Escherichia coli str. K-12 substr. W3110 strain K-12. [asmbl_id: NC_000000].4646332, GC%: 50.80%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
18238..9191 PHAGE_Cyanop_MED4_213: TalC; -; phage(gi472340344) 2e-12 Click
29306..9893 predicted molybdochelatase; - 0.0 Click
3complement(9928..10494) conserved inner membrane protein associated with acetate transport; - 0.0 Click
4complement(10643..11356) hypothetical protein; - 0.0 Click
510830..11315 hypothetical protein; - 0.0 Click
6complement(11382..11786) hypothetical protein; - 0.0 Click
712163..14079 PHAGE_Bathyc_BpV1: hypothetical protein; -; phage(gi313768007) 2e-154 Click
814168..15298 PHAGE_Cafete_BV_PW1: putative DnaJ/Hsp40; -; phage(gi310831116) 4e-46 Click
915445..16557 PROPHAGE_Escher_MG1655: IS186 transposase; -; phage(gi90111427) 0.0 Click
10complement(16751..16960) PHAGE_Entero_Min27: mokW; -; phage(gi170783687) 3e-22 Click
11complement(16751..16903) PHAGE_Entero_Min27: mokW; -; phage(gi170783687) 8e-17 Click
1217489..18655 sodium-proton antiporter; - 0.0 Click
1318715..19620 DNA-binding transcriptional activator; - 0.0 Click
14complement(19811..20314) PROPHAGE_Escher_MG1655: IS1 transposase B; -; phage(gi16131317) 1e-96 Click

Region 2, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1563978..564024 attL    CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT 0.0 Click
2complement(564038..565201) PHAGE_Salmon_epsilon34: Tyrosine integrase; -; phage(gi221328640) 0.0 Click
3complement(565321..565584) PHAGE_Entero_2008: putative exonuclease; -; phage(gi209427739) 1e-46 Click
4566056..566364 PROPHAGE_Escher_MG1655: IS3 transposase A; -; phage(gi226524700) 4e-49 Click
5566361..567227 PROPHAGE_Escher_MG1655: IS3 transposase B; -; phage(gi16128284) 3e-173 Click
6567285..567470 PHAGE_Entero_lambda: ren exclusion protein; -; phage(gi9626297) 2e-21 Click
7567538..567870 PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; -; phage(gi311992758) 1e-10 Click
8567928..567939 attL    TTTTATGCTTTT 0.0 Click
9568125..569651 PHAGE_Bacill_WBeta: putative site-specific recombinase; -; phage(gi85701406) 5e-09 Click
10570116..570667 predicted kinase inhibitor; - 0.0 Click
11570677..571474 predicted DNA-binding transcriptional regulator; - 0.0 Click
12571689..572144 PHAGE_Cronob_phiES15: hypothetical protein; -; phage(gi401817579) 6e-61 Click
13572144..572314 PHAGE_Escher_HK639: NinE; -; phage(gi356870663) 6e-15 Click
14572307..572597 PHAGE_Entero_mEp237: hypothetical protein; -; phage(gi435439317) 8e-49 Click
15572594..572956 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; -; phage(gi435439318) 5e-62 Click
16572953..573093 PHAGE_Entero_mEp237: hypothetical protein; -; phage(gi435439319) 1e-10 Click
17573179..573562 PHAGE_Entero_2008: antitermination protein Q; -; phage(gi209427762) 5e-56 Click
18complement(573960..574976) PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; -; phage(gi16131377) 0.0 Click
19576621..576836 PHAGE_Stx2_c_II: holin; -; phage(gi302393164) 1e-28 Click
20576836..577333 PHAGE_Entero_cdtI: lysin; -; phage(gi148609440) 3e-92 Click
21577330..577791 PHAGE_Entero_lambda: cell lysis protein; -; phage(gi9626310) 2e-79 Click
22577550..577732 PHAGE_Entero_lambda: Rz1 protein; -; phage(gi160338810) 1e-29 Click
23complement(577823..578116) PHAGE_Escher_TL_2011c: Bor protein precursor; -; phage(gi418487071) 2e-49 Click
24complement(578407..578817) PHAGE_Entero_lambda: putative envelope protein; -; phage(gi19263396) 7e-75 Click
25579103..579309 PHAGE_Entero_lambda: hypothetical protein lambdap79; -; phage(gi19263397) 1e-32 Click
26580057..580602 PHAGE_Entero_lambda: DNA packaging protein; -; phage(gi9626244) 1e-96 Click
27complement(581375..581959) predicted SAM-dependent methyltransferase; - 0.0 Click
28582098..582283 PHAGE_Entero_lambda: Putative fiber assembly protein; -; phage(gi9626269) 1e-05 Click
29585042..585053 attR    TTTTATGCTTTT 0.0 Click
30585280..585326 attR    CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT 0.0 Click

Region 3, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11200217..1200230 attL    ATTCATCTTATTTT 0.0 Click
2complement(1201256..1202383) PHAGE_Entero_mEp235: integrase; -; phage(gi428781836) 1e-58 Click
3complement(1202364..1202609) predicted excisionase; - 0.0 Click
4complement(1202646..1202957) hypothetical protein; - 0.0 Click
51203074..1203415 hypothetical protein; - 0.0 Click
6complement(1203353..1203661) PHAGE_Cronob_phiES15: hypothetical protein; -; phage(gi401817573) 2e-11 Click
7complement(1203836..1204510) PHAGE_Entero_SfV: repressor; -; phage(gi19549021) 5e-132 Click
81204601..1204801 PHAGE_Entero_SfV: repressor; -; phage(gi19549022) 7e-32 Click
91204833..1205402 PHAGE_Entero_SfV: hypothetical protein SfVp36; -; phage(gi19549023) 1e-91 Click
101205399..1205737 hypothetical protein; - 0.0 Click
111205747..1207114 PHAGE_Entero_SfV: large terminase subunit; -; phage(gi19548992) 0.0 Click
121207126..1207308 PHAGE_Salmon_ST64B: putative integral membrane protein; -; phage(gi23505448) 9e-29 Click
131207308..1207781 PHAGE_Salmon_ST64B: Portal Protein; -; phage(gi23505449) 2e-75 Click
141207837..1208499 PHAGE_Entero_SfV: tail protein; -; phage(gi19549009) 9e-122 Click
151208490..1209074 PHAGE_Entero_SfV: tail protein; -; phage(gi19548988) 1e-113 Click
161209078..1209707 PHAGE_Entero_SfV: hypothetical protein SfVp21; -; phage(gi19548989) 5e-54 Click
171209709..1210122 PHAGE_Entero_mEp213: tail fiber assembly protein; -; phage(gi428782612) 6e-24 Click
18complement(1210094..1210696) PHAGE_Entero_HK106: tail fiber assembly protein; -; phage(gi428783304) 3e-100 Click
191211262..1211816 PHAGE_Entero_2: DNA-invertase; -; phage(gi169936026) 8e-89 Click
201211923..1212756 PHAGE_Lactob_H: hypothetical protein; -; phage(gi148750872) 4e-05 Click
21complement(1213257..1213580) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; -; phage(gi209447168) 3e-42 Click
22complement(1214280..1214684) PHAGE_Entero_HK629: putative envelope protein; -; phage(gi428782079) 2e-29 Click
231218248..1218261 attR    ATTCATCTTATTTT 0.0 Click

Region 4, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11413683..1413694 attL    AAATGGGGCAAA 0.0 Click
2complement(1413714..1414949) PHAGE_Gifsy_2: bacteriophage integrase; -; phage(gi169257268) 2e-90 Click
3complement(1414951..1415166) hypothetical protein; - 0.0 Click
4complement(1415245..1415454) hypothetical protein; - 0.0 Click
5complement(1415447..1415641) restriction alleviation protein; - 0.0 Click
6complement(1415698..1416507) PHAGE_Entero_epsilon15: RecT; -; phage(gi30387413) 1e-81 Click
7complement(1419202..1419477) hypothetical protein; - 0.0 Click
8complement(1419552..1419722) PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; -; phage(gi169257274) 5e-06 Click
9complement(1419722..1419943) PHAGE_Escher_P13374: host killing protein; -; phage(gi410491620) 8e-06 Click
101420385..1420873 PHAGE_Entero_lambda: Superinfection exclusion protein B; -; phage(gi19263394) 1e-07 Click
11complement(1420870..1421025) PHAGE_Salico_CGphi29: hypothetical protein; -; phage(gi472340166) 7e-10 Click
12complement(1421036..1421170) hypothetical protein; - 0.0 Click
13complement(1421479..1421955) predicted DNA-binding transcriptional regulator; - 0.0 Click
141422079..1422375 PHAGE_Aggreg_S1249: phage protein; -; phage(gi273809591) 2e-14 Click
151422398..1422820 PHAGE_Entero_mEp237: CII protein; -; phage(gi435439306) 3e-08 Click
161422833..1423690 PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; -; phage(gi169257279) 9e-23 Click
171423697..1424443 PHAGE_Gifsy_2: bacteriophage DNA replication protein; -; phage(gi169257280) 2e-76 Click
181424466..1425026 predicted DNA-binding protein; - 0.0 Click
191425059..1425358 PHAGE_Entero_HK630: cell lysis protein Rz; -; phage(gi428782852) 4e-46 Click
201425114..1425299 PHAGE_Entero_HK630: Rz1 protein; -; phage(gi428782853) 7e-29 Click
211425496..1426953 potassium transporter subunit; - 0.0 Click
221427091..1427354 PHAGE_Psychr_pOW20_A: DNA methylase; -; phage(gi472339820) 5e-21 Click
231427335..1427694 hypothetical protein; - 0.0 Click
241428168..1429196 PHAGE_Escher_HK639: tail length tape measure protein; -; phage(gi356870615) 6e-27 Click
25complement(1429460..1430440) PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; -; phage(gi16131377) 0.0 Click
261430763..1434125 PHAGE_Entero_mEp460: side tail fiber protein; -; phage(gi428782336) 2e-149 Click
271434125..1434700 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; -; phage(gi16129505) 9e-109 Click
28complement(1434798..1435388) PHAGE_Escher_D108: G region invertase; -; phage(gi281199698) 7e-25 Click
291436526..1436537 attR    AAATGGGGCAAA 0.0 Click

Region 5, total : 39 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11621271..1621282 attL    AAAAAAGAGGTA 0.0 Click
21626406..1626418 attL    ATATGTTTGAAAA 0.0 Click
31630929..1631132 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; -; phage(gi410491512) 1e-13 Click
4complement(1631167..1632627) PHAGE_Microm_MpV1: hypothetical protein; -; phage(gi313768442) 1e-40 Click
5complement(1632716..1633999) PHAGE_Burkho_phi1026b: gp59; -; phage(gi38707949) 1e-33 Click
61634753..1635019 predicted DNA-binding transcriptional regulator; - 0.0 Click
71635336..1635926 PHAGE_Escher_D108: G region invertase; -; phage(gi281199698) 5e-25 Click
8complement(1636024..1636599) PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; -; phage(gi16129505) 2e-109 Click
9complement(1636599..1637561) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; -; phage(gi16129506) 0.0 Click
10complement(1637512..1638081) PHAGE_Entero_HK630: terminase small subunit nu1; -; phage(gi428782788) 3e-94 Click
111638470..1638703 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; -; phage(gi209427772) 7e-21 Click
121638761..1639171 PHAGE_Entero_HK629: putative envelope protein; -; phage(gi428782079) 2e-60 Click
13complement(1639323..1639496) hypothetical protein; - 0.0 Click
14complement(1639668..1639823) hypothetical protein; - 0.0 Click
15complement(1640169..1640381) PHAGE_Lactoc_bIL312: Csp; -; phage(gi13095918) 1e-15 Click
16complement(1640744..1641241) PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; -; phage(gi16765210) 2e-53 Click
17complement(1641238..1641771) PHAGE_Entero_mEp460: endolysin; -; phage(gi428782372) 2e-97 Click
18complement(1641768..1642079) PHAGE_Entero_mEp460: hypothetical protein; -; phage(gi428782371) 1e-29 Click
19complement(1642084..1642299) PHAGE_Entero_mEp460: porin; -; phage(gi428782370) 3e-33 Click
201642330..1642342 attR    ATATGTTTGAAAA 0.0 Click
21complement(1643053..1643268) PHAGE_Lactoc_bIL312: Csp; -; phage(gi13095918) 5e-16 Click
221643569..1643781 cold shock protein; - 0.0 Click
23complement(1644203..1644955) PHAGE_Entero_mEp460: late gene regulator; -; phage(gi428782366) 4e-137 Click
24complement(1644969..1646018) PHAGE_Entero_mEp460: hypothetical protein; -; phage(gi428782365) 5e-114 Click
25complement(1646365..1646616) hypothetical protein; - 0.0 Click
26complement(1646833..1646988) PHAGE_Stx2_c_II: putative host killer protein; -; phage(gi302393105) 3e-19 Click
27complement(1647060..1647347) toxin of the RelE-RelB toxin-antitoxin system; - 0.0 Click
28complement(1647347..1647586) bifunctional antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor; - 0.0 Click
291647611..1647916 hypothetical protein; - 0.0 Click
301648119..1648451 hypothetical protein; - 0.0 Click
31complement(1648888..1649037) hypothetical protein; - 0.0 Click
32complement(1649060..1649350) hypothetical protein; - 0.0 Click
33complement(1649334..1649564) PHAGE_Pectob_ZF40: putative cro anti-repressor; -; phage(gi422936651) 1e-08 Click
341649648..1650055 PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; -; phage(gi401817574) 5e-33 Click
351650222..1650377 PHAGE_Salico_CGphi29: hypothetical protein; -; phage(gi472340166) 2e-09 Click
361650379..1650507 hypothetical protein; - 0.0 Click
371650537..1650755 hypothetical protein; - 0.0 Click
381651323..1651511 cell division inhibition protein; - 0.0 Click
391651508..1651699 hypothetical protein; - 0.0 Click
401651792..1652712 hypothetical protein; - 0.0 Click
411652595..1653251 PROPHAGE_Escher_MG1655: IS2 transposase TnpB; -; phage(gi16130763) 1e-128 Click
421653226..1654422 PHAGE_Entero_2008: putative integrase; -; phage(gi209427727) 1e-135 Click
431654566..1654577 attR    AAAAAAGAGGTA 0.0 Click

Region 6, total : 17 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12471800..2471815 attL    TTGCAGGTTCGATTCC 0.0 Click
22471991..2473148 PROPHAGE_Escher_MG1655: CPS-53 (KpLE1) prophage; predicted prophage CPS-53 integrase; -; phage(gi16130281) 0.0 Click
32473301..2473663 PHAGE_Entero_SfV: putative flippase; -; phage(gi19549013) 1e-58 Click
42473660..2474580 PHAGE_Entero_SfV: bactoprenol glucosyltransferase; -; phage(gi19549012) 6e-163 Click
52474577..2475908 predicted inner membrane protein; - 0.0 Click
6complement(2476523..2476963) PHAGE_Entero_mEp213: tail fiber assembly protein; -; phage(gi428782612) 2e-26 Click
7complement(2476990..2477508) PHAGE_Entero_SfV: hypothetical protein SfVp21; -; phage(gi19548989) 2e-38 Click
8complement(2477558..2477833) PHAGE_Entero_SfV: DNA adenine methylase; -; phage(gi19549028) 2e-50 Click
9complement(2477833..2478327) PHAGE_Entero_SfV: hypothetical protein SfVp40; -; phage(gi19549027) 2e-87 Click
10complement(2478324..2478692) PHAGE_Entero_HK140: DNA replication protein O; -; phage(gi428781991) 3e-14 Click
112478966..2479412 PHAGE_Entero_SfV: hypothetical protein SfVp32; -; phage(gi19549019) 8e-63 Click
122479478..2480302 PHAGE_Entero_SfV: hypothetical protein SfVp31; -; phage(gi19549018) 3e-151 Click
132480430..2480966 PHAGE_Entero_SfV: hypothetical protein SfVp30; -; phage(gi19549017) 3e-99 Click
142480957..2481319 PHAGE_Entero_SfV: hypothetical protein SfVp29; -; phage(gi19549016) 5e-67 Click
152481319..2481624 PHAGE_Entero_SfV: hypothetical protein SfVp28; -; phage(gi19549015) 3e-52 Click
162481540..2481680 PHAGE_Entero_SfV: excisionase; -; phage(gi19548990) 2e-19 Click
172481721..2481736 attR    TTGCAGGTTCGATTCC 0.0 Click
182481756..2481956 PHAGE_Entero_HK633: hypothetical protein; -; phage(gi428782548) 3e-34 Click
19complement(2482140..2483075) PHAGE_Burkho_phi1026b: gp58; -; phage(gi38707948) 1e-15 Click