Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884 [asmbl_id: NC_000000].5280675, GC%: 57.23%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 52 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
19118..12084 PROPHAGE_Xantho_33913: Tn5041 transposase; HMPREF0484_0014; phage(gi21231545) 4e-28 Click
212114..12277 conserved hypothetical protein; HMPREF0484_0015 0.0 Click
312524..12751 PHAGE_Bacter_2: Q protein; HMPREF0484_0016; phage(gi212499710) 9e-08 Click
4complement(12814..12945) conserved hypothetical protein; HMPREF0484_0017 0.0 Click
513531..13779 conserved hypothetical protein; HMPREF0484_0018 0.0 Click
613782..14312 PHAGE_Escher_TL_2011c: lysozyme; HMPREF0484_0019; phage(gi418487070) 1e-81 Click
714309..14698 PHAGE_Entero_SfV: putative Rz lytic protein; HMPREF0484_0020; phage(gi19549038) 1e-27 Click
814865..15005 conserved hypothetical protein; HMPREF0484_0021 0.0 Click
915172..16118 PROPHAGE_Escher_CFT073: transposase; HMPREF0484_0022; phage(gi26249432) 2e-98 Click
1015870..15884 attL    GAACAGGCCATGGAG 0.0 Click
1116135..16311 PHAGE_Cronob_ENT47670: endodeoxyribonuclease RUS; HMPREF0484_0023; phage(gi431810529) 2e-14 Click
1216308..16448 PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; HMPREF0484_0024; phage(gi169257245) 1e-08 Click
1316445..17134 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; HMPREF0484_0025; phage(gi169257244) 4e-73 Click
1417318..17392 tRNA 0.0 Click
1517585..17899 PHAGE_Salmon_SPN3UB: hypothetical protein; HMPREF0484_0026; phage(gi423262443) 6e-47 Click
1617914..18405 PHAGE_Entero_HK225: lysozyme; HMPREF0484_0027; phage(gi428782444) 1e-74 Click
1718402..18869 PHAGE_Salmon_SE1: Gp15; HMPREF0484_0028; phage(gi219681237) 2e-60 Click
1818934..19179 PHAGE_Salmon_ST160: hypothetical protein; HMPREF0484_0029; phage(gi318065946) 3e-08 Click
1919314..19949 PHAGE_Cronob_ENT47670: putative transposase; HMPREF0484_0030; phage(gi431810514) 2e-86 Click
2019980..20447 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0031; phage(gi431810521) 4e-42 Click
2120431..21729 PHAGE_Salmon_SPN3UB: terminase large subunit; HMPREF0484_0032; phage(gi423262379) 0.0 Click
2221742..23211 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0033; phage(gi431810500) 4e-151 Click
2323243..24133 PHAGE_Cronob_ENT47670: phage head morphogenesis; HMPREF0484_0034; phage(gi431810507) 2e-116 Click
2424164..24433 conserved hypothetical protein; HMPREF0484_0035 0.0 Click
2524497..25678 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0036; phage(gi431810499) 1e-88 Click
2625682..26110 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0037; phage(gi431810525) 2e-42 Click
2726122..27306 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0038; phage(gi431810503) 3e-124 Click
2827309..27689 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0039; phage(gi431810531) 1e-31 Click
2927689..27859 PHAGE_Salmon_SPN3UB: hypothetical protein; HMPREF0484_0040; phage(gi423262387) 4e-12 Click
3027856..28203 PHAGE_Salmon_E1: hypothetical protein VIP0025; HMPREF0484_0041; phage(gi170676301) 1e-20 Click
3128206..28574 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0042; phage(gi431810532) 1e-50 Click
3228583..28960 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0043; phage(gi431810530) 9e-34 Click
3329029..29781 PHAGE_Cronob_ENT47670: major tail subunit; HMPREF0484_0044; phage(gi431810520) 6e-35 Click
3429834..30511 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0045; phage(gi431810508) 3e-75 Click
3530691..31446 PHAGE_Entero_mEpX1: hypothetical protein; HMPREF0484_0046; phage(gi428781933) 2e-61 Click
3631449..31706 PHAGE_Entero_mEpX2: hypothetical protein; HMPREF0484_0047; phage(gi428765677) 9e-32 Click
3731836..32033 conserved hypothetical protein; HMPREF0484_0048 0.0 Click
38complement(31990..32148) metallo-beta-lactamase; HMPREF0484_0049 0.0 Click
3932179..32475 conserved hypothetical protein; HMPREF0484_0050 0.0 Click
4032655..32867 PHAGE_Salmon_SPN3UB: hypothetical protein; HMPREF0484_0051; phage(gi423262402) 2e-16 Click
4132942..33457 conserved hypothetical protein; HMPREF0484_0052 0.0 Click
4233514..35529 PHAGE_Salmon_vB_SosS_Oslo: tail length tape-measure protein; HMPREF0484_0053; phage(gi399528779) 3e-94 Click
4335530..35926 PHAGE_Cronob_ENT47670: putative tail protein; HMPREF0484_0054; phage(gi431810494) 2e-08 Click
4435967..36134 hypothetical protein; HMPREF0484_0055 0.0 Click
45complement(36131..36301) ATP-NAD/AcoX kinase; HMPREF0484_0056 0.0 Click
4636399..36890 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0057; phage(gi431810519) 5e-42 Click
4736890..37360 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0058; phage(gi431810518) 3e-27 Click
4837357..37752 PHAGE_Cronob_ENT47670: hypothetical protein; HMPREF0484_0059; phage(gi431810526) 3e-37 Click
4937739..40216 PHAGE_Cronob_ENT47670: putative tail protein; HMPREF0484_0060; phage(gi431810495) 0.0 Click
5040301..41934 PHAGE_Entero_phiV10: putative tail fiber; HMPREF0484_0061; phage(gi89152445) 4e-13 Click
5141935..42118 conserved hypothetical protein; HMPREF0484_0062 0.0 Click
5242115..42237 conserved hypothetical protein; HMPREF0484_0063 0.0 Click
53complement(42561..43661) PHAGE_Entero_mEp460: integrase; HMPREF0484_0064; phage(gi428782338) 3e-105 Click
54complement(44077..44430) PROPHAGE_Escher_CFT073: insertion element IS2 transposase InsD; HMPREF0484_0065; phage(gi26249446) 6e-50 Click
5547992..48006 attR    GAACAGGCCATGGAG 0.0 Click

Region 2, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1432570..433811 PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; HMPREF0484_0476; phage(gi16130540) 2e-125 Click
2434005..434781 hypothetical protein; HMPREF0484_0477 0.0 Click
3435076..435285 conserved hypothetical protein; HMPREF0484_0478 0.0 Click
4435567..435716 conserved hypothetical protein; HMPREF0484_0479 0.0 Click
5435730..436332 PHAGE_Entero_N15: gp30; HMPREF0484_0480; phage(gi9630500) 2e-22 Click
6436332..436511 conserved hypothetical protein; HMPREF0484_0481 0.0 Click
7436508..437053 conserved hypothetical protein; HMPREF0484_0482 0.0 Click
8437050..438078 PHAGE_Entero_SfV: immunity region; HMPREF0484_0483; phage(gi19549024) 5e-16 Click
9438075..438389 ubiquinol-cytochrome c reductase cytochrome b subunit; HMPREF0484_0484 0.0 Click
10438386..438583 PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; HMPREF0484_0485; phage(gi169257169) 2e-11 Click
11438580..438801 PHAGE_Salmon_1: hypothetical protein STM0898.5n.Fels1; HMPREF0484_0486; phage(gi169257168) 2e-05 Click
12438825..439424 PHAGE_Entero_phiP27: hypothetical protein P27p06; HMPREF0484_0487; phage(gi18249870) 8e-24 Click
13439435..439785 conserved hypothetical protein; HMPREF0484_0488 0.0 Click
14439778..442558 PHAGE_Entero_P4: DNA primase; HMPREF0484_0489; phage(gi9627512) 6e-39 Click
15complement(442997..443213) PHAGE_Entero_phiV10: putative replication protein p; HMPREF0484_0490; phage(gi155370096) 5e-21 Click
16complement(443210..443485) PHAGE_Entero_epsilon15: putative DNA replication protein; HMPREF0484_0491; phage(gi30387421) 8e-07 Click
17complement(443569..443970) PHAGE_Marino_P12026: hypothetical protein; HMPREF0484_0492; phage(gi399528352) 5e-31 Click
18complement(443970..444179) PHAGE_Entero_epsilon15: hypothetical protein epsilon15p40; HMPREF0484_0493; phage(gi30387419) 2e-09 Click
19complement(444326..444559) PHAGE_Entero_epsilon15: hypothetical protein epsilon15p39; HMPREF0484_0494; phage(gi30387418) 4e-24 Click
20444713..445294 PHAGE_Entero_epsilon15: putative repressor; HMPREF0484_0495; phage(gi30387417) 3e-66 Click
21445554..445958 PHAGE_Entero_epsilon15: hypothetical protein epsilon15p36; HMPREF0484_0496; phage(gi30387415) 3e-22 Click
22445955..446854 PHAGE_Entero_epsilon15: hypothetical protein epsilon15p35; HMPREF0484_0497; phage(gi30387414) 3e-158 Click
23446971..447882 PHAGE_Entero_epsilon15: RecT; HMPREF0484_0498; phage(gi30387413) 1e-162 Click
24447933..448181 PHAGE_Entero_epsilon15: hypothetical protein epsilon15p33; HMPREF0484_0499; phage(gi30387412) 4e-31 Click
25448291..448584 PHAGE_Entero_epsilon15: hypothetical protein epsilon15p31; HMPREF0484_0500; phage(gi30387410) 6e-34 Click
26448577..448735 PHAGE_Salmon_SPN1S: hypothetical protein; HMPREF0484_0501; phage(gi374531225) 8e-19 Click
27448732..449325 PHAGE_Entero_epsilon15: adenine methylase; HMPREF0484_0502; phage(gi30387408) 8e-108 Click
28449322..449513 cell division initiation protein; HMPREF0484_0503 0.0 Click
29complement(449530..450780) PHAGE_Entero_epsilon15: integrase; HMPREF0484_0504; phage(gi30387406) 0.0 Click
30complement(450973..452550) GMP synthase; HMPREF0484_0505 0.0 Click
31complement(452618..454126) PHAGE_Staphy_42E: ORF012; HMPREF0484_0506; phage(gi66395520) 1e-31 Click

Region 3, total : 38 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1965345..965356 attL    ATAAATTCCACA 0.0 Click
2complement(966768..967088) PHAGE_Pseudo_vB_PaeS_PMG1: integrase; HMPREF0484_1044; phage(gi374531680) 7e-05 Click
3complement(967101..967757) PHAGE_Thermu_26: phage XerD-like integrase; HMPREF0484_1045; phage(gi157265417) 5e-06 Click
4complement(968162..971230) PHAGE_Pseudo_vB_PaeS_PMG1: putative tail protein; HMPREF0484_1046; phage(gi374531670) 7e-67 Click
5complement(971227..971607) PHAGE_Pseudo_phi297: hypothetical protein; HMPREF0484_1047; phage(gi374531303) 1e-18 Click
6complement(971617..972099) PHAGE_Pseudo_D3: Orf22; HMPREF0484_1048; phage(gi9635614) 1e-29 Click
7complement(972086..972559) PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp19; HMPREF0484_1049; phage(gi209552438) 2e-39 Click
8complement(972559..976098) PHAGE_Entero_mEp213: tail length tape measure protein; HMPREF0484_1050; phage(gi428782602) 1e-116 Click
9complement(976164..977087) PHAGE_Escher_TL_2011b: hypothetical protein; HMPREF0484_1051; phage(gi418487673) 1e-61 Click
10complement(977065..977226) toxin-antitoxin system; HMPREF0484_1052 0.0 Click
11977376..977744 PHAGE_Salmon_SPN3UB: Arc-like DNA binding domain protein; HMPREF0484_1053; phage(gi423262396) 4e-06 Click
12complement(977761..978264) hypothetical protein; HMPREF0484_1054 0.0 Click
13complement(978261..979289) PHAGE_Pseudo_phi297: putative DNA segregation ATPase; HMPREF0484_1055; phage(gi374531256) 1e-09 Click
14complement(979279..979809) PHAGE_Salmon_SE1: hypothetical protein SE1_gp47; HMPREF0484_1056; phage(gi219681238) 3e-59 Click
15complement(979986..980183) hypothetical protein; HMPREF0484_1057 0.0 Click
16complement(980321..980803) conserved hypothetical protein; HMPREF0484_1058 0.0 Click
17complement(980859..981875) PHAGE_Serrat_phiMAM1: putative phage tail fiber; HMPREF0484_1059; phage(gi440789465) 1e-10 Click
18complement(982055..982447) PHAGE_Acinet_Bphi_B1251: hypothetical protein; HMPREF0484_1060; phage(gi423262013) 1e-14 Click
19complement(982444..982995) PHAGE_Escher_HK639: hypothetical protein; HMPREF0484_1061; phage(gi356870610) 2e-29 Click
20complement(982997..983380) PHAGE_Acinet_Bphi_B1251: hypothetical protein; HMPREF0484_1062; phage(gi423262010) 7e-16 Click
21complement(983352..983648) conserved hypothetical protein; HMPREF0484_1063 0.0 Click
22complement(983650..984060) conserved hypothetical protein; HMPREF0484_1064 0.0 Click
23complement(984064..984276) PHAGE_Escher_HK639: hypothetical protein; HMPREF0484_1065; phage(gi356870607) 2e-12 Click
24complement(984316..985452) PHAGE_Escher_HK639: hypothetical protein; HMPREF0484_1066; phage(gi356870606) 1e-165 Click
25complement(985540..986304) PHAGE_Escher_HK639: hypothetical protein; HMPREF0484_1067; phage(gi356870605) 1e-96 Click
26complement(986409..987521) PHAGE_Escher_HK639: hypothetical protein; HMPREF0484_1068; phage(gi356870604) 1e-108 Click
27complement(987505..988929) PHAGE_Escher_HK639: hypothetical protein; HMPREF0484_1069; phage(gi356870603) 0.0 Click
28complement(988934..990238) PHAGE_Pseudo_H105/1: phage terminase large subunit; HMPREF0484_1070; phage(gi327198525) 6e-109 Click
29complement(990216..991220) PHAGE_Burkho_BcepMigl: terminase small subunit; HMPREF0484_1071; phage(gi431809885) 2e-47 Click
30complement(991224..991412) hypothetical protein; HMPREF0484_1072 0.0 Click
31complement(991471..991707) PHAGE_Salmon_ST160: hypothetical protein; HMPREF0484_1073; phage(gi318065946) 1e-09 Click
32complement(991793..991946) conserved hypothetical protein; HMPREF0484_1074 0.0 Click
33complement(991949..993820) PHAGE_Entero_c_1: hypothetical protein; HMPREF0484_1075; phage(gi428781787) 0.0 Click
34complement(993926..994900) PHAGE_Staphy_SpaA1: DnaD-like replication protein; HMPREF0484_1076; phage(gi399498903) 9e-32 Click
35complement(994927..995241) conserved hypothetical protein; HMPREF0484_1077 0.0 Click
36complement(995238..995426) conserved hypothetical protein; HMPREF0484_1078 0.0 Click
37complement(995524..995844) conserved hypothetical protein; HMPREF0484_1079 0.0 Click
38995868..996161 PHAGE_Burkho_Bcep176: gp17; HMPREF0484_1080; phage(gi77864642) 1e-07 Click
39996270..997253 PHAGE_Entero_phiP27: putative lambda repressor; HMPREF0484_1081; phage(gi18249875) 1e-81 Click
401001742..1001753 attR    ATAAATTCCACA 0.0 Click

Region 4, total : 32 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11068250..1068265 attL    CCAGCTGATTGTTTTC 0.0 Click
21080839..1082359 PROPHAGE_Escher_Sakai: putative ATP-dependent protease; HMPREF0484_1163; phage(gi15833954) 0.0 Click
3complement(1082384..1082722) YifE like protein; HMPREF0484_1164 0.0 Click
41082829..1083662 HTH-type transcriptional regulator HdfR; HMPREF0484_1165 0.0 Click
5complement(1083772..1083847) tRNA 0.0 Click
6complement(1084060..1084350) PHAGE_Cronob_phiES15: hypothetical protein; HMPREF0484_1166; phage(gi401817581) 6e-41 Click
7complement(1084343..1084513) PHAGE_Escher_HK639: NinE; HMPREF0484_1167; phage(gi356870663) 2e-13 Click
8complement(1084513..1084968) PHAGE_Cronob_phiES15: hypothetical protein; HMPREF0484_1168; phage(gi401817579) 6e-48 Click
9complement(1084965..1085087) conserved hypothetical protein; HMPREF0484_1169 0.0 Click
10complement(1085467..1086090) PHAGE_Entero_cdtI: Valyl-tRNA synthetase; HMPREF0484_1170; phage(gi148609417) 2e-14 Click
11complement(1086087..1086263) conserved hypothetical protein; HMPREF0484_1171 0.0 Click
12complement(1086263..1086475) potassium channel protein; HMPREF0484_1172 0.0 Click
13complement(1086453..1086809) lipoprotein; HMPREF0484_1173 0.0 Click
14complement(1086810..1087025) protein GrpE (HSP-70 cofactor); HMPREF0484_1174 0.0 Click
15complement(1087145..1087570) PHAGE_Entero_HK542: hypothetical protein; HMPREF0484_1175; phage(gi428783371) 1e-12 Click
16complement(1087567..1087860) PHAGE_Entero_933W: Ren protein; HMPREF0484_1176; phage(gi9632496) 5e-27 Click
17complement(1087857..1088726) PHAGE_Entero_mEpX1: putative replication protein DnaC; HMPREF0484_1177; phage(gi428781919) 2e-97 Click
18complement(1088711..1089601) PHAGE_Cronob_phiES15: putative replication protein O; HMPREF0484_1178; phage(gi401817576) 7e-42 Click
19complement(1089598..1090395) PHAGE_Salmon_E1: phage-related DNA-binding protein; HMPREF0484_1179; phage(gi170676297) 1e-53 Click
20complement(1090482..1090802) PHAGE_Gifsy_2: bacteriophage transcriptional activator; Lambda gpCII analog; HMPREF0484_1180; phage(gi169257278) 4e-38 Click
21complement(1090843..1091070) PHAGE_Escher_HK75: regulatory protein cro; HMPREF0484_1181; phage(gi356870715) 3e-17 Click
221091139..1091861 PHAGE_Salmon_ST160: C2; HMPREF0484_1182; phage(gi318065925) 1e-76 Click
231091901..1092164 PHAGE_Entero_HK225: hypothetical protein; HMPREF0484_1183; phage(gi428782419) 1e-16 Click
241092203..1092751 PHAGE_Entero_HK225: hypothetical protein; HMPREF0484_1184; phage(gi428782418) 1e-15 Click
251093126..1093356 PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp35; HMPREF0484_1185; phage(gi209552454) 5e-12 Click
26complement(1093549..1093797) conserved hypothetical protein; HMPREF0484_1186 0.0 Click
271093805..1094204 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip133; HMPREF0484_1187; phage(gi20065928) 4e-41 Click
281094201..1094971 PHAGE_Azospi_Cd: hypothetical protein APCd_gp13; HMPREF0484_1188; phage(gi168495116) 2e-35 Click
291094968..1095531 conserved hypothetical protein; HMPREF0484_1189 0.0 Click
301095524..1096135 PHAGE_Salmon_vB_SemP_Emek: Eaa1; HMPREF0484_1190; phage(gi399498822) 5e-44 Click
311096132..1096461 PHAGE_Cronob_phiES15: hypothetical protein; HMPREF0484_1191; phage(gi401817569) 6e-26 Click
321096714..1097001 PHAGE_Salmon_SPN3UB: excisionase-like protein; HMPREF0484_1192; phage(gi423262418) 4e-28 Click
33complement(1097151..1097375) nitrate/sulfonate/taurine/bicarbonate ABC superfamily ATP binding cassette transporter; HMPREF0484_1193 0.0 Click
34complement(1097535..1097681) hypothetical protein; HMPREF0484_1194 0.0 Click
35complement(1097798..1099027) PHAGE_Salmon_SPN3UB: putative integrase; HMPREF0484_1195; phage(gi423262417) 0.0 Click
361106112..1106127 attR    CCAGCTGATTGTTTTC 0.0 Click

Region 5, total : 34 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12531845..2532033 PHAGE_Salmon_RE_2010: hypothetical protein; HMPREF0484_2667; phage(gi418489693) 3e-25 Click
22532038..2532280 PHAGE_Salmon_RE_2010: SOS induction modulator; HMPREF0484_2668; phage(gi418489694) 2e-32 Click
32532356..2532613 PHAGE_Salmon_SSU5: hypothetical protein; HMPREF0484_2669; phage(gi410491513) 8e-17 Click
42532642..2532860 conserved hypothetical protein; HMPREF0484_2670 0.0 Click
52533065..2533652 PHAGE_Entero_mEp460: hypothetical protein; HMPREF0484_2671; phage(gi428782339) 8e-34 Click
62533732..2533911 conserved hypothetical protein; HMPREF0484_2672 0.0 Click
7complement(2533966..2534997) PHAGE_Salmon_RE_2010: capsid packaging protein; HMPREF0484_2673; phage(gi418489696) 3e-173 Click
8complement(2534997..2536760) PHAGE_Salmon_RE_2010: terminase ATPase subunit; HMPREF0484_2674; phage(gi418489697) 0.0 Click
92536901..2537734 PHAGE_Salmon_RE_2010: capsid scaffolding protein; HMPREF0484_2675; phage(gi418489698) 7e-118 Click
102537751..2538815 PHAGE_Salmon_RE_2010: major capsid protein; HMPREF0484_2676; phage(gi418489699) 0.0 Click
112538819..2539469 PHAGE_Salmon_RE_2010: terminase endonuclease subunit; HMPREF0484_2677; phage(gi418489700) 2e-104 Click
122539566..2540030 PHAGE_Salmon_RE_2010: head completion-stabilization protein; HMPREF0484_2678; phage(gi418489701) 6e-74 Click
132540030..2540233 PHAGE_Salmon_RE_2010: tail component protein; HMPREF0484_2679; phage(gi418489702) 1e-30 Click
142540237..2540452 PHAGE_Salmon_RE_2010: lysis protein S; HMPREF0484_2680; phage(gi418489703) 3e-32 Click
152540472..2540942 PHAGE_Salmon_RE_2010: lysozyme; HMPREF0484_2681; phage(gi418489704) 6e-75 Click
162540947..2541330 conserved hypothetical protein; HMPREF0484_2682 0.0 Click
172541327..2541755 PHAGE_Salmon_RE_2010: lysozyme subunit B; HMPREF0484_2683; phage(gi418489705) 3e-52 Click
182541851..2542282 PHAGE_Salmon_RE_2010: tail protein; HMPREF0484_2684; phage(gi418489706) 1e-64 Click
192542275..2542721 PHAGE_Salmon_RE_2010: tail completion protein; HMPREF0484_2685; phage(gi418489707) 4e-59 Click
202542790..2543362 PHAGE_Salmon_RE_2010: baseplate assembly protein V; HMPREF0484_2686; phage(gi418489709) 7e-80 Click
212543359..2543718 PHAGE_Salmon_RE_2010: baseplate wedge subunit; HMPREF0484_2687; phage(gi418489710) 9e-50 Click
222543705..2544613 PHAGE_Salmon_RE_2010: baseplate assembly protein J; HMPREF0484_2688; phage(gi418489711) 4e-117 Click
232544606..2545214 PHAGE_Salmon_RE_2010: tail protein I; HMPREF0484_2689; phage(gi418489712) 9e-60 Click
242545211..2547202 PHAGE_Burkho_BcepMu: gp52; HMPREF0484_2690; phage(gi48696962) 6e-05 Click
252547202..2548623 PHAGE_Rhodob_RcapMu: putative tail fiber protein; HMPREF0484_2691; phage(gi356870896) 1e-23 Click
262548636..2549673 PHAGE_Salmon_RE_2010: tail fiber protein; HMPREF0484_2692; phage(gi418489713) 1e-33 Click
272549812..2550984 PHAGE_Salmon_RE_2010: major tail sheath protein; HMPREF0484_2693; phage(gi418489720) 0.0 Click
282550994..2551509 PHAGE_Salmon_RE_2010: major tail tube protein; HMPREF0484_2694; phage(gi418489721) 1e-83 Click
292551562..2551861 PHAGE_Salmon_RE_2010: tail protein E; HMPREF0484_2695; phage(gi418489722) 1e-37 Click
302551876..2551995 PHAGE_Salmon_RE_2010: tail protein E'; HMPREF0484_2696; phage(gi418489723) 1e-14 Click
312551988..2554561 PHAGE_Salmon_RE_2010: tail tape measure protein; HMPREF0484_2697; phage(gi418489724) 2e-84 Click
322554608..2554853 PHAGE_Salmon_RE_2010: tail protein; HMPREF0484_2698; phage(gi418489725) 5e-36 Click
332554844..2555092 PHAGE_Salmon_RE_2010: tail protein; HMPREF0484_2699; phage(gi418489725) 8e-30 Click
342555089..2556186 PHAGE_Salmon_RE_2010: gene D protein; HMPREF0484_2700; phage(gi418489726) 7e-180 Click

Region 6, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13336811..3336833 attL    GTCCCCTTAGTTAAATGGATATA 0.0 Click
2complement(3336915..3337055) PHAGE_Salmon_SE2: p11.5 protein; HMPREF0484_3533; phage(gi375267258) 2e-06 Click
3complement(3337030..3337389) PHAGE_Salmon_SE2: hypothetical protein; HMPREF0484_3534; phage(gi375267257) 6e-14 Click
4complement(3337386..3337922) PHAGE_Entero_N15: gp54; HMPREF0484_3535; phage(gi9630497) 8e-83 Click
5complement(3337906..3338130) PHAGE_Escher_P13374: lysis protein, holin; HMPREF0484_3536; phage(gi410491645) 6e-23 Click
6complement(3338225..3338407) secretion protein HlyD; HMPREF0484_3537 0.0 Click
7complement(3338408..3340182) PHAGE_Entero_phiV10: putative tail fiber; HMPREF0484_3538; phage(gi89152445) 2e-51 Click
8complement(3340198..3341808) PHAGE_Erwini_vB_EamP_L1: terminase large subunit; HMPREF0484_3539; phage(gi422935571) 1e-13 Click
9complement(3341805..3342170) hypothetical protein; HMPREF0484_3540 0.0 Click
103342180..3342719 conserved hypothetical protein; HMPREF0484_3541 0.0 Click
11complement(3342716..3345610) PHAGE_Entero_vB_EcoP_ACG_C91: putative internal virion protein; HMPREF0484_3542; phage(gi414087618) 1e-16 Click
12complement(3345610..3348252) PHAGE_Entero_GJ1: putative tail fiber; HMPREF0484_3543; phage(gi161617977) 2e-10 Click
13complement(3348330..3348818) PHAGE_Salmon_SPN1S: hypothetical protein; HMPREF0484_3544; phage(gi374531207) 1e-11 Click
14complement(3348821..3349273) PHAGE_Entero_SP6: gp28; HMPREF0484_3545; phage(gi31711670) 4e-17 Click
15complement(3349273..3351267) PHAGE_Burkho_BcepC6B: hypothetical protein BcepC6B_gp12; HMPREF0484_3546; phage(gi48697202) 3e-78 Click
16complement(3351269..3351832) PHAGE_Vibrio_VP5: major tail subunit; HMPREF0484_3547; phage(gi48696686) 2e-11 Click
17complement(3351892..3352884) PHAGE_Pelagi_HTVC010P: putative major capsid protein; HMPREF0484_3548; phage(gi460042266) 7e-25 Click
18complement(3353020..3353868) PHAGE_Pelagi_HTVC010P: hypothetical protein; HMPREF0484_3549; phage(gi460042264) 3e-08 Click
19complement(3353855..3354088) conserved hypothetical protein; HMPREF0484_3550 0.0 Click
20complement(3354117..3355664) PHAGE_Pelagi_HTVC010P: head-tail connector protein; HMPREF0484_3551; phage(gi460042262) 1e-71 Click
21complement(3355668..3355916) hypothetical protein; HMPREF0484_3552 0.0 Click
22complement(3355903..3356301) conserved hypothetical protein; HMPREF0484_3553 0.0 Click
23complement(3356586..3356855) conserved hypothetical protein; HMPREF0484_3554 0.0 Click
24complement(3357146..3359335) PHAGE_Acyrth_1: hypothetical protein APSE-1_03; HMPREF0484_3555; phage(gi9633552) 3e-169 Click
25complement(3359339..3359551) PHAGE_Entero_HK633: prophage antirepressor; HMPREF0484_3556; phage(gi428782568) 3e-13 Click
263359672..3360295 PHAGE_Entero_HK446: prophage repressor; HMPREF0484_3557; phage(gi428782233) 8e-27 Click
273360822..3360971 hypothetical protein; HMPREF0484_3558 0.0 Click
283360971..3361570 PHAGE_Entero_ES18: gp53; HMPREF0484_3559; phage(gi62362266) 8e-47 Click
293361574..3362452 PHAGE_Acyrth_1: hypothetical protein APSE-1_53; HMPREF0484_3560; phage(gi9633600) 7e-10 Click
303362504..3363685 PHAGE_Acyrth_1: hypothetical protein APSE-1_51; HMPREF0484_3561; phage(gi9633598) 4e-127 Click
313363702..3364250 PHAGE_Acyrth_1: hypothetical protein APSE-1_50; HMPREF0484_3562; phage(gi9633597) 6e-46 Click
323364342..3365430 PHAGE_Acyrth_1: P45; HMPREF0484_3563; phage(gi9633592) 1e-115 Click
333365922..3366908 PHAGE_Acyrth_1: P45; HMPREF0484_3564; phage(gi9633592) 3e-102 Click
343366914..3367141 conserved hypothetical protein; HMPREF0484_3565 0.0 Click
353367172..3367522 sensor histidine kinase/response regulator; HMPREF0484_3566 0.0 Click
363367519..3367761 ABC superfamily ATP binding cassette transporter; HMPREF0484_3567 0.0 Click
373367758..3368027 PHAGE_Acyrth_1: hypothetical protein APSE-1_44; HMPREF0484_3568; phage(gi9633591) 5e-27 Click
383368024..3368254 PHAGE_Bacill_phBC6A51: hypothetical protein BC1874; HMPREF0484_3569; phage(gi31415768) 8e-09 Click
393368251..3368880 PHAGE_Bacill_phBC6A51: hypothetical protein BC1875; HMPREF0484_3570; phage(gi31415769) 8e-09 Click
403368883..3370277 PHAGE_Acyrth_1: hypothetical protein APSE-1_41; HMPREF0484_3571; phage(gi9633588) 0.0 Click
413370274..3370459 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp37; HMPREF0484_3572; phage(gi116222029) 3e-16 Click
42complement(3370443..3371693) PHAGE_Stx2_c_86: integrase; HMPREF0484_3573; phage(gi116222028) 0.0 Click
433371808..3371879 tRNA 0.0 Click
443371808..3371830 attR    GTCCCCTTAGTTAAATGGATATA 0.0 Click
453372044..3373204 PHAGE_Entero_HK633: integrase; HMPREF0484_3574; phage(gi428782545) 0.0 Click
46complement(3373177..3373386) PHAGE_Entero_HK225: hypothetical protein; HMPREF0484_3575; phage(gi428782404) 2e-10 Click

Region 7, total : 33 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13481043..3481588 PHAGE_Xylell_Xfas53: inner membrane protein; HMPREF0484_3677; phage(gi273810461) 2e-08 Click
23481833..3482648 PHAGE_Entero_phiV10: putative anti-immunity protein; HMPREF0484_3678; phage(gi89152443) 2e-63 Click
33482831..3483475 hypothetical protein; HMPREF0484_3679 0.0 Click
4complement(3483528..3484094) hypothetical protein; HMPREF0484_3680 0.0 Click
5complement(3484091..3484522) PHAGE_Entero_phiV10: hypothetical protein PhiV10p20; HMPREF0484_3681; phage(gi89152441) 2e-13 Click
6complement(3484512..3486638) PHAGE_Entero_phiV10: hypothetical protein PhiV10p20; HMPREF0484_3682; phage(gi89152441) 2e-26 Click
7complement(3486638..3488344) PHAGE_Pectob_PP1: putative internal virion protein 1; HMPREF0484_3683; phage(gi423262081) 1e-05 Click
8complement(3488346..3490967) PHAGE_Entero_phiV10: hypothetical structural protein; HMPREF0484_3684; phage(gi89152439) 5e-44 Click
9complement(3490978..3491520) PHAGE_Entero_phiV10: hypothetical protein PhiV10p17; HMPREF0484_3685; phage(gi89152438) 5e-63 Click
10complement(3491520..3491984) PHAGE_Entero_phiV10: hypothetical protein PhiV10p16; HMPREF0484_3686; phage(gi89152437) 2e-54 Click
11complement(3491984..3492859) PHAGE_Entero_phiV10: hypothetical protein PhiV10p15; HMPREF0484_3687; phage(gi89152436) 4e-135 Click
12complement(3492926..3494461) PHAGE_Entero_phiV10: hypothetical protein PhiV10p15; HMPREF0484_3688; phage(gi89152436) 0.0 Click
13complement(3494461..3495066) PHAGE_Entero_phiV10: hypothetical protein PhiV10p14; HMPREF0484_3689; phage(gi89152435) 1e-89 Click
14complement(3495066..3495389) PHAGE_Entero_phiV10: hypothetical protein PhiV10p13; HMPREF0484_3690; phage(gi89152434) 7e-47 Click
15complement(3495440..3495781) PHAGE_Entero_phiV10: hypothetical protein PhiV10p12; HMPREF0484_3691; phage(gi89152433) 9e-40 Click
16complement(3495792..3496235) PHAGE_Entero_phiV10: hypothetical protein PhiV10p11; HMPREF0484_3692; phage(gi89152432) 3e-66 Click
17complement(3496283..3497269) PHAGE_Entero_phiV10: hypothetical protein PhiV10p10; HMPREF0484_3693; phage(gi89152431) 2e-176 Click
18complement(3497284..3497973) PHAGE_Entero_phiV10: hypothetical protein PhiV10p09; HMPREF0484_3694; phage(gi89152430) 8e-92 Click
19complement(3497985..3498308) PHAGE_Salmon_SETP3: putative head protein; HMPREF0484_3695; phage(gi134288599) 4e-06 Click
20complement(3498305..3498604) PHAGE_Entero_phiV10: hypothetical protein PhiV10p08; HMPREF0484_3696; phage(gi89152429) 2e-32 Click
21complement(3498601..3500283) PHAGE_Entero_phiV10: putative head-to-tail-joining protein; HMPREF0484_3697; phage(gi89152428) 0.0 Click
22complement(3500298..3500504) PHAGE_Entero_phiV10: hypothetical protein PhiV10p06; HMPREF0484_3698; phage(gi89152427) 7e-29 Click
233500940..3501016 tRNA 0.0 Click
243501060..3501215 GTP pyrophosphokinase; HMPREF0484_3699 0.0 Click
25complement(3501227..3502702) PHAGE_Entero_phiV10: putative terminase large subunit; HMPREF0484_3700; phage(gi89152423) 0.0 Click
26complement(3502699..3503283) PHAGE_Entero_phiV10: putative terminase small subunit; HMPREF0484_3701; phage(gi155370097) 2e-90 Click
27complement(3503341..3503535) PHAGE_Entero_phiV10: hypothetical protein PhiV10p55; HMPREF0484_3702; phage(gi89152469) 3e-07 Click
28complement(3503746..3504675) PHAGE_Pseudo_phi297: hypothetical protein; HMPREF0484_3703; phage(gi374531246) 1e-10 Click
29complement(3504672..3504884) PHAGE_Entero_phiV10: hypothetical protein PhiV10p52; HMPREF0484_3704; phage(gi89152466) 9e-13 Click
30complement(3504884..3505363) RelE family toxin-antitoxin system; HMPREF0484_3705 0.0 Click
31complement(3505375..3505842) PHAGE_Edward_MSW_3: hypothetical protein; HMPREF0484_3706; phage(gi448261045) 3e-09 Click
32complement(3505839..3505973) hypothetical protein; HMPREF0484_3707 0.0 Click
33complement(3506035..3506379) PHAGE_Entero_phiV10: hypothetical protein PhiV10p45; HMPREF0484_3708; phage(gi89152461) 3e-53 Click
34complement(3506499..3507069) PHAGE_Entero_phiV10: putative replication protein p; HMPREF0484_3709; phage(gi155370096) 7e-103 Click

Region 8, total : 61 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13555790..3555848 attL    TGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACC 0.0 Click
23556317..3556790 PHAGE_Entero_vB_KleM_RaK2: putative structural protein; HMPREF0484_3762; phage(gi422937418) 1e-09 Click
3complement(3556819..3557025) conserved hypothetical protein; HMPREF0484_3763 0.0 Click
4complement(3557025..3559460) PHAGE_Entero_phiV10: putative tail fiber; HMPREF0484_3764; phage(gi89152445) 8e-58 Click
5complement(3559563..3559790) conserved hypothetical protein; HMPREF0484_3765 0.0 Click
6complement(3559932..3560228) conserved hypothetical protein; HMPREF0484_3766 0.0 Click
7complement(3560225..3560569) PHAGE_Pseudo_vB_Pae_Kakheti25: holin; HMPREF0484_3767; phage(gi388542661) 8e-12 Click
8complement(3560566..3561105) PHAGE_Erwini_vB_EamP_S6: endolysin; HMPREF0484_3768; phage(gi422935930) 2e-59 Click
9complement(3561110..3561325) PHAGE_Escher_P13374: lysis protein, holin; HMPREF0484_3769; phage(gi410491645) 9e-13 Click
103561294..3561428 hypothetical protein; HMPREF0484_3770 0.0 Click
11complement(3561855..3562640) PHAGE_Stx2_c_II: putative antirepressor-like protein; HMPREF0484_3771; phage(gi302393152) 5e-36 Click
123562981..3563271 PHAGE_Burkho_2: gp7, putative addiction module killer protein; HMPREF0484_3772; phage(gi134288691) 7e-24 Click
133563280..3563573 PHAGE_Burkho_2: gp6, putative addiction module antidote protein; HMPREF0484_3773; phage(gi134288715) 6e-17 Click
143563685..3564323 conserved hypothetical protein; HMPREF0484_3774 0.0 Click
153564387..3564599 cell division protein FtsW; HMPREF0484_3775 0.0 Click
16complement(3564600..3567524) PHAGE_Salmon_SPN1S: hypothetical protein; HMPREF0484_3776; phage(gi374531210) 4e-43 Click
17complement(3567524..3568843) PHAGE_Vibrio_VP5: hypothetical protein VP5_gp17; HMPREF0484_3777; phage(gi50282963) 2e-05 Click
18complement(3569044..3569214) primosomal replication factor N; HMPREF0484_3778 0.0 Click
19complement(3569214..3571928) PHAGE_Pseudo_AF: putative structural lysozyme; HMPREF0484_3779; phage(gi431810307) 8e-35 Click
20complement(3571929..3572270) conserved hypothetical protein; HMPREF0484_3780 0.0 Click
21complement(3572381..3572878) PHAGE_Burkho_BcepC6B: hypothetical protein BcepC6B_gp14; HMPREF0484_3781; phage(gi48697204) 2e-07 Click
22complement(3572882..3573313) conserved hypothetical protein; HMPREF0484_3782 0.0 Click
23complement(3573313..3573600) conserved hypothetical protein; HMPREF0484_3783 0.0 Click
24complement(3573597..3573998) conserved hypothetical protein; HMPREF0484_3784 0.0 Click
25complement(3573991..3576267) PHAGE_Burkho_BcepC6B: hypothetical protein BcepC6B_gp12; HMPREF0484_3785; phage(gi48697202) 5e-113 Click
26complement(3576267..3576875) PHAGE_Burkho_BcepC6B: hypothetical protein BcepC6B_gp11; HMPREF0484_3786; phage(gi48697201) 2e-26 Click
27complement(3576933..3577406) PHAGE_Pseudo_AF: hypothetical protein; HMPREF0484_3787; phage(gi431810301) 2e-28 Click
28complement(3577445..3578440) PHAGE_Pseudo_AF: putative major capsid protein; HMPREF0484_3788; phage(gi431810300) 4e-103 Click
29complement(3578451..3579176) PHAGE_Entero_epsilon15: putative endoprotease; HMPREF0484_3789; phage(gi30387385) 7e-18 Click
30complement(3579163..3579489) small GTP-binding protein domain:GTP-binding protein Era; HMPREF0484_3790 0.0 Click
31complement(3579489..3581153) PHAGE_Pelagi_HTVC010P: head-tail connector protein; HMPREF0484_3791; phage(gi460042262) 3e-81 Click
32complement(3581153..3582547) PHAGE_Pelagi_HTVC010P: phage terminase large subunit; HMPREF0484_3792; phage(gi460042259) 2e-64 Click
33complement(3582632..3583084) PHAGE_Salmon_SPN9CC: terminase small subunit; HMPREF0484_3793; phage(gi389060536) 1e-50 Click
34complement(3583091..3583351) spermidine/putrescine ABC superfamily ATP binding cassette transporter, binding protein; HMPREF0484_3794 0.0 Click
35complement(3583335..3583568) phenylalanyl-tRNA synthetase subunit beta chain; HMPREF0484_3795 0.0 Click
36complement(3583565..3583921) enterotoxin type H; HMPREF0484_3796 0.0 Click
37complement(3584204..3584701) PHAGE_Brucel_Tb: putative DNA-binding protein; HMPREF0484_3797; phage(gi418487736) 8e-22 Click
38complement(3584691..3585284) PHAGE_Pectob_ZF40: hypothetical protein; HMPREF0484_3798; phage(gi422936663) 1e-80 Click
39complement(3585353..3585544) conserved hypothetical protein; HMPREF0484_3799 0.0 Click
40complement(3585727..3586065) PHAGE_Pectob_ZF40: hypothetical protein; HMPREF0484_3800; phage(gi422936662) 5e-37 Click
41complement(3586078..3586695) PHAGE_Bacill_phBC6A51: hypothetical protein BC1875; HMPREF0484_3801; phage(gi31415769) 1e-07 Click
42complement(3586692..3586922) PHAGE_Bacill_phBC6A51: hypothetical protein BC1874; HMPREF0484_3802; phage(gi31415768) 6e-09 Click
43complement(3586925..3587515) PHAGE_Entero_phiV10: putative adenine methylase; HMPREF0484_3803; phage(gi89152451) 4e-95 Click
44complement(3587512..3587646) conserved hypothetical protein; HMPREF0484_3804 0.0 Click
45complement(3587643..3588428) PHAGE_Burkho_2: gp57; HMPREF0484_3805; phage(gi134288621) 6e-68 Click
46complement(3588468..3588701) PHAGE_Pectob_ZF40: hypothetical protein; HMPREF0484_3806; phage(gi422936657) 7e-13 Click
47complement(3588705..3589124) PHAGE_Pectob_ZF40: hypothetical protein; HMPREF0484_3807; phage(gi422936656) 5e-13 Click
48complement(3589394..3590782) PHAGE_Entero_ST104: gp12; HMPREF0484_3808; phage(gi46358676) 2e-109 Click
49complement(3590779..3591786) PHAGE_Pectob_ZF40: putative replication protein; HMPREF0484_3809; phage(gi422936654) 2e-51 Click
50complement(3591789..3592010) PHAGE_Pectob_ZF40: hypothetical protein; HMPREF0484_3810; phage(gi422936653) 4e-18 Click
51complement(3592031..3592477) PHAGE_Pectob_ZF40: putative cII repressor; HMPREF0484_3811; phage(gi422936652) 2e-33 Click
52complement(3592538..3592771) conserved hypothetical protein; HMPREF0484_3812 0.0 Click
533592871..3593335 PHAGE_Pseudo_F116: transcriptional regulator; HMPREF0484_3813; phage(gi56692918) 7e-11 Click
54complement(3593348..3593467) hypothetical protein; HMPREF0484_3814 0.0 Click
553594341..3594574 conserved hypothetical protein; HMPREF0484_3815 0.0 Click
563594619..3596802 PHAGE_Pectob_ZF40: putative exonuclease; HMPREF0484_3816; phage(gi422936647) 1e-106 Click
573596802..3597362 PHAGE_Pectob_ZF40: hypothetical protein; HMPREF0484_3817; phage(gi422936646) 7e-53 Click
583597364..3597549 PHAGE_Pectob_ZF40: hypothetical protein; HMPREF0484_3818; phage(gi422936645) 2e-08 Click
593597759..3597983 PHAGE_Pectob_ZF40: hypothetical protein; HMPREF0484_3819; phage(gi422936643) 7e-21 Click
603598107..3599015 PHAGE_Pectob_ZF40: putative integrase; HMPREF0484_3820; phage(gi422936642) 1e-72 Click
61complement(3599084..3599171) tRNA 0.0 Click
623599084..3599142 attR    TGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACC 0.0 Click
63complement(3599291..3600517) oligopeptide ABC superfamily ATP binding cassette transporter, binding protein; HMPREF0484_3821 0.0 Click
64complement(3600617..3600943) oligopeptide ABC superfamily ATP binding cassette transporter, binding protein; HMPREF0484_3822 0.0 Click
653601213..3601872 PHAGE_Camelp_virus: CMLV006; HMPREF0484_3823; phage(gi18640240) 6e-10 Click

Region 9, total : 31 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13625123..3625374 PHAGE_Entero_P1: InsA; HMPREF0484_3847; phage(gi46401643) 3e-18 Click
2complement(3625511..3627465) transketolase; HMPREF0484_3848 0.0 Click
3complement(3627592..3627852) PHAGE_Entero_mEp460: hypothetical protein; HMPREF0484_3849; phage(gi428782341) 7e-19 Click
4complement(3627860..3628006) PHAGE_Salmon_1: hypothetical protein STM0895.1n.Fels1; HMPREF0484_3850; phage(gi169257158) 1e-19 Click
5complement(3627990..3628157) PHAGE_Escher_HK639: hypothetical protein; HMPREF0484_3851; phage(gi356870633) 1e-11 Click
6complement(3628491..3628709) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; HMPREF0484_3852; phage(gi20065893) 1e-11 Click
7complement(3628706..3629105) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip133; HMPREF0484_3853; phage(gi20065928) 6e-42 Click
8complement(3629106..3629815) PHAGE_Entero_HK630: Bet protein; HMPREF0484_3854; phage(gi428782823) 4e-62 Click
9complement(3629853..3630137) PHAGE_Escher_HK639: hypothetical protein; HMPREF0484_3855; phage(gi356870640) 6e-33 Click
10complement(3630218..3630424) PHAGE_Entero_mEp237: Kil protein; HMPREF0484_3856; phage(gi435439298) 1e-27 Click
11complement(3630417..3630542) conserved hypothetical protein; HMPREF0484_3857 0.0 Click
123630852..3631055 conserved hypothetical protein; HMPREF0484_3858 0.0 Click
13complement(3631132..3632556) conserved hypothetical protein; HMPREF0484_3859 0.0 Click
14complement(3632698..3633408) PHAGE_Entero_HK140: prophage repressor; HMPREF0484_3860; phage(gi428781988) 3e-99 Click
153633513..3633704 PHAGE_Escher_TL_2011c: hypothetical protein; HMPREF0484_3861; phage(gi418487091) 2e-11 Click
163633784..3634104 PHAGE_Gifsy_2: bacteriophage transcriptional activator; Lambda gpCII analog; HMPREF0484_3862; phage(gi169257278) 1e-37 Click
173634191..3634337 conserved hypothetical protein; HMPREF0484_3863 0.0 Click
183634378..3635415 PHAGE_Erwini_phiEt88: phage replication protein O; HMPREF0484_3864; phage(gi327198609) 2e-89 Click
193635412..3636785 PHAGE_Erwini_phiEt88: Replicative DNA helicase; HMPREF0484_3865; phage(gi327198610) 7e-170 Click
203636775..3637089 PHAGE_Entero_933W: Ren protein; HMPREF0484_3866; phage(gi9632496) 1e-19 Click
213637086..3637520 PHAGE_Edward_MSW_3: hypothetical protein; HMPREF0484_3867; phage(gi448261045) 6e-09 Click
223637517..3637914 conserved hypothetical protein; HMPREF0484_3868 0.0 Click
233637915..3638506 PHAGE_Entero_cdtI: Valyl-tRNA synthetase; HMPREF0484_3869; phage(gi148609417) 2e-12 Click
24complement(3638503..3638664) conserved hypothetical protein; HMPREF0484_3870 0.0 Click
253638665..3639261 PHAGE_Entero_mEp237: hypothetical protein; HMPREF0484_3871; phage(gi435439315) 6e-48 Click
263639324..3639467 PHAGE_Entero_mEp237: hypothetical protein; HMPREF0484_3872; phage(gi435439316) 2e-05 Click
273639470..3639760 PHAGE_Entero_mEp237: hypothetical protein; HMPREF0484_3873; phage(gi435439317) 2e-47 Click
283639757..3639926 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; HMPREF0484_3874; phage(gi435439318) 7e-24 Click
293640222..3641838 PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; HMPREF0484_3875; phage(gi61806062) 3e-72 Click
303641854..3643149 phosphoribosylamine-glycine ligase; HMPREF0484_3876 0.0 Click
31complement(3643139..3644488) PHAGE_Ectoca_1: EsV-1-65; HMPREF0484_3877; phage(gi13242537) 9e-10 Click
32complement(3644457..3645002) PHAGE_Ectoca_1: EsV-1-65; HMPREF0484_3878; phage(gi13242537) 2e-09 Click

Region 10, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13674717..3674728 attL    GAACCCCACCCA 0.0 Click
2complement(3680475..3681161) PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF0484_3916; phage(gi371496158) 2e-33 Click
33681162..3681347 protease I; HMPREF0484_3917 0.0 Click
4complement(3681469..3681597) type IV secretory pathway; HMPREF0484_3918 0.0 Click
5complement(3681652..3682020) conserved hypothetical protein; HMPREF0484_3919 0.0 Click
63682019..3682196 conserved hypothetical protein; HMPREF0484_3920 0.0 Click
73682197..3682652 ABC superfamily ATP binding cassette transporter, membrane protein; HMPREF0484_3921 0.0 Click
83682652..3683002 PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF0484_3922; phage(gi371496158) 2e-06 Click
93683003..3683873 CPA1 family monovalent cation:proton (H+) antiporter-1; HMPREF0484_3923 0.0 Click
103683874..3685012 PHAGE_Megavi_lba: putative cholinesterase; HMPREF0484_3924; phage(gi448825996) 6e-23 Click
113685129..3685341 PHAGE_Entero_mEp234: prophage repressor; HMPREF0484_3925; phage(gi428782293) 4e-37 Click
123685454..3685682 PHAGE_Entero_lambda: exclusion protein; HMPREF0484_3926; phage(gi9626291) 2e-38 Click
133685683..3686412 tetracycline resistance protein; HMPREF0484_3927 0.0 Click
14complement(3686493..3687062) PHAGE_Escher_D108: G region invertase; HMPREF0484_3928; phage(gi281199698) 6e-62 Click
15complement(3687047..3688117) ShiA-like protein; HMPREF0484_3929 0.0 Click
16complement(3688345..3688755) PHAGE_Salmon_1: hypothetical protein STM0895.Fels1; HMPREF0484_3930; phage(gi169257160) 6e-20 Click
17complement(3688752..3688907) conserved hypothetical protein; HMPREF0484_3931 0.0 Click
18complement(3688961..3689185) PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; HMPREF0484_3932; phage(gi169257161) 2e-21 Click
19complement(3689182..3689307) conserved hypothetical protein; HMPREF0484_3933 0.0 Click
20complement(3689291..3689728) conserved hypothetical protein; HMPREF0484_3934 0.0 Click
21complement(3689718..3690440) PHAGE_Entero_phiP27: hypothetical protein P27p14; HMPREF0484_3935; phage(gi18249878) 2e-84 Click
22complement(3690446..3691024) PHAGE_Entero_phiP27: hypothetical protein P27p06; HMPREF0484_3936; phage(gi18249870) 7e-46 Click
23complement(3691005..3691445) PHAGE_Salmon_1: hypothetical protein STM0898.1n.Fels1; HMPREF0484_3937; phage(gi169257164) 7e-45 Click
24complement(3691442..3691564) conserved hypothetical protein; HMPREF0484_3938 0.0 Click
25complement(3691632..3691796) PHAGE_Entero_phiP27: hypothetical protein P27p07; HMPREF0484_3939; phage(gi18249871) 3e-09 Click
26complement(3691836..3692123) hypothetical protein; HMPREF0484_3940 0.0 Click
27complement(3692164..3692295) PHAGE_Salmon_1: hypothetical protein STM0898.4n.Fels1; HMPREF0484_3941; phage(gi169257167) 2e-08 Click
28complement(3692580..3692972) hypothetical protein; HMPREF0484_3942 0.0 Click
29complement(3692969..3693175) conserved hypothetical protein; HMPREF0484_3943 0.0 Click
303693177..3693352 conserved hypothetical protein; HMPREF0484_3944 0.0 Click
31complement(3693490..3696075) PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; HMPREF0484_3945; phage(gi15800640) 2e-77 Click
323698326..3698337 attR    GAACCCCACCCA 0.0 Click

Region 11, total : 34 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14407172..4407184 attL    GCGCCTTCAGCGC 0.0 Click
2complement(4407506..4408054) PHAGE_Entero_P1: Cin; HMPREF0484_4754; phage(gi46401653) 4e-63 Click
34408145..4409692 PHAGE_Vibrio_VvAW1: hypothetical protein; HMPREF0484_4755; phage(gi460042927) 2e-05 Click
44409705..4410379 conserved hypothetical protein; HMPREF0484_4756 0.0 Click
54410372..4411670 conserved hypothetical protein; HMPREF0484_4757 0.0 Click
6complement(4411768..4413168) PHAGE_Rhodob_RcapMu: putative tail fiber protein; HMPREF0484_4758; phage(gi356870896) 5e-27 Click
7complement(4413170..4413301) DNA-binding protein HU; HMPREF0484_4759 0.0 Click
8complement(4413298..4415289) conserved hypothetical protein; HMPREF0484_4760 0.0 Click
9complement(4415366..4418434) PHAGE_Pseudo_vB_PaeS_PMG1: putative tail protein; HMPREF0484_4761; phage(gi374531670) 2e-66 Click
10complement(4418431..4418811) PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; HMPREF0484_4762; phage(gi374531669) 8e-19 Click
11complement(4418819..4419301) PHAGE_Pseudo_D3: Orf22; HMPREF0484_4763; phage(gi9635614) 5e-29 Click
12complement(4419288..4419767) PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp19; HMPREF0484_4764; phage(gi209552438) 1e-35 Click
13complement(4419767..4422214) PHAGE_Entero_mEpX2: tail length tape measure protein; HMPREF0484_4765; phage(gi428765628) 3e-162 Click
14complement(4422259..4422726) PHAGE_Cronob_phiES15: hypothetical protein; HMPREF0484_4766; phage(gi401817606) 8e-08 Click
15complement(4422792..4423055) PHAGE_Entero_mEpX2: hypothetical protein; HMPREF0484_4767; phage(gi428765627) 5e-09 Click
16complement(4423088..4423441) PHAGE_Entero_mEpX2: tail assembly chaperone; HMPREF0484_4768; phage(gi428765626) 1e-37 Click
17complement(4423485..4423976) PHAGE_Entero_mEpX2: major tail subunit; HMPREF0484_4769; phage(gi428765625) 7e-63 Click
18complement(4424033..4424398) PHAGE_Entero_mEpX2: hypothetical protein; HMPREF0484_4770; phage(gi428765624) 4e-50 Click
19complement(4424395..4424934) PHAGE_Entero_mEpX2: hypothetical protein; HMPREF0484_4771; phage(gi428765623) 6e-81 Click
20complement(4424927..4425259) PHAGE_Entero_mEpX2: hypothetical protein; HMPREF0484_4772; phage(gi428765622) 2e-51 Click
21complement(4425261..4425458) PHAGE_Entero_mEpX2: hypothetical protein; HMPREF0484_4773; phage(gi428765621) 4e-24 Click
22complement(4425520..4425912) PHAGE_Entero_mEp235: head-tail connector II; HMPREF0484_4774; phage(gi428781817) 1e-11 Click
23complement(4426073..4427230) PHAGE_Entero_mEpX2: major head subunit; HMPREF0484_4775; phage(gi428765618) 4e-153 Click
24complement(4427242..4427760) PHAGE_Entero_mEpX2: head maturation protease; HMPREF0484_4776; phage(gi428765617) 4e-60 Click
25complement(4427928..4429205) PHAGE_Entero_HK140: portal protein; HMPREF0484_4777; phage(gi428781942) 0.0 Click
26complement(4429208..4430740) PHAGE_Entero_mEpX2: terminase large subunit; HMPREF0484_4778; phage(gi428765615) 1e-115 Click
27complement(4430750..4431184) PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp01; HMPREF0484_4779; phage(gi209552420) 1e-26 Click
28complement(4431398..4431688) PHAGE_Rhizob_3: holin; HMPREF0484_4780; phage(gi195546640) 5e-21 Click
29complement(4431697..4432011) conserved hypothetical protein; HMPREF0484_4781 0.0 Click
30complement(4432173..4432418) PHAGE_Salmon_ST160: hypothetical protein; HMPREF0484_4782; phage(gi318065946) 5e-09 Click
31complement(4432504..4432663) conserved hypothetical protein; HMPREF0484_4783 0.0 Click
32complement(4432666..4434537) PHAGE_Salmon_vB_SosS_Oslo: DNA primase/helicase; HMPREF0484_4784; phage(gi399528819) 0.0 Click
33complement(4434641..4435558) PHAGE_Entero_phiP27: hypothetical protein P27p17; HMPREF0484_4785; phage(gi18249881) 3e-50 Click
344435820..4436071 conserved hypothetical protein; HMPREF0484_4786 0.0 Click
354436510..4437229 PHAGE_Erwini_phiEt88: phage repressor protein; HMPREF0484_4787; phage(gi327198606) 5e-65 Click
364446580..4446592 attR    GCGCCTTCAGCGC 0.0 Click