Grimontia hollisae CIP 101886 , whole genome shotgun [asmbl_id: NC_000000].4002786, GC%: 49.47%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1285248..286153 PHAGE_Parame_1: hypothetical protein; VHA_000267; phage(gi9631622) 3e-07 Click
2286153..286737 uracil-DNA glycosylase; VHA_000268 0.0 Click
3complement(286917..287981) uroporphyrinogen III decarboxylase; VHA_000269 0.0 Click
4288156..288196 attL    ATAATCGCATCTTACCCGCCTCCCTACGGCGGGCTTTTTTT 0.0 Click
5complement(288352..289392) PHAGE_Vibrio_kappa: putative integrase; VHA_000270; phage(gi165970235) 1e-85 Click
6complement(289827..290225) PHAGE_Vibrio_kappa: putative repressor; VHA_000271; phage(gi165970238) 5e-16 Click
7290640..290840 PHAGE_Haemop_HP2: orf2(S)cox; VHA_000272; phage(gi17981819) 6e-09 Click
8290954..291493 PHAGE_Vibrio_kappa: putative regulator; VHA_000273; phage(gi165970240) 9e-12 Click
9291505..291873 PHAGE_Vibrio_kappa: hypothetical protein KP7; VHA_000274; phage(gi165970241) 8e-15 Click
10291935..292213 hypothetical protein; VHA_000275 0.0 Click
11292210..292440 PHAGE_Vibrio_kappa: hypothetical protein KP11; VHA_000276; phage(gi165970245) 2e-12 Click
12292437..294746 hypothetical protein; VHA_000277 0.0 Click
13294743..295339 PHAGE_Vibrio_vB_VpaM_MAR: putative exonuclease; VHA_000278; phage(gi428782757) 4e-45 Click
14complement(295636..295764) hypothetical protein; VHA_000279 0.0 Click
15complement(296411..297472) hypothetical protein; VHA_000280 0.0 Click
16complement(297462..298220) hypothetical protein; VHA_000281 0.0 Click
17complement(298442..299476) RelA/SpoT domain protein; VHA_000282 0.0 Click
18complement(300359..301387) PHAGE_Salmon_ST160: regulatory protein; VHA_000283; phage(gi318065923) 9e-30 Click
19complement(302020..303060) PHAGE_Vibrio_kappa: hypothetical pbsx family phage portal protein; VHA_000284; phage(gi165970255) 4e-115 Click
20complement(303063..304847) PHAGE_Vibrio_kappa: putative terminase ATPase subunit; VHA_000285; phage(gi165970256) 0.0 Click
21305026..305868 PHAGE_Vibrio_kappa: putative capsid scaffolding protein; VHA_000286; phage(gi165970257) 5e-37 Click
22305869..306861 PHAGE_Vibrio_kappa: putative major capsid protein; VHA_000287; phage(gi165970258) 5e-71 Click
23306872..307594 PHAGE_Vibrio_kappa: putative terminase endonuclease subunit; VHA_000288; phage(gi165970259) 2e-52 Click
24307702..308109 PHAGE_Vibrio_kappa: putative head completion protein; VHA_000289; phage(gi165970260) 3e-09 Click
25308109..308594 PHAGE_Vibrio_kappa: hypothetical protein KP27; VHA_000290; phage(gi165970261) 5e-16 Click
26308578..309246 PHAGE_Vibrio_kappa: putative tail completion protein; VHA_000291; phage(gi165970262) 3e-10 Click
27309249..310379 PHAGE_Vibrio_kappa: putative tail sheath protein; VHA_000292; phage(gi165970264) 5e-70 Click
28310383..310832 PHAGE_Vibrio_kappa: putative tail tube protein; VHA_000293; phage(gi165970265) 8e-25 Click
29complement(310862..310999) hypothetical protein; VHA_000294 0.0 Click
30311062..311481 hypothetical protein; VHA_000295 0.0 Click
31311486..312070 PHAGE_Burkho_BcepF1: hypothetical protein BcepF1.086; VHA_000296; phage(gi126011020) 1e-14 Click
32312071..312346 hypothetical protein; VHA_000297 0.0 Click
33312343..312609 PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_36; VHA_000298; phage(gi148727164) 2e-11 Click
34312651..312794 PHAGE_Pasteu_F108: hypothetical protein F108p32; VHA_000299; phage(gi109302928) 9e-08 Click
35312798..314687 PHAGE_Vibrio_kappa: putative tail length determinator; VHA_000300; phage(gi165970271) 2e-145 Click
36314684..315022 PHAGE_Vibrio_kappa: hypothetical protein KP38; VHA_000301; phage(gi165970272) 2e-13 Click
37315015..316199 PHAGE_Vibrio_kappa: hypothetical protein KP39; VHA_000302; phage(gi165970273) 3e-78 Click
38316204..316824 PHAGE_Vibrio_kappa: hypothetical protein KP40; VHA_000303; phage(gi165970274) 9e-39 Click
39316844..318274 PHAGE_Vibrio_kappa: putative tail fiber protein; VHA_000304; phage(gi165970275) 5e-93 Click
40318271..318822 PHAGE_Vibrio_kappa: putative tail fiber assembly protein; VHA_000305; phage(gi165970276) 2e-10 Click
41318823..319362 PHAGE_Vibrio_kappa: hypothetical protein KP44; VHA_000306; phage(gi165970278) 2e-19 Click
42complement(321583..321708) hypothetical protein; VHA_000309 0.0 Click
43322272..323024 PHAGE_Invert_6: 235L; VHA_000310; phage(gi15078947) 8e-09 Click
44323323..323363 attR    ATAATCGCATCTTACCCGCCTCCCTACGGCGGGCTTTTTTT 0.0 Click