio_CP_T1: putative portal protein; PP_03197; phage(gi418489212) 3e-40 Click
31complement(3075980..3076963) PHAGE_Burkho_BcepB1A: gp33 TerL; PP_03198; phage(gi48697520) 1e-50 Click
32complement(3076966..3077538) PHAGE_Pseudo_phi297: terminase small subunit; PP_03199; phage(gi374531284) 6e-49 Click
33complement(3077600..3078124) PHAGE_Entero_HK225: lysis protein Rz; PP_03200; phage(gi428782445) 7e-44 Click
34complement(3078108..3078584) PHAGE_Entero_SfV: lysin; PP_03201; phage(gi19549037) 2e-86 Click
35complement(3078588..3078851) PHAGE_Entero_SfV: holin; PP_03202; phage(gi19549036) 2e-43 Click
36complement(3079333..3079767) PHAGE_Bacter_2: Q protein; PP_03203; phage(gi212499710) 5e-43 Click
37complement(3080054..3082240) PHAGE_Bacter_2: predicted P-loop ATPase; PP_03204; phage(gi212499708) 5e-173 Click
383083856..3084005 hypothetical protein ECIAI1_2659 [Escherichia coli IAI1] gi|218555129|ref|YP_002388042.1|; PP_03205 6e-19 Click
393084002..3084904 PHAGE_Bacter_2: hypothetical protein APSE242; PP_03206; phage(gi212499746) 3e-09 Click
403084907..3086208 PHAGE_Bacter_2: hypothetical protein APSE241; PP_03207; phage(gi212499745) 3e-134 Click
413086224..3086772 PHAGE_Bacter_2: hypothetical protein APSE240; PP_03208; phage(gi212499744) 3e-49 Click
423086824..3087465 PHAGE_Salmon_SPN3UB: hypothetical protein; PP_03209; phage(gi423262433) 3e-73 Click
43complement(3087459..3088148) hypothetical protein HMPREF0424_0495 [Gardnerella vaginalis 409-05] gi|283782982|ref|YP_003373736.1|; PP_03210 9e-19 Click
443088210..3090273 PHAGE_Bordet_1: Bbp42; PP_03211; phage(gi41179402) 0.0 Click
453090333..3090494 hypothetical protein ECO103_3133 [Escherichia coli O103:H2 str. 12009] gi|260845240|ref|YP_003223018.1|; PP_03212 1e-23 Click
463090491..3090751 PHAGE_Entero_EcP1: hypothetical protein; PP_03213; phage(gi418489320) 4e-15 Click
473090735..3091028 PHAGE_Bacter_2: hypothetical protein APSE235; PP_03214; phage(gi212499740) 9e-29 Click
483091001..3092029 PHAGE_Entero_epsilon15: cytosine methylase; PP_03215; phage(gi30387420) 9e-102 Click
493092381..3093775 PHAGE_Bacter_2: DEAD box helicase; PP_03216; phage(gi212499736) 0.0 Click

Region 15, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13147200..3147212 attL    TGCGGGCTTTTTT 0.0 Click
23147329..3148540 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; PP_03271; phage(gi16130540) 5e-140 Click
33148568..3149926 PHAGE_Bacill_phBC6A51: hypothetical protein BC1912; PP_03272; phage(gi31415804) 1e-35 Click
4complement(3150297..3150869) PHAGE_Entero_P4: amber mutation-suppressing protein; PP_03273; phage(gi9627520) 1e-102 Click
5complement(3150943..3151083) PHAGE_Entero_P4: transactivation protein; PP_03275; phage(gi9627519) 3e-19 Click
63151223..3151345 hypothetical; PP_03274 0.0 Click
7complement(3151440..3152174) PHAGE_Entero_P4: head size determination protein sid; PP_03276; phage(gi9627518) 9e-135 Click
83152726..3152992 PHAGE_Entero_P4: transcriptional regulator; PP_03277; phage(gi9627517) 1e-46 Click
93152989..3153579 PHAGE_Entero_P4: putative CI repressor; PP_03278; phage(gi9627516) 9e-54 Click
103153572..3153859 PHAGE_Entero_P4: helper derepression protein; PP_03279; phage(gi9627515) 1e-49 Click
113153852..3154307 PHAGE_Entero_P4: hypothetical protein P4p08; PP_03280; phage(gi9627514) 2e-87 Click
123154443..3154763 PHAGE_Entero_P4: hypothetical protein P4p07; PP_03281; phage(gi9627513) 1e-55 Click
133154778..3157111 PHAGE_Entero_P4: DNA primase; PP_03282; phage(gi9627512) 0.0 Click
143157767..3157779 attR    TGCGGGCTTTTTT 0.0 Click

Region 16, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3165661..3166110) PHAGE_Clostr_phiMMP04: peptidoglycan-binding lysin domain protein; PP_03291; phage(gi414090456) 2e-06 Click
2complement(3166194..3166352) hypothetical protein SSON_2810 [Shigella sonnei Ss046] gi|74313237|ref|YP_311656.1|; PP_03292 8e-24 Click
33166535..3166834 transcriptional regulator YgaV [Escherichia coli O83:H1 str. NRG 857C] gi|387617939|ref|YP_006120961.1|; PP_03293 2e-47 Click
43166844..3167368 hypothetical protein ECSF_2465 [Escherichia coli SE15] gi|387830518|ref|YP_003350455.1|; PP_03294 2e-93 Click
5complement(3167415..3167819) DNA binding protein [Escherichia coli str. 'clone D i2'] gi|386630398|ref|YP_006150118.1|; PP_03295 7e-68 Click
63167948..3168361 PHAGE_Entero_HK022: IS903 transposase; PP_03296; phage(gi9634149) 3e-69 Click
73168343..3168783 PHAGE_Entero_HK022: IS903 transposase; PP_03297; phage(gi9634149) 2e-77 Click
83169465..3169914 hypothetical protein SFV_2833 [Shigella flexneri 5 str. 8401] gi|110806697|ref|YP_690217.1|; PP_03298 4e-80 Click
9complement(3169951..3170295) hypothetical protein SSON_2816 [Shigella sonnei Ss046] gi|74313243|ref|YP_311662.1|; PP_03299 6e-61 Click
103170447..3170776 hypothetical protein SSON_2817 [Shigella sonnei Ss046] gi|74313244|ref|YP_311663.1|; PP_03300 1e-55 Click
113171023..3171268 PHAGE_Mycoba_Porky: gp37; PP_03301; phage(gi194303333) 3e-10 Click
123171265..3171675 PHAGE_Bacill_SP10: ribonucleotide reductase stimulatory protein; PP_03302; phage(gi418489617) 7e-14 Click
133171648..3173792 PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; PP_03303; phage(gi158079505) 0.0 Click
143173802..3174761 PHAGE_Mycoba_Myrna: gp256; PP_03304; phage(gi203454817) 1e-129 Click
153175117..3176319 PHAGE_Plankt_PaV_LD: ABC transporter; PP_03305; phage(gi371496158) 3e-24 Click
163176312..3177376 PHAGE_Lactob_KC5a: putative minor tail protein; PP_03306; phage(gi90592623) 6e-06 Click

Region 17, total : 138 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14688033..4688046 attL    CATTGCTGGTGGCT 0.0 Click
24701344..4701952 PHAGE_Entero_mEp460: LexA DNA binding domain protein; PP_04764; phage(gi428782362) 2e-13 Click
34702025..4703350 DNA-damage-inducible SOS response protein [Escherichia coli str. 'clone D i2'] gi|386632019|ref|YP_006151739.1|; PP_04765 0.0 Click
44703466..4703675 putative stress-response protein [Escherichia coli str. 'clone D i2'] gi|386632020|ref|YP_006151740.1|; PP_04766 4e-36 Click
5complement(4703717..4704232) zinc uptake transcriptional repressor [Escherichia coli str. 'clone D i2'] gi|386632021|ref|YP_006151741.1|; PP_04767 7e-96 Click
64704598..4705131 PHAGE_Entero_mEp460: hypothetical protein; PP_04768; phage(gi428782339) 2e-100 Click
74705328..4705501 PHAGE_Entero_mEp460: hypothetical protein; PP_04769; phage(gi428782340) 4e-26 Click
84705555..4705677 hypothetical; PP_04770 0.0 Click
9complement(4705867..4706439) PHAGE_Entero_mEp460: putative exonuclease; PP_04771; phage(gi428782342) 3e-107 Click
10complement(4706439..4706804) PHAGE_Entero_mEp460: hypothetical protein; PP_04772; phage(gi428782343) 5e-43 Click
114706823..4706951 hypothetical; PP_04773 0.0 Click
124707442..4707867 PHAGE_Entero_P1: TciA; PP_04774; phage(gi46401694) 3e-73 Click
134708142..4708217 tRNA 0.0 Click
144708571..4709866 PHAGE_Entero_P1: Ban; PP_04775; phage(gi46401697) 0.0 Click
154709866..4710864 PHAGE_Entero_P1: Dbn; PP_04776; phage(gi46401698) 0.0 Click
16complement(4710910..4711509) PHAGE_Entero_P1: gp5; PP_04777; phage(gi46401699) 2e-111 Click
17complement(4711535..4712551) PHAGE_Entero_P1: gp6; PP_04778; phage(gi46401700) 0.0 Click
18complement(4712553..4713338) PHAGE_Entero_P1: gp24; PP_04779; phage(gi46401701) 5e-142 Click
19complement(4713325..4714053) PHAGE_Entero_P1: gp7; PP_04780; phage(gi46401702) 3e-138 Click
20complement(4714057..4715274) PHAGE_Entero_P1: gp25; PP_04781; phage(gi46401703) 0.0 Click
21complement(4715284..4715544) PHAGE_Entero_P1: gp26; PP_04782; phage(gi46401704) 4e-46 Click
224715808..4716053 PHAGE_Entero_P1: PmgL; PP_04783; phage(gi46401705) 7e-42 Click
234716056..4716634 PHAGE_Entero_P1: pmgM; PP_04784; phage(gi46401706) 2e-101 Click
244716740..4716856 PHAGE_Entero_P1: PmgN; PP_04785; phage(gi46401707) 1e-15 Click
254717358..4717984 PHAGE_Entero_P1: PmgP; PP_04786; phage(gi46401709) 2e-121 Click
264717966..4718658 PHAGE_Entero_P1: Ppp; PP_04787; phage(gi46401710) 1e-133 Click
274718655..4719356 PHAGE_Entero_P1: PmgQ; PP_04788; phage(gi46401711) 4e-139 Click
284719658..4720920 PHAGE_Entero_P1: PmgS; PP_04789; phage(gi46401713) 0.0 Click
294720994..4721500 PHAGE_Entero_P1: Pap; PP_04790; phage(gi46401714) 3e-92 Click
304721551..4721685 hypothetical; PP_04791 0.0 Click
314721695..4722273 PHAGE_Salmon_SPN1S: hypothetical protein; PP_04792; phage(gi374531240) 1e-59 Click
324722283..4723155 PHAGE_Entero_lambda: NinC protein; PP_04793; phage(gi9626299) 7e-145 Click
334723152..4723355 PHAGE_Entero_mEp460: hypothetical protein; PP_04794; phage(gi428782347) 4e-31 Click
344723348..4723587 PHAGE_Entero_mEp460: hypothetical protein; PP_04795; phage(gi428782346) 1e-34 Click
354723584..4724216 PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; PP_04796; phage(gi89152464) 6e-81 Click
364724730..4725740 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp45; PP_04797; phage(gi116222037) 2e-57 Click
374725806..4726099 PHAGE_Entero_P1: PmgV; PP_04798; phage(gi46401717) 2e-47 Click
38complement(4726175..4726312) hypothetical; PP_04799 0.0 Click
394726602..4726727 PHAGE_Entero_P1: UpfO; PP_04800; phage(gi46401720) 2e-14 Click
404726763..4727014 PHAGE_Entero_P1: Hot; PP_04801; phage(gi46401721) 7e-39 Click
414727048..4727398 PHAGE_Salmon_SSU5: hypothetical protein; PP_04802; phage(gi410491441) 2e-32 Click
424727499..4727888 PHAGE_Entero_P1: HumD; PP_04803; phage(gi46401723) 4e-70 Click
434727961..4728182 PHAGE_Entero_P1: Phd; PP_04804; phage(gi46401724) 2e-34 Click
444728182..4728562 PHAGE_Entero_P1: Doc; PP_04805; phage(gi46401725) 5e-62 Click
454728862..4729041 PHAGE_Entero_P1: PdcA; PP_04806; phage(gi46401726) 2e-25 Click
464729069..4730112 PHAGE_Entero_mEp460: hypothetical protein; PP_04807; phage(gi428782365) 4e-35 Click
474730231..4730653 PHAGE_Entero_P1: Lpa; PP_04808; phage(gi46401728) 7e-76 Click
484730740..4731933 PHAGE_Entero_P1: PacA; PP_04809; phage(gi46401729) 0.0 Click
494731933..4733417 PHAGE_Entero_P1: PacB; PP_04810; phage(gi46401730) 0.0 Click
50complement(4733443..4734294) PHAGE_Entero_P1: C1.100; PP_04811; phage(gi46401731) 2e-159 Click
514735219..4735440 PHAGE_Entero_P1: Cra; PP_04812; phage(gi46401627) 5e-35 Click
524735460..4735855 hypothetical; PP_04813 0.0 Click
534735933..4736883 PHAGE_Entero_P1: Cre; PP_04814; phage(gi46401628) 1e-179 Click
544737492..4738052 PHAGE_Entero_P1: Ref; PP_04815; phage(gi46401630) 2e-104 Click
554738131..4738883 PHAGE_Entero_P1: Mat; PP_04816; phage(gi46401631) 3e-138 Click
564738940..4740244 PHAGE_Bacill_phBC6A51: hypothetical protein BC1912; PP_04817; phage(gi31415804) 3e-10 Click
57complement(4740286..4740423) PHAGE_Entero_P1: Lxc; PP_04818; phage(gi46401633) 4e-21 Click
58complement(4740531..4740971) PHAGE_Entero_P1: Ulx; PP_04819; phage(gi46401634) 1e-79 Click
59complement(4741005..4747661) PHAGE_Entero_P1: DarB; PP_04820; phage(gi46401635) 0.0 Click
604747848..4749569 PHAGE_Entero_P1: Prt; PP_04821; phage(gi46401636) 0.0 Click
61complement(4749602..4750732) PHAGE_Gifsy_1: transposase; PP_04822; phage(gi169257226) 0.0 Click
624750845..4751864 PHAGE_Entero_P1: Pro; PP_04823; phage(gi46401637) 0.0 Click
63complement(4752156..4752800) PHAGE_Entero_P1: Lyz; PP_04824; phage(gi46401639) 1e-106 Click
644752883..4753371 PHAGE_Entero_P1: Ssb; PP_04825; phage(gi46401640) 3e-91 Click
654753568..4754248 PHAGE_Vibrio_vB_VpaS_MAR10: hypothetical protein; PP_04826; phage(gi428782094) 2e-10 Click
664754255..4755037 PHAGE_Entero_P1: IsaA; PP_04827; phage(gi46401641) 5e-138 Click
67complement(4755067..4755375) PHAGE_Entero_P1: Hxr; PP_04828; phage(gi46401645) 5e-54 Click
68complement(4755365..4758352) PHAGE_Entero_P1: DdrB; PP_04829; phage(gi46401646) 0.0 Click
69complement(4758365..4758706) PHAGE_Entero_P1: DdrA; PP_04830; phage(gi46401647) 9e-56 Click
70complement(4758727..4760646) PHAGE_Entero_P1: DarA; PP_04831; phage(gi46401648) 0.0 Click
71complement(4760648..4761250) PHAGE_Entero_P1: Hdf; PP_04832; phage(gi46401649) 7e-105 Click
72complement(4761237..4761680) PHAGE_Entero_P1: LydB; PP_04833; phage(gi46401650) 9e-83 Click
73complement(4761677..4761793) PHAGE_Entero_P1: LydA; PP_04834; phage(gi46401651) 1e-14 Click
74complement(4762780..4763352) PHAGE_Entero_2: DNA-invertase; PP_04835; phage(gi169936026) 7e-82 Click
754763854..4764291 PHAGE_Xantho_vB_XveM_DIBBI: single-stranded DNA-binding protein; PP_04836; phage(gi389060431) 5e-35 Click
76complement(4764261..4764686) hypothetical; PP_04838 0.0 Click
774764663..4765043 PHAGE_Entero_P1: Ssb; PP_04837; phage(gi46401640) 1e-29 Click
784765106..4765327 hypothetical protein ECH74115_B0067 [Escherichia coli O157:H7 str. EC4115] gi|209395632|ref|YP_002268447.1|; PP_04839 1e-29 Click
79complement(4765385..4765687) hypothetical protein APECO1_1036 [Escherichia coli APEC O1] gi|117624142|ref|YP_853055.1|; PP_04840 9e-37 Click
80complement(4765674..4765973) PHAGE_Pectob_ZF40: putative methylase; PP_04841; phage(gi422936660) 1e-37 Click
81complement(4766165..4766494) PHAGE_Entero_phiV10: eae-like protein; PP_04842; phage(gi89152462) 1e-37 Click
82complement(4766506..4767042) PHAGE_Entero_mEp460: hypothetical protein; PP_04843; phage(gi428782349) 3e-100 Click
83complement(4767171..4767995) PHAGE_Entero_mEp460: hypothetical protein; PP_04844; phage(gi428782350) 5e-151 Click
84complement(4767964..4768104) hypothetical; PP_04845 0.0 Click
85complement(4768061..4768423) PHAGE_Entero_mEp460: hypothetical protein; PP_04846; phage(gi428782351) 3e-61 Click
864768703..4769044 hypothetical protein Y75_p1113 [Escherichia coli str. K-12 substr. W3110] gi|388477223|ref|YP_489411.1|; PP_04847 2e-58 Click
87complement(4769464..4769724) PHAGE_Entero_SfV: repressor; PP_04848; phage(gi19549021) 1e-47 Click
884770229..4770429 PHAGE_Entero_cdtI: Repressor; PP_04849; phage(gi148609424) 7e-32 Click
894770473..4771024 PHAGE_Entero_mEp460: hypothetical protein; PP_04850; phage(gi428782356) 2e-98 Click
904771021..4772805 PHAGE_Entero_mEp460: regulatory protein Rha; PP_04851; phage(gi428782357) 4e-152 Click
914772802..4772996 hypothetical protein CE10_2479 [Escherichia coli O7:K1 str. CE10] gi|386624804|ref|YP_006144532.1|; PP_04852 2e-17 Click
924772993..4773217 PHAGE_Entero_mEp460: hypothetical protein; PP_04853; phage(gi428782358) 6e-31 Click
934773220..4774101 PHAGE_Entero_mEp460: regulatory protein Rha; PP_04854; phage(gi428782357) 2e-87 Click
944774098..4775039 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_04855; phage(gi18249881) 4e-40 Click
954775279..4775530 PHAGE_Entero_mEp460: hypothetical protein; PP_04856; phage(gi428782360) 1e-40 Click
964775530..4776183 PHAGE_Entero_mEp460: DNA N-6-adenine-methyltransferase; PP_04857; phage(gi428782361) 4e-126 Click
974776180..4776506 PHAGE_Entero_mEp460: LexA DNA binding domain protein; PP_04858; phage(gi428782362) 3e-55 Click
984776503..4776874 PHAGE_Entero_mEp460: holliday junction resolvase; PP_04859; phage(gi428782363) 7e-61 Click
994777026..4777841 PHAGE_Entero_mEp460: KilA-N domain protein; PP_04860; phage(gi428782364) 2e-95 Click
1004777857..4778372 PHAGE_Entero_phiP27: hypothetical protein P27p20; PP_04861; phage(gi18249884) 3e-07 Click
1014778454..4779371 PHAGE_Entero_mEp460: hypothetical protein; PP_04862; phage(gi428782365) 0.0 Click
1024779389..4779754 PHAGE_Entero_cdtI: antitermination protein Q; PP_04863; phage(gi148609434) 4e-57 Click
103complement(4779791..4780201) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp53; PP_04864; phage(gi148609435) 2e-29 Click
104complement(4780262..4781464) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp54; PP_04865; phage(gi148609436) 6e-68 Click
1054781840..4782061 PHAGE_Entero_mEp460: porin; PP_04866; phage(gi428782370) 2e-12 Click
1064782039..4782578 PHAGE_Entero_mEp460: endolysin; PP_04867; phage(gi428782372) 1e-98 Click
1074782853..4783422 PHAGE_Escher_P13374: antirepressor; PP_04868; phage(gi410491647) 2e-81 Click
1084783533..4783679 hypothetical protein ECSP_2608 [Escherichia coli O157:H7 str. TW14359] gi|254793653|ref|YP_003078490.1|; PP_04869 9e-18 Click
1094784000..4784113 hypothetical; PP_04870 0.0 Click
1104784110..4784577 PHAGE_Entero_HK630: cell lysis protein Rz; PP_04871; phage(gi428782852) 5e-49 Click
1114785018..4785200 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip154; PP_04872; phage(gi20065949) 1e-05 Click
1124785184..4785348 PHAGE_Escher_P13374: regulatory protein; PP_04873; phage(gi410491650) 1e-09 Click
113complement(4785316..4785489) arginyl-tRNA synthetase [Escherichia coli O7:K1 str. CE10] gi|386622925|ref|YP_006142653.1|; PP_04874 2e-10 Click
1144785556..4786098 hypothetical; PP_04875 0.0 Click
1154786420..4786533 hypothetical; PP_04876 0.0 Click
1164786620..4787168 PHAGE_Entero_mEp237: terminase small subunit nu1; PP_04877; phage(gi435439266) 5e-59 Click
1174787299..4789065 PHAGE_Gifsy_1: DNA packaging protein; large terminase subunit; Lambda gpA homolog; PP_04878; phage(gi169257235) 0.0 Click
1184789052..4789258 PHAGE_Entero_mEp237: head-tail connector; PP_04879; phage(gi435439268) 1e-13 Click
1194789255..4790847 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; PP_04880; phage(gi169257233) 0.0 Click
1204790837..4792342 PHAGE_Gifsy_1: bacteriophage prohead protease; Lambda gpC homolog; PP_04881; phage(gi169257232) 5e-174 Click
1214792379..4792717 PHAGE_Gifsy_1: bacteriophage head decoration protein; Lambda gpD homolog; PP_04882; phage(gi169257231) 1e-40 Click
1224792798..4793826 PHAGE_Gifsy_1: bacteriophage major capsid protein; Lambda gpE homolog; PP_04883; phage(gi169257230) 2e-171 Click
1234793877..4794278 PHAGE_Entero_HK225: head assembly protein Fi; PP_04884; phage(gi428782384) 4e-17 Click
1244794290..4794661 PHAGE_Entero_HK630: head-tail connector Fii; PP_04885; phage(gi428782797) 3e-29 Click
1254794648..4795226 PHAGE_Entero_mEp460: minor tail protein; PP_04886; phage(gi428782324) 4e-92 Click
1264795223..4795624 PHAGE_Entero_mEp460: minor tail protein; PP_04887; phage(gi428782325) 1e-67 Click
1274795635..4796378 PHAGE_Entero_mEp460: major tail protein; PP_04888; phage(gi428782326) 2e-119 Click
1284796442..4796834 PHAGE_Entero_mEp460: minor tail protein; PP_04889; phage(gi428782327) 2e-41 Click
1294796855..4797157 PHAGE_Entero_mEp460: tail assembly protein; PP_04890; phage(gi428782328) 2e-40 Click
1304797141..4800149 PHAGE_Entero_mEp460: tail length tape measure protein; PP_04891; phage(gi428782329) 0.0 Click
1314800149..4800478 PHAGE_Entero_mEp460: minor tail protein; PP_04892; phage(gi428782330) 6e-46 Click
1324800489..4801187 PHAGE_Entero_mEp460: minor tail protein; PP_04893; phage(gi428782331) 1e-111 Click
1334801336..4801935 PHAGE_Entero_mEp460: tail fiber component; PP_04894; phage(gi428782332) 4e-108 Click
1344801899..4802483 PHAGE_Entero_mEp460: tail assembly protein; PP_04895; phage(gi428782333) 9e-75 Click
1354802527..4805346 PHAGE_Entero_mEp460: host specificity protein; PP_04896; phage(gi428782334) 0.0 Click
1364805348..4806121 PHAGE_Entero_HK629: tail fiber protein; PP_04897; phage(gi428782034) 3e-25 Click
1374806096..4806335 hypothetical; PP_04898 0.0 Click
1384806348..4807424 phage-like protein [Salmonella bongori NCTC 12419] gi|339998925|ref|YP_004729808.1|; PP_04899 3e-32 Click
1394807435..4807701 hypothetical; PP_04900 0.0 Click
140complement(4808060..4808308) PHAGE_Entero_mEp460: DinI-like protein; PP_04901; phage(gi428782337) 5e-41 Click
1414808167..4808180 attR    CATTGCTGGTGGCT 0.0 Click
142complement(4808370..4809467) PHAGE_Entero_mEp460: integrase; PP_04902; phage(gi428782338) 0.0 Click

Region 18, total : 55 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15283756..5284778 PHAGE_Megavi_lba: putative zinc-type alcohol dehydrogenase-like protein; PP_05377; phage(gi448825331) 1e-17 Click
2complement(5285136..5285651) PHAGE_Pseudo_DMS3: putative c repressor; PP_05378; phage(gi156523050) 8e-07 Click
35285885..5286094 PHAGE_Haemop_SuMu: Mu-like prophage FluMu DNA-binding protein Ner; PP_05379; phage(gi418489037) 7e-08 Click
45286096..5288198 PROPHAGE_Escher_Sakai: phage transposase; PP_05380; phage(gi15834199) 0.0 Click
55288237..5289175 PHAGE_Entero_Mu: DNA transposition protein; PP_05381; phage(gi9633513) 3e-174 Click
65289191..5289418 PHAGE_Entero_Mu: kil; PP_05382; phage(gi9633497) 4e-38 Click
75289421..5289651 PHAGE_Entero_Mu: hypothetical protein Mup06; PP_05383; phage(gi9633498) 3e-43 Click
85289663..5289926 PHAGE_Entero_Mu: hypothetical protein Mup07; PP_05384; phage(gi9633499) 1e-40 Click
95289917..5290360 PHAGE_Entero_Mu: hypothetical protein Mup08; PP_05385; phage(gi9633547) 5e-78 Click
105290373..5290660 PHAGE_Entero_Mu: hypothetical protein Mup09; PP_05386; phage(gi9633546) 4e-50 Click
115290680..5291204 PHAGE_Entero_Mu: Gam; PP_05387; phage(gi9633500) 5e-93 Click
125291303..5291833 PHAGE_Entero_Mu: hypothetical protein Mup11; PP_05388; phage(gi9633501) 1e-99 Click
135291833..5292363 PHAGE_Entero_Mu: hypothetical protein Mup12; PP_05389; phage(gi9633502) 9e-100 Click
145292350..5292532 PHAGE_Entero_Mu: hypothetical protein Mup13; PP_05390; phage(gi9633503) 5e-35 Click
155292534..5292836 PHAGE_Entero_Mu: hypothetical protein Mup14; PP_05391; phage(gi9633504) 2e-51 Click
165292888..5293439 PHAGE_Entero_Mu: hypothetical protein Mup16; PP_05392; phage(gi9633506) 1e-101 Click
175293436..5293825 PHAGE_Entero_Mu: Mor; PP_05393; phage(gi9633507) 6e-70 Click
185293903..5294133 PHAGE_Entero_Mu: hypothetical protein Mup18; PP_05394; phage(gi9633508) 6e-38 Click
195294114..5294233 PHAGE_Entero_Mu: hypothetical protein Mup20; PP_05395; phage(gi9633510) 2e-15 Click
205294246..5294668 PHAGE_Entero_Mu: putative transcription regulator; PP_05396; phage(gi9633511) 2e-78 Click
215294760..5295278 PHAGE_Entero_Mu: Lys; PP_05397; phage(gi9633512) 1e-93 Click
225295262..5295648 PHAGE_Entero_Mu: hypothetical protein Mup23; PP_05398; phage(gi9633514) 5e-67 Click
235295734..5295850 hypothetical protein [Escherichia coli KO11FL] gi|378714370|ref|YP_005279263.1|; PP_05399 5e-14 Click
245295807..5296001 PHAGE_Entero_Mu: hypothetical protein Mup24; PP_05400; phage(gi9633515) 7e-34 Click
255296001..5296300 PHAGE_Entero_Mu: hypothetical protein Mup25; PP_05401; phage(gi9633516) 3e-50 Click
265296297..5296587 PHAGE_Entero_Mu: hypothetical protein Mup26; PP_05402; phage(gi9633517) 7e-50 Click
275296599..5297174 PHAGE_Entero_Mu: hypothetical protein Mup27; PP_05403; phage(gi9633518) 3e-101 Click
285297366..5297563 hypothetical; PP_05404 0.0 Click
29complement(5297538..5297789) hypothetical; PP_05405 0.0 Click
305297788..5299443 PHAGE_Entero_Mu: putative portal protein; PP_05406; phage(gi9633519) 0.0 Click
315299443..5300981 PHAGE_Entero_Mu: hypothetical protein Mup29; PP_05407; phage(gi9633520) 0.0 Click
325300962..5302281 PHAGE_Entero_Mu: virion morphogenesis late F orf; PP_05408; phage(gi9633521) 0.0 Click
335302278..5302748 PHAGE_Entero_Mu: putative virion morphogenesis protein; PP_05409; phage(gi9633522) 7e-87 Click
345302945..5304030 PHAGE_Entero_Mu: putative protease protein; PP_05410; phage(gi9633523) 0.0 Click
355304027..5304944 PHAGE_Entero_Mu: major head subunit; PP_05411; phage(gi9633525) 3e-177 Click
365305011..5305421 PHAGE_Entero_Mu: hypothetical protein Mup35; PP_05412; phage(gi9633526) 2e-69 Click
375305418..5305843 PHAGE_Entero_Mu: hypothetical protein Mup36; PP_05413; phage(gi9633527) 5e-75 Click
385305843..5306391 PHAGE_Entero_Mu: hypothetical protein Mup37; PP_05414; phage(gi9633528) 6e-105 Click
395306378..5306581 PHAGE_Entero_Mu: hypothetical protein Mup38; PP_05415; phage(gi9633529) 4e-32 Click
405306578..5308065 PHAGE_Entero_Mu: major tail subunit; PP_05416; phage(gi9633530) 0.0 Click
415308075..5308431 PHAGE_Entero_Mu: hypothetical protein Mup40; PP_05417; phage(gi9633531) 1e-64 Click
425308441..5308875 PHAGE_Entero_Mu: hypothetical protein Mup41; PP_05418; phage(gi9633532) 5e-75 Click
435309020..5311092 PHAGE_Entero_Mu: putative tape measure protein; PP_05419; phage(gi9633533) 0.0 Click
445311097..5312584 PHAGE_Entero_Mu: putative DNA circulation protein; PP_05420; phage(gi9633534) 0.0 Click
455312577..5313710 PHAGE_Entero_Mu: putative tail protein; PP_05421; phage(gi9633535) 0.0 Click
465313698..5314291 PHAGE_Entero_Mu: putative baseplate assembly protein; PP_05422; phage(gi9633536) 2e-109 Click
475314288..5314725 PHAGE_Entero_Mu: hypothetical protein Mup46; PP_05423; phage(gi9633537) 7e-82 Click
485314726..5315808 PHAGE_Entero_Mu: hypothetical protein Mup47; PP_05424; phage(gi9633538) 0.0 Click
495315799..5316341 PHAGE_Entero_Mu: hypothetical protein Mup48; PP_05425; phage(gi9633539) 4e-102 Click
50complement(5316408..5316548) PHAGE_Entero_HK022: IS903 transposase; PP_05426; phage(gi9634149) 5e-19 Click
515316864..5317175 PROPHAGE_Xantho_33913: ISxac3 transposase; PP_05427; phage(gi21231087) 1e-06 Click
525317188..5317370 hypothetical; PP_05428 0.0 Click
535317364..5318041 PHAGE_Entero_Sf6: putative transposase OrfB; PP_05429; phage(gi41057343) 6e-81 Click
545318131..5319099 conjugative transfer: assembly [Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S] gi|378448131|ref|YP_005235623.1|; PP_05430 3e-171 Click
555319096..5322365 PHAGE_Strept_P9: tail protein; PP_05431; phage(gi157311175) 3e-06 Click

Region 19, total : 11 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(5414148..5414654) PHAGE_Aggreg_S1249: hypothetical protein; PP_05565; phage(gi273809547) 6e-08 Click
25414641..5414781 hypothetical; PP_05566 0.0 Click
3complement(5414800..5415954) PHAGE_Psychr_pOW20_A: hypothetical protein; PP_05567; phage(gi472339848) 2e-51 Click
4complement(5415932..5416603) PROPHAGE_Escher_CFT073: transposase/IS protein; PP_05568; phage(gi26248359) 2e-119 Click
5complement(5416671..5417615) PROPHAGE_Escher_CFT073: transposase; PP_05569; phage(gi26248360) 6e-151 Click
6complement(5417629..5419221) PHAGE_Cyprin_2: membrane protein ORF25D; PP_05570; phage(gi422933804) 4e-17 Click
75419515..5420207 hypothetical protein FTW_1679 [Francisella tularensis subsp. tularensis WY96-3418] gi|134302522|ref|YP_001122492.1|; PP_05571 4e-44 Click
8complement(5420235..5420348) hypothetical; PP_05572 0.0 Click
95420891..5421118 phage terminase, small subunit [Escherichia coli O55:H7 str. CB9615] gi|291283816|ref|YP_003500634.1|; PP_05573 3e-22 Click
105421121..5421303 terminase large subunit [Escherichia coli O127:H6 str. E2348/69] gi|215487586|ref|YP_002330017.1|; PP_05574 1e-16 Click
115421284..5422546 PHAGE_Psychr_pOW20_A: phage terminase large subunit; PP_05575; phage(gi472339822) 7e-25 Click