Escherichia coli O157:H7 str. FRIK966 , whole [asmbl_id: NC_000000].5376914, GC%: 50.24%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 44 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11734183..1734194 attL    CTGATTTTTATA 0.0 Click
21742985..1743031 attL    ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT 0.0 Click
3complement(1743045..1744208) PHAGE_Entero_SfV: integrase; PP_01760; phage(gi19549014) 0.0 Click
4complement(1744435..1744740) PHAGE_Entero_SfV: hypothetical protein SfVp28; PP_01761; phage(gi19549015) 1e-53 Click
5complement(1744740..1744913) PHAGE_Entero_SfV: hypothetical protein SfVp29; PP_01762; phage(gi19549016) 7e-32 Click
61745316..1745561 hypothetical; PP_01763 0.0 Click
7complement(1746031..1746678) PHAGE_Entero_mEp460: prophage repressor; PP_01764; phage(gi428782354) 9e-114 Click
81746821..1747081 PHAGE_Entero_mEp460: putative antirepressor Cro; PP_01765; phage(gi428782355) 2e-42 Click
91747074..1747625 PHAGE_Entero_SfV: hypothetical protein SfVp36; PP_01766; phage(gi19549023) 4e-93 Click
101747970..1748911 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_01767; phage(gi18249881) 1e-40 Click
111749001..1749810 PHAGE_Entero_SfV: hypothetical protein SfVp44; PP_01768; phage(gi19549031) 1e-127 Click
121750986..1751192 hypothetical; PP_01769 0.0 Click
131751642..1751764 PHAGE_Entero_SfV: hypothetical protein SfVp48; PP_01770; phage(gi19549035) 2e-14 Click
141751805..1752236 PHAGE_Entero_SfV: holin; PP_01771; phage(gi19549036) 1e-61 Click
151752240..1752716 PHAGE_Escher_HK75: lysozyme; PP_01772; phage(gi356870730) 6e-86 Click
161752713..1753000 PHAGE_Entero_HK630: cell lysis protein Rz; PP_01773; phage(gi428782852) 4e-40 Click
17complement(1752992..1753285) PHAGE_Entero_HK630: Bor protein; PP_01774; phage(gi428782854) 1e-46 Click
181754012..1754161 PHAGE_Entero_SfV: hypothetical protein SfVp53; PP_01775; phage(gi19549040) 2e-23 Click
191754287..1754781 PHAGE_Entero_SfV: small terminase subunit; PP_01776; phage(gi19548991) 5e-91 Click
201754778..1756511 PHAGE_Entero_SfV: large terminase subunit; PP_01777; phage(gi19548992) 0.0 Click
211756508..1756669 hypothetical protein APECO78_03170 [Escherichia coli APEC O78] gi|443615961|ref|YP_007379817.1|; PP_01778 3e-18 Click
221756782..1757885 PHAGE_Entero_SfV: portal protein; PP_01779; phage(gi19548993) 0.0 Click
231757878..1758480 PHAGE_Entero_SfV: capsid protease; PP_01780; phage(gi19548994) 3e-112 Click
241758491..1759720 PHAGE_Entero_SfV: capsid; PP_01781; phage(gi19548995) 0.0 Click
251759799..1760122 PHAGE_Entero_SfV: hypothetical protein SfVp06; PP_01782; phage(gi19548996) 9e-56 Click
261760119..1760529 PHAGE_Entero_SfV: hypothetical protein SfVp07; PP_01783; phage(gi19548997) 1e-46 Click
271760504..1761010 PHAGE_Entero_SfV: hypothetical protein SfVp08; PP_01784; phage(gi19548998) 2e-88 Click
281761007..1761567 PHAGE_Entero_SfV: hypothetical protein SfVp09; PP_01785; phage(gi19548999) 2e-104 Click
291761576..1761746 PHAGE_Entero_SfV: hypothetical protein SfVp10; PP_01786; phage(gi19549000) 1e-27 Click
301761730..1763226 PHAGE_Entero_SfV: tail sheath protein; PP_01787; phage(gi19549001) 0.0 Click
311763226..1763582 PHAGE_Entero_SfV: hypothetical protein SfVp12; PP_01788; phage(gi19549002) 6e-65 Click
321763582..1763851 PHAGE_Entero_SfV: hypothetical protein SfVp13; PP_01789; phage(gi19549003) 7e-45 Click
331763818..1764006 hypothetical protein ECOK1_2982 [Escherichia coli IHE3034] gi|386600606|ref|YP_006102112.1|; PP_01790 2e-29 Click
341763993..1765828 PHAGE_Entero_SfV: tail protein; PP_01791; phage(gi19549004) 0.0 Click
351765889..1767217 PHAGE_Entero_SfV: tail/DNA circulation protein; PP_01792; phage(gi19549005) 0.0 Click
361767214..1767483 PHAGE_Entero_SfV: tail protein; PP_01793; phage(gi19549006) 1e-41 Click
371767540..1768277 PHAGE_Entero_SfV: tail protein; PP_01794; phage(gi19549006) 3e-139 Click
381768277..1768825 PHAGE_Entero_SfV: tail protein; PP_01795; phage(gi19549007) 1e-97 Click
391768825..1769250 PHAGE_Entero_SfV: tail protein; PP_01796; phage(gi19549008) 1e-81 Click
401769237..1770295 PHAGE_Entero_SfV: tail protein; PP_01797; phage(gi19549009) 0.0 Click
411770286..1770870 PHAGE_Entero_SfV: tail protein; PP_01798; phage(gi19548988) 4e-113 Click
421770874..1771764 PHAGE_Entero_2: DNA-invertase; PP_01799; phage(gi169936026) 2e-87 Click
43complement(1771825..1772649) PHAGE_Pseudo_OBP: putative homing nuclease; PP_01800; phage(gi371671534) 6e-37 Click
441773423..1774166 AraC family transcriptional regulator [Escherichia coli O157:H7 str. TW14359] gi|254791418|ref|YP_003076255.1|; PP_01801 4e-137 Click
45complement(1774208..1774561) PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; PP_01802; phage(gi24111655) 1e-42 Click
461774921..1774967 attR    ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT 0.0 Click
471775078..1776310 PROPHAGE_Escher_CFT073: putative prophage integrase; PP_01803; phage(gi26250313) 6e-143 Click
481782036..1782047 attR    CTGATTTTTATA 0.0 Click

Region 2, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11926480..1926493 attL    AAGCATAAACAGAA 0.0 Click
2complement(1932203..1933180) PHAGE_Entero_P1: HrdC; PP_01956; phage(gi46401690) 4e-97 Click
31933239..1933901 manno(fructo)kinase [Escherichia coli W] gi|386607755|ref|YP_006123241.1|; PP_01957 2e-108 Click
4complement(1934487..1934660) PHAGE_Salmon_SPN3UB: hypothetical protein; PP_01958; phage(gi423262397) 4e-24 Click
5complement(1934992..1935375) PHAGE_Entero_2008: putative minor tail protein; PP_01959; phage(gi209427786) 1e-49 Click
6complement(1935368..1936381) PHAGE_Entero_2008: putative tail protein; PP_01960; phage(gi209427785) 0.0 Click
7complement(1936401..1938131) PHAGE_Entero_2008: putative tail protein; PP_01961; phage(gi209427785) 0.0 Click
8complement(1938133..1938390) PHAGE_Entero_2008: putative tail assembly protein; PP_01962; phage(gi209427783) 7e-45 Click
9complement(1938405..1938740) PHAGE_Entero_2008: putative tail protein; PP_01963; phage(gi209427782) 1e-58 Click
10complement(1938713..1939117) PHAGE_Entero_2008: putative prophage structural protein; PP_01964; phage(gi209427781) 6e-60 Click
11complement(1939114..1939560) PHAGE_Entero_2008: hypothetical protein YYZ_gp57; PP_01965; phage(gi209427780) 2e-80 Click
12complement(1939557..1941275) PHAGE_Entero_2008: putative portal protein; PP_01966; phage(gi209427777) 0.0 Click
13complement(1941308..1941469) PHAGE_Entero_2008: hypothetical protein YYZ_gp53; PP_01967; phage(gi209427801) 7e-26 Click
14complement(1941574..1943511) PHAGE_Entero_2008: putative major head protein/prohead proteinase; PP_01968; phage(gi209427776) 0.0 Click
15complement(1943575..1944009) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; PP_01969; phage(gi209427775) 3e-78 Click
16complement(1944427..1944573) hypothetical; PP_01970 0.0 Click
171944542..1944727 PHAGE_Entero_2008: hypothetical protein YYZ_gp48; PP_01971; phage(gi209427772) 7e-18 Click
18complement(1944857..1944997) hypothetical protein ECS88_0566 [Escherichia coli S88] gi|218557476|ref|YP_002390389.1|; PP_01972 2e-18 Click
19complement(1945084..1945209) hypothetical protein ECSP_1456 [Escherichia coli O157:H7 str. TW14359] gi|254792537|ref|YP_003077374.1|; PP_01973 2e-13 Click
20complement(1945261..1945830) PHAGE_Entero_2008: putative antirepressor; PP_01974; phage(gi209427770) 7e-107 Click
21complement(1946101..1946436) PHAGE_Entero_2008: putative endolysin; PP_01975; phage(gi209427769) 2e-64 Click
22complement(1946509..1946778) PHAGE_Escher_P13374: hypothetical protein; PP_01976; phage(gi410491644) 1e-26 Click
23complement(1946816..1946998) PHAGE_Escher_P13374: hypothetical protein; PP_01977; phage(gi410491643) 3e-18 Click
24complement(1947146..1949137) PHAGE_Entero_4795: hypothetical protein YjhS; PP_01978; phage(gi157166028) 0.0 Click
251949146..1949388 hypothetical protein ECO26_1166 [Escherichia coli O26:H11 str. 11368] gi|260854328|ref|YP_003228219.1|; PP_01979 8e-40 Click
261949483..1950385 PHAGE_Salmon_ST64B: Integrase protein; PP_01980; phage(gi23505472) 2e-83 Click
271950793..1951452 PHAGE_Camelp_virus: CMLV006; PP_01981; phage(gi18640240) 3e-12 Click
281960561..1960574 attR    AAGCATAAACAGAA 0.0 Click

Region 3, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12868996..2869007 attL    TGTGTGTTTTGT 0.0 Click
22871426..2872529 PHAGE_Halovi_HVTV_1: HNH domain endonuclease; PP_02884; phage(gi443404658) 4e-05 Click
32872760..2873083 N-acetylneuraminate epimerase 2 [Escherichia coli O55:H7 str. CB9615] gi|291285680|ref|YP_003502498.1|; PP_02885 2e-60 Click
42873037..2873921 hypothetical protein Z5892 [Escherichia coli O157:H7 str. EDL933] gi|15804871|ref|NP_290912.1|; PP_02886 1e-173 Click
5complement(2874154..2874321) PROPHAGE_Salmon_LT2: transposase; PP_02887; phage(gi16766077) 2e-05 Click
6complement(2874381..2875208) PROPHAGE_Escher_Sakai: putative integrase; PP_02888; phage(gi15834507) 6e-157 Click
7complement(2875426..2875722) PHAGE_Entero_P4: hypothetical protein P4p05; PP_02889; phage(gi19263411) 8e-54 Click
8complement(2875770..2875946) PHAGE_Entero_mEp460: host specificity protein; PP_02890; phage(gi428782334) 9e-26 Click
92876033..2876419 PHAGE_Entero_mEp460: hypothetical protein; PP_02891; phage(gi428782350) 7e-66 Click
102876547..2876861 PHAGE_Entero_mEp460: hypothetical protein; PP_02892; phage(gi428782349) 2e-51 Click
112877001..2877240 PHAGE_Salmon_vB_SosS_Oslo: putative DNA methyltransferase; PP_02893; phage(gi399528794) 3e-35 Click
122877280..2877429 PHAGE_Pectob_ZF40: putative methylase; PP_02894; phage(gi422936660) 2e-17 Click
132877576..2877773 PHAGE_Entero_mEp460: hypothetical protein; PP_02895; phage(gi428782343) 1e-13 Click
142877965..2878081 PHAGE_Entero_mEp460: putative exonuclease; PP_02896; phage(gi428782342) 2e-16 Click
152878118..2878399 PHAGE_Entero_mEp460: hypothetical protein; PP_02897; phage(gi428782341) 1e-48 Click
16complement(2878447..2878620) PHAGE_Entero_mEp460: hypothetical protein; PP_02898; phage(gi428782340) 4e-26 Click
17complement(2878817..2879350) PHAGE_Entero_mEp460: hypothetical protein; PP_02899; phage(gi428782339) 2e-100 Click
182893231..2893242 attR    TGTGTGTTTTGT 0.0 Click

Region 4, total : 14 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3079151..3079330) PROPHAGE_Escher_MG1655: predicted transposase; PP_03087; phage(gi16131356) 4e-27 Click
2complement(3079838..3080047) hypothetical protein ECW_m1586 [Escherichia coli W] gi|386608819|ref|YP_006124305.1|; PP_03088 6e-32 Click
3complement(3080244..3081419) hypothetical protein ECSP_1939, partial [Escherichia coli O157:H7 str. TW14359] gi|254793003|ref|YP_003077840.1|; PP_03089 0.0 Click
43081763..3082440 PHAGE_Stx2_c_1717: putative Ant antirepressor protein; PP_03090; phage(gi209447161) 2e-92 Click
53082515..3082835 PHAGE_Stx2_c_1717: phage antirepressor protein; PP_03091; phage(gi209447193) 6e-59 Click
63082952..3083122 PHAGE_Stx2_c_1717: putative tail component K-like protein; PP_03092; phage(gi209447194) 5e-16 Click
7complement(3083119..3083535) PROPHAGE_Escher_Sakai: putative transposase TnA; PP_03093; phage(gi15832531) 8e-77 Click
83083740..3084573 PHAGE_Stx2_c_1717: transposase; PP_03094; phage(gi209447153) 3e-118 Click
93084618..3085898 PHAGE_Stx2_c_1717: putative tail fiber component J; PP_03095; phage(gi209447196) 0.0 Click
10complement(3085888..3086469) hypothetical protein G2583_1529 [Escherichia coli O55:H7 str. CB9615] gi|291282278|ref|YP_003499096.1|; PP_03096 1e-108 Click
113086826..3087569 hypothetical protein G2583_1528 [Escherichia coli O55:H7 str. CB9615] gi|291282277|ref|YP_003499095.1|; PP_03097 1e-127 Click
123087599..3088138 intracellular septation protein A [Shigella sonnei Ss046] gi|74312396|ref|YP_310815.1|; PP_03098 6e-99 Click
133088297..3088641 acyl-CoA thioester hydrolase [Escherichia coli O157:H7 str. TW14359] gi|254792723|ref|YP_003077560.1|; PP_03099 2e-60 Click
14complement(3088681..3089415) PHAGE_Parame_NY2A: hypothetical protein NY2A_B554R; PP_03100; phage(gi157952858) 2e-12 Click

Region 5, total : 34 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3544483..3544737) PHAGE_Yersin_413C: Ogr; PP_03549; phage(gi30065732) 2e-45 Click
2complement(3544783..3545946) PHAGE_Yersin_413C: gpD; PP_03550; phage(gi30065731) 0.0 Click
3complement(3545946..3546425) PHAGE_Yersin_413C: gpU; PP_03551; phage(gi30065730) 1e-85 Click
4complement(3546440..3548887) PHAGE_Yersin_413C: gpT; PP_03552; phage(gi30065729) 0.0 Click
5complement(3548880..3549035) PHAGE_Yersin_413C: gpE+E'; PP_03553; phage(gi30065728) 7e-24 Click
6complement(3549032..3549307) PHAGE_Yersin_413C: gpE; PP_03554; phage(gi30065727) 1e-43 Click
7complement(3549364..3549882) PHAGE_Yersin_413C: FII; PP_03555; phage(gi30065726) 6e-93 Click
8complement(3549895..3551085) PHAGE_Yersin_413C: gpFI; PP_03556; phage(gi30065725) 0.0 Click
9complement(3551145..3551738) PHAGE_Entero_2: DNA-invertase; PP_03557; phage(gi169936026) 9e-88 Click
10complement(3551783..3552853) PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_03558; phage(gi29143754) 9e-161 Click
11complement(3552850..3553461) PHAGE_Yersin_413C: gpI; PP_03559; phage(gi30065721) 5e-82 Click
12complement(3553454..3554362) PHAGE_Yersin_413C: gpJ; PP_03560; phage(gi30065720) 3e-164 Click
13complement(3554367..3554714) PHAGE_Yersin_413C: gpW; PP_03561; phage(gi30065719) 6e-60 Click
14complement(3554711..3555346) PHAGE_Yersin_413C: gpV; PP_03562; phage(gi30065718) 2e-117 Click
15complement(3555413..3555865) PHAGE_Yersin_413C: gpS; PP_03563; phage(gi30065717) 9e-80 Click
16complement(3555858..3556325) PHAGE_Yersin_413C: gpR; PP_03564; phage(gi30065716) 6e-82 Click
17complement(3556288..3556446) PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_03565; phage(gi431810968) 2e-10 Click
18complement(3556433..3556858) PHAGE_Yersin_413C: LysB; PP_03566; phage(gi30065715) 3e-71 Click
19complement(3556846..3557271) PHAGE_Yersin_413C: LysA; PP_03567; phage(gi30065714) 2e-66 Click
20complement(3557286..3557783) PHAGE_Yersin_413C: gpK; PP_03568; phage(gi30065713) 2e-93 Click
21complement(3557783..3558064) PHAGE_Yersin_413C: gpY; PP_03569; phage(gi30065712) 1e-45 Click
22complement(3558068..3558271) PHAGE_Yersin_413C: gpX; PP_03570; phage(gi30065711) 4e-32 Click
23complement(3558271..3558744) PHAGE_Yersin_413C: gpL; PP_03571; phage(gi30065710) 2e-85 Click
24complement(3558880..3559623) PHAGE_Yersin_413C: gpM; PP_03572; phage(gi30065709) 2e-136 Click
25complement(3559627..3560700) PHAGE_Yersin_413C: gpN; PP_03573; phage(gi30065708) 0.0 Click
26complement(3560755..3561609) PHAGE_Yersin_413C: gpO; PP_03574; phage(gi30065707) 3e-159 Click
273561783..3563555 PHAGE_Yersin_413C: gpP; PP_03575; phage(gi30065706) 0.0 Click
283563555..3564589 PHAGE_Yersin_413C: gpQ; PP_03576; phage(gi30065705) 0.0 Click
29complement(3564628..3564789) hypothetical protein ECOK1_0941 [Escherichia coli IHE3034] gi|386598654|ref|YP_006100160.1|; PP_03577 4e-19 Click
303564802..3565071 hypothetical; PP_03578 0.0 Click
31complement(3565102..3565233) hypothetical protein ETAC_16530 [Edwardsiella tarda C07-087] gi|470464476|ref|YP_007630787.1|; PP_03579 1e-05 Click
323565295..3565732 hypothetical protein A225_3963 [Klebsiella oxytoca E718] gi|397658954|ref|YP_006499656.1|; PP_03580 3e-71 Click
33complement(3565857..3566753) PHAGE_Burkho_KS5: gp44; PP_03581; phage(gi327198042) 6e-41 Click
34complement(3566785..3567093) PHAGE_Burkho_KS5: gp45; PP_03582; phage(gi327198043) 8e-15 Click

Region 6, total : 48 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13537263..3537274 attL    ATCAGAGTATTT 0.0 Click
2complement(3544483..3544737) PHAGE_Yersin_413C: Ogr; PP_03549; phage(gi30065732) 2e-45 Click
3complement(3544783..3545946) PHAGE_Yersin_413C: gpD; PP_03550; phage(gi30065731) 0.0 Click
4complement(3545946..3546425) PHAGE_Yersin_413C: gpU; PP_03551; phage(gi30065730) 1e-85 Click
5complement(3546440..3548887) PHAGE_Yersin_413C: gpT; PP_03552; phage(gi30065729) 0.0 Click
6complement(3548880..3549035) PHAGE_Yersin_413C: gpE+E'; PP_03553; phage(gi30065728) 7e-24 Click
7complement(3549032..3549307) PHAGE_Yersin_413C: gpE; PP_03554; phage(gi30065727) 1e-43 Click
8complement(3549364..3549882) PHAGE_Yersin_413C: FII; PP_03555; phage(gi30065726) 6e-93 Click
9complement(3549895..3551085) PHAGE_Yersin_413C: gpFI; PP_03556; phage(gi30065725) 0.0 Click
10complement(3551145..3551738) PHAGE_Entero_2: DNA-invertase; PP_03557; phage(gi169936026) 9e-88 Click
11complement(3551783..3552853) PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_03558; phage(gi29143754) 9e-161 Click
12complement(3552850..3553461) PHAGE_Yersin_413C: gpI; PP_03559; phage(gi30065721) 5e-82 Click
13complement(3553454..3554362) PHAGE_Yersin_413C: gpJ; PP_03560; phage(gi30065720) 3e-164 Click
14complement(3554367..3554714) PHAGE_Yersin_413C: gpW; PP_03561; phage(gi30065719) 6e-60 Click
15complement(3554711..3555346) PHAGE_Yersin_413C: gpV; PP_03562; phage(gi30065718) 2e-117 Click
16complement(3555413..3555865) PHAGE_Yersin_413C: gpS; PP_03563; phage(gi30065717) 9e-80 Click
17complement(3555858..3556325) PHAGE_Yersin_413C: gpR; PP_03564; phage(gi30065716) 6e-82 Click
18complement(3556288..3556446) PHAGE_Erwini_ENT90: putative host lysis-related protein; PP_03565; phage(gi431810968) 2e-10 Click
19complement(3556433..3556858) PHAGE_Yersin_413C: LysB; PP_03566; phage(gi30065715) 3e-71 Click
20complement(3556846..3557271) PHAGE_Yersin_413C: LysA; PP_03567; phage(gi30065714) 2e-66 Click
21complement(3557286..3557783) PHAGE_Yersin_413C: gpK; PP_03568; phage(gi30065713) 2e-93 Click
22complement(3557783..3558064) PHAGE_Yersin_413C: gpY; PP_03569; phage(gi30065712) 1e-45 Click
23complement(3558068..3558271) PHAGE_Yersin_413C: gpX; PP_03570; phage(gi30065711) 4e-32 Click
24complement(3558271..3558744) PHAGE_Yersin_413C: gpL; PP_03571; phage(gi30065710) 2e-85 Click
25complement(3558880..3559623) PHAGE_Yersin_413C: gpM; PP_03572; phage(gi30065709) 2e-136 Click
26complement(3559627..3560700) PHAGE_Yersin_413C: gpN; PP_03573; phage(gi30065708) 0.0 Click
27complement(3560755..3561609) PHAGE_Yersin_413C: gpO; PP_03574; phage(gi30065707) 3e-159 Click
283561783..3563555 PHAGE_Yersin_413C: gpP; PP_03575; phage(gi30065706) 0.0 Click
293563555..3564589 PHAGE_Yersin_413C: gpQ; PP_03576; phage(gi30065705) 0.0 Click
30complement(3564628..3564789) hypothetical protein ECOK1_0941 [Escherichia coli IHE3034] gi|386598654|ref|YP_006100160.1|; PP_03577 4e-19 Click
313564802..3565071 hypothetical; PP_03578 0.0 Click
32complement(3565102..3565233) hypothetical protein ETAC_16530 [Edwardsiella tarda C07-087] gi|470464476|ref|YP_007630787.1|; PP_03579 1e-05 Click
333565295..3565732 hypothetical protein A225_3963 [Klebsiella oxytoca E718] gi|397658954|ref|YP_006499656.1|; PP_03580 3e-71 Click
34complement(3565857..3566753) PHAGE_Burkho_KS5: gp44; PP_03581; phage(gi327198042) 6e-41 Click
35complement(3566785..3567093) PHAGE_Burkho_KS5: gp45; PP_03582; phage(gi327198043) 8e-15 Click
36complement(3567130..3567285) hypothetical; PP_03583 0.0 Click
37complement(3567694..3569982) PHAGE_Yersin_413C: gpA; PP_03584; phage(gi30065742) 0.0 Click
38complement(3569972..3570247) PHAGE_Yersin_413C: hypothetical protein L-413Cp37; PP_03585; phage(gi30065741) 1e-45 Click
39complement(3570244..3570468) PHAGE_Yersin_413C: hypothetical protein L-413Cp36; PP_03586; phage(gi30065740) 4e-37 Click
40complement(3570468..3570770) PHAGE_Yersin_413C: hypothetical protein L-413Cp35; PP_03587; phage(gi30065739) 9e-45 Click
41complement(3570770..3570994) PHAGE_Yersin_413C: hypothetical protein L-413Cp34; PP_03588; phage(gi30065738) 1e-34 Click
42complement(3571058..3571558) PHAGE_Yersin_413C: gpB; PP_03589; phage(gi30065737) 2e-92 Click
43complement(3571555..3571725) PHAGE_Yersin_413C: hypothetical protein L-413Cp32; PP_03590; phage(gi30065736) 1e-25 Click
44complement(3571736..3571921) PHAGE_Yersin_413C: Cox; PP_03591; phage(gi30065735) 8e-12 Click
453572167..3572178 attR    ATCAGAGTATTT 0.0 Click
463572541..3573554 PHAGE_Yersin_413C: Int; PP_03592; phage(gi30065733) 1e-91 Click
47complement(3573819..3574151) hypothetical protein Z3251 [Escherichia coli O157:H7 str. EDL933] gi|15802563|ref|NP_288590.1|; PP_03593 2e-56 Click
483574542..3575441 phosphatidylglycerol kinase, metal-dependent [Escherichia coli W] gi|386609485|ref|YP_006124971.1|; PP_03594 2e-170 Click
49complement(3575523..3576302) galactitol utilization operon repressor [Escherichia coli O157:H7 str. TW14359] gi|254793913|ref|YP_003078750.1|; PP_03595 5e-138 Click
50complement(3576402..3577442) PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; PP_03596; phage(gi326781942) 8e-11 Click

Region 7, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3623619..3625304) PHAGE_Entero_2008: putative 2-component sensor protein YehU; PP_03641; phage(gi209427798) 0.0 Click
23625563..3625703 hypothetical; PP_03642 0.0 Click
3complement(3625841..3626362) PHAGE_Entero_P4: amber mutation-suppressing protein; PP_03643; phage(gi9627520) 3e-90 Click
4complement(3626436..3626576) PHAGE_Entero_P4: transactivation protein; PP_03644; phage(gi9627519) 6e-20 Click
5complement(3626736..3626858) hypothetical; PP_03645 0.0 Click
6complement(3626934..3627425) PHAGE_Entero_P4: head size determination protein sid; PP_03646; phage(gi9627518) 8e-89 Click
7complement(3627457..3627666) PHAGE_Entero_P4: head size determination protein sid; PP_03647; phage(gi9627518) 1e-27 Click
83627961..3628296 PHAGE_Entero_P4: putative CI repressor; PP_03648; phage(gi9627516) 5e-51 Click
93628289..3628576 PHAGE_Entero_P4: helper derepression protein; PP_03649; phage(gi9627515) 4e-50 Click
103628569..3629024 PHAGE_Entero_P4: hypothetical protein P4p08; PP_03650; phage(gi9627514) 9e-88 Click
113629129..3629392 PHAGE_Entero_P4: hypothetical protein P4p07; PP_03651; phage(gi9627513) 5e-30 Click
123629493..3630329 PHAGE_Entero_P4: DNA primase; PP_03652; phage(gi9627512) 3e-153 Click
133630286..3631827 PHAGE_Entero_P4: DNA primase; PP_03653; phage(gi9627512) 0.0 Click
14complement(3631782..3631907) hypothetical; PP_03654 0.0 Click
15complement(3631979..3632389) PHAGE_Entero_mEp460: holliday junction resolvase; PP_03655; phage(gi428782363) 5e-68 Click
16complement(3632386..3632712) PHAGE_Entero_mEp460: LexA DNA binding domain protein; PP_03656; phage(gi428782362) 5e-54 Click
17complement(3632709..3633230) PHAGE_Entero_cdtI: putative DNA adenine methylase; PP_03657; phage(gi148609429) 1e-94 Click
18complement(3633211..3633360) PHAGE_Entero_cdtI: putative DNA adenine methylase; PP_03658; phage(gi148609429) 1e-24 Click
19complement(3633353..3633610) PHAGE_Entero_mEp460: hypothetical protein; PP_03659; phage(gi428782360) 3e-23 Click
203633825..3634001 hypothetical protein ECSP_1237 [Escherichia coli O157:H7 str. TW14359] gi|254792323|ref|YP_003077160.1|; PP_03660 5e-27 Click
21complement(3634163..3636523) PHAGE_Parame_AR158: hypothetical protein AR158_C191R; PP_03661; phage(gi157953382) 5e-35 Click

Region 8, total : 100 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3899453..3900718) PROPHAGE_Shewan_MR-1: ISSod3, transposase; PP_03917; phage(gi24375070) 7e-121 Click
23900797..3901450 plasmid partition protein [Escherichia coli O127:H6 str. E2348/69] gi|215486897|ref|YP_002329328.1|; PP_03918 3e-92 Click
33901648..3902412 PHAGE_Stx2_c_1717: putative Ant antirepressor protein; PP_03919; phage(gi209447161) 4e-147 Click
4complement(3902372..3902545) hypothetical; PP_03920 0.0 Click
5complement(3902697..3902843) hypothetical protein ECSP_2608 [Escherichia coli O157:H7 str. TW14359] gi|254793653|ref|YP_003078490.1|; PP_03921 2e-18 Click
6complement(3902950..3903078) endolysin [Escherichia coli O55:H7 str. CB9615] gi|291282468|ref|YP_003499286.1|; PP_03922 1e-06 Click
7complement(3903035..3903397) PHAGE_Entero_4795: putative R protein; PP_03923; phage(gi157166033) 9e-69 Click
83903417..3903539 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip158; PP_03924; phage(gi20065953) 5e-05 Click
9complement(3903887..3904156) PHAGE_Stx1_converting: Shiga toxin 1 subunit B; PP_03925; phage(gi302861196) 4e-46 Click
10complement(3904166..3905113) PHAGE_Stx1_converting: Shiga toxin 1 subunit A; PP_03926; phage(gi302861195) 1e-176 Click
11complement(3905620..3906054) PHAGE_Entero_2008: antitermination protein Q; PP_03927; phage(gi209427762) 8e-83 Click
123906537..3906863 PHAGE_Entero_mEp460: hypothetical protein; PP_03928; phage(gi428782349) 3e-52 Click
13complement(3906975..3907550) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; PP_03929; phage(gi209447201) 2e-20 Click
14complement(3908432..3908860) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; PP_03930; phage(gi209427795) 6e-24 Click
153909313..3909477 PROPHAGE_Escher_CFT073: putative transposase; PP_03931; phage(gi26246170) 3e-21 Click
163909768..3909962 PROPHAGE_Escher_EDL933: putative transposase; PP_03932; phage(gi15803522) 8e-22 Click
173909972..3910154 PROPHAGE_Escher_EDL933: putative transposase; PP_03933; phage(gi15803522) 3e-20 Click
183910223..3910369 hypothetical; PP_03934 0.0 Click
19complement(3910588..3911178) T3SS effector EspM [Escherichia coli O26:H11 str. 11368] gi|260854953|ref|YP_003228844.1|; PP_03935 4e-108 Click
203911362..3912009 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; PP_03936; phage(gi209447201) 3e-36 Click
213913543..3913839 PROPHAGE_Escher_CFT073: transposase; PP_03937; phage(gi26246249) 3e-26 Click
223913869..3914126 PROPHAGE_Escher_CFT073: transposase; PP_03938; phage(gi26246249) 9e-34 Click
233914422..3914433 attL    GAAAACATTACT 0.0 Click
243914519..3915211 PHAGE_Entero_HK630: integrase; PP_03939; phage(gi428782814) 2e-91 Click
253915872..3917197 PHAGE_Entero_4795: NleA4795 protein; PP_03940; phage(gi157166068) 0.0 Click
263917407..3917553 NleA8-2 protein [Escherichia coli O55:H7 str. CB9615] gi|291282338|ref|YP_003499156.1|; PP_03941 4e-08 Click
27complement(3917537..3917872) PHAGE_Entero_2008: hypothetical protein YYZ_gp72; PP_03942; phage(gi209427795) 1e-20 Click
28complement(3918156..3918377) PHAGE_Stx2_c_1717: putative tail fiber protein; PP_03943; phage(gi209447198) 3e-31 Click
29complement(3918450..3918563) hypothetical; PP_03944 0.0 Click
30complement(3918529..3920466) PHAGE_Stx2_c_1717: putative tail fiber component J; PP_03945; phage(gi209447196) 0.0 Click
31complement(3920447..3921313) PHAGE_Entero_2008: phage-related tail protein; PP_03946; phage(gi209427791) 1e-152 Click
32complement(3921268..3921987) PHAGE_Entero_HK630: tail fiber J; PP_03947; phage(gi428782808) 3e-86 Click
333922121..3922648 PHAGE_Salmon_1: hypothetical bacteriophage protein; PP_03948; phage(gi169257202) 2e-61 Click
343922813..3922941 hypothetical; PP_03949 0.0 Click
35complement(3922956..3923285) PHAGE_Entero_HK630: minor tail protein M; PP_03950; phage(gi428782804) 5e-46 Click
36complement(3923282..3923839) PHAGE_Entero_HK630: tail length tape measure protein H; PP_03951; phage(gi428782803) 2e-82 Click
37complement(3923833..3925338) PHAGE_Entero_HK630: tail length tape measure protein H; PP_03952; phage(gi428782803) 0.0 Click
38complement(3925319..3925708) PHAGE_Entero_HK630: tail assembly protein GT; PP_03953; phage(gi428782802) 4e-43 Click
39complement(3925759..3926190) PHAGE_Entero_HK630: minor tail protein G; PP_03954; phage(gi428782801) 5e-45 Click
40complement(3926181..3926606) PHAGE_Entero_HK630: major tail protein V; PP_03955; phage(gi428782800) 5e-64 Click
41complement(3926666..3926932) PHAGE_Entero_HK630: major head subunit E; PP_03956; phage(gi428782795) 2e-20 Click
42complement(3926990..3927337) PHAGE_Entero_HK630: head decoration protein D; PP_03957; phage(gi428782794) 6e-25 Click
43complement(3927374..3928879) PHAGE_Entero_HK630: head maturation protease C; PP_03958; phage(gi428782792) 4e-108 Click
44complement(3928869..3930461) PHAGE_Entero_HK630: portal protein B; PP_03959; phage(gi428782791) 0.0 Click
45complement(3930458..3930664) PHAGE_Entero_HK630: head-tail connector W; PP_03960; phage(gi428782790) 1e-11 Click
46complement(3930648..3932576) PHAGE_Entero_HK630: terminase large subunit A; PP_03961; phage(gi428782789) 0.0 Click
47complement(3932548..3932790) PHAGE_Entero_HK630: terminase small subunit nu1; PP_03962; phage(gi428782788) 2e-13 Click
48complement(3932865..3932941) tRNA 0.0 Click
49complement(3932949..3933024) tRNA 0.0 Click
50complement(3933235..3933924) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_03963; phage(gi169257244) 1e-80 Click
51complement(3933961..3934470) PHAGE_Entero_mEp460: hypothetical protein; PP_03964; phage(gi428782365) 4e-40 Click
523934691..3934828 hypothetical protein S2141 [Shigella flexneri 2a str. 2457T] gi|30063428|ref|NP_837599.1|; PP_03965 1e-17 Click
53complement(3935041..3935190) hypothetical protein ECSP_2624 [Escherichia coli O157:H7 str. TW14359] gi|254793666|ref|YP_003078503.1|; PP_03966 2e-19 Click
54complement(3935255..3935818) PHAGE_Entero_mEp460: hypothetical protein; PP_03967; phage(gi428782343) 5e-41 Click
55complement(3935945..3936256) PHAGE_Entero_mEp213: hypothetical protein; PP_03968; phage(gi428782634) 2e-24 Click
56complement(3936253..3936405) hypothetical protein ECO26_1472 [Escherichia coli O26:H11 str. 11368] gi|260854622|ref|YP_003228513.1|; PP_03969 2e-24 Click
57complement(3936438..3936794) PHAGE_Entero_HK629: hypothetical protein; PP_03970; phage(gi428782046) 9e-16 Click
58complement(3936791..3937015) PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; PP_03971; phage(gi169257161) 4e-15 Click
59complement(3937037..3937735) hypothetical protein ECSP_2628 [Escherichia coli O157:H7 str. TW14359] gi|254793670|ref|YP_003078507.1|; PP_03972 2e-127 Click
60complement(3937770..3937958) PHAGE_Escher_HK639: replication protein 14; PP_03973; phage(gi356870655) 3e-10 Click
61complement(3937955..3938080) hypothetical protein ECO26_1466 [Escherichia coli O26:H11 str. 11368] gi|260854616|ref|YP_003228507.1|; PP_03974 1e-12 Click
623938705..3939046 PHAGE_Entero_mEp390: prophage repressor; PP_03975; phage(gi428782701) 9e-13 Click
633939321..3939473 PHAGE_Salico_CGphi29: hypothetical protein; PP_03976; phage(gi472340166) 1e-08 Click
64complement(3939806..3939925) hypothetical protein CE10_1440 [Escherichia coli O7:K1 str. CE10] gi|386623806|ref|YP_006143534.1|; PP_03977 1e-14 Click
653939954..3940142 hypothetical protein ECSP_2634 [Escherichia coli O157:H7 str. TW14359] gi|254793676|ref|YP_003078513.1|; PP_03978 7e-28 Click
663940139..3940327 hypothetical protein ECSP_2635 [Escherichia coli O157:H7 str. TW14359] gi|254793677|ref|YP_003078514.1|; PP_03979 2e-27 Click
67complement(3940341..3941000) PHAGE_Stx2_c_1717: transposase; PP_03980; phage(gi209447153) 3e-49 Click
68complement(3940969..3941304) PHAGE_Stx2_c_1717: putative tail assembly chaperone; PP_03981; phage(gi209447188) 1e-44 Click
69complement(3941310..3941648) PHAGE_Stx2_c_1717: putative major tail subunit; PP_03982; phage(gi209447187) 3e-60 Click
703941710..3942666 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_03983; phage(gi209427766) 2e-173 Click
71complement(3943124..3943591) PHAGE_Entero_HK106: side tail fiber protein; PP_03984; phage(gi428783303) 1e-38 Click
72complement(3943608..3944408) PHAGE_Entero_HK630: tail component K; PP_03985; phage(gi428782806) 2e-109 Click
73complement(3944444..3944623) hypothetical protein Z6068 [Escherichia coli O157:H7 str. EDL933] gi|15801981|ref|NP_288002.1|; PP_03986 1e-25 Click
74complement(3944649..3945389) PHAGE_Gifsy_2: bacteriophage DNA replication protein; PP_03987; phage(gi169257280) 7e-76 Click
75complement(3945396..3946088) PHAGE_Entero_mEp237: DNA replication protein O; PP_03988; phage(gi435439307) 3e-20 Click
76complement(3946090..3946242) phage regulatory protein CII [Escherichia coli O26:H11 str. 11368] gi|260855750|ref|YP_003229641.1|; PP_03989 1e-18 Click
773946792..3947010 repressor protein encoded by cryptic prophage CP-933P [Escherichia coli O157:H7 str. TW14359] gi|254793187|ref|YP_003078024.1|; PP_03990 1e-34 Click
783946995..3947222 hypothetical protein ECO26_2665 [Escherichia coli O26:H11 str. 11368] gi|260855753|ref|YP_003229644.1|; PP_03991 1e-28 Click
793947601..3947735 hypothetical protein ECO111_1410 [Escherichia coli O111:H- str. 11128] gi|260867495|ref|YP_003233897.1|; PP_03992 8e-19 Click
803947798..3947923 hypothetical protein ECSP_2136 [Escherichia coli O157:H7 str. TW14359] gi|254793189|ref|YP_003078026.1|; PP_03993 8e-09 Click
81complement(3947956..3948147) hypothetical protein ECO26_1101 [Escherichia coli O26:H11 str. 11368] gi|260854266|ref|YP_003228157.1|; PP_03994 2e-29 Click
82complement(3948144..3948332) cell division inhibition protein [Escherichia coli O26:H11 str. 11368] gi|260854267|ref|YP_003228158.1|; PP_03995 2e-27 Click
83complement(3949023..3949760) PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_03996; phage(gi399528893) 3e-14 Click
843949796..3949930 hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_03997 9e-15 Click
853949891..3951441 PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_03998; phage(gi16129506) 5e-100 Click
863951441..3952022 PHAGE_Entero_HK630: tail fiber assembly protein; PP_03999; phage(gi428782810) 1e-102 Click
87complement(3952142..3953032) hypothetical protein ECSP_1557 [Escherichia coli O157:H7 str. TW14359] gi|254792637|ref|YP_003077474.1|; PP_04000 4e-167 Click
88complement(3953051..3953557) hypothetical protein ECSP_1558 [Escherichia coli O157:H7 str. TW14359] gi|254792638|ref|YP_003077475.1|; PP_04001 8e-90 Click
89complement(3953594..3954094) hypothetical protein ECSP_1559 [Escherichia coli O157:H7 str. TW14359] gi|254792639|ref|YP_003077476.1|; PP_04002 1e-85 Click
90complement(3954173..3954355) hypothetical protein ECSP_1560 [Escherichia coli O157:H7 str. TW14359] gi|254792640|ref|YP_003077477.1|; PP_04003 7e-29 Click
91complement(3954853..3955521) hypothetical protein SF2201 [Shigella flexneri 2a str. 301] gi|24113509|ref|NP_708019.1|; PP_04004 4e-127 Click
923954872..3954883 attR    GAAAACATTACT 0.0 Click
933955578..3955850 PHAGE_Entero_HK630: tail fiber assembly protein; PP_04005; phage(gi428782810) 1e-14 Click
943955984..3956187 hypothetical protein G2583_2117 [Escherichia coli O55:H7 str. CB9615] gi|291282850|ref|YP_003499668.1|; PP_04006 3e-32 Click
953956447..3957601 PHAGE_Cafete_BV_PW1: putative eIF-2gamma; PP_04007; phage(gi310831469) 7e-13 Click
963957690..3958292 hypothetical protein ECO26_1354 [Escherichia coli O26:H11 str. 11368] gi|260854505|ref|YP_003228396.1|; PP_04008 1e-103 Click
97complement(3958246..3959301) PHAGE_Entero_HK630: major tail protein V; PP_04009; phage(gi428782800) 9e-79 Click
98complement(3959309..3959482) PHAGE_Entero_HK630: tail length tape measure protein H; PP_04010; phage(gi428782803) 1e-18 Click
99complement(3959463..3959852) PHAGE_Entero_HK630: tail assembly protein GT; PP_04011; phage(gi428782802) 1e-40 Click
100complement(3959903..3960349) PHAGE_Entero_HK630: minor tail protein U; PP_04012; phage(gi428782799) 8e-57 Click
101complement(3960346..3960879) PHAGE_Entero_HK630: minor tail protein Z; PP_04013; phage(gi428782798) 2e-65 Click
102complement(3960894..3961082) PHAGE_Entero_HK630: head-tail connector Fii; PP_04014; phage(gi428782797) 7e-27 Click
103complement(3961133..3961750) PHAGE_Stx2_c_1717: transposase; PP_04015; phage(gi209447153) 7e-49 Click
104complement(3961858..3962220) PHAGE_Stx2_c_1717: truncated transposase; PP_04016; phage(gi209447151) 8e-11 Click

Region 9, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14162426..4162438 attL    AATATATAAACTT 0.0 Click
2complement(4167666..4168667) PHAGE_Haemop_HP2: integrase; PP_04240; phage(gi17981816) 1e-104 Click
3complement(4168673..4169020) hypothetical protein ECO26_2759 [Escherichia coli O26:H11 str. 11368] gi|260855847|ref|YP_003229738.1|; PP_04241 4e-62 Click
4complement(4169050..4169700) hypothetical protein ECSP_2484 [Escherichia coli O157:H7 str. TW14359] gi|254793534|ref|YP_003078371.1|; PP_04242 4e-119 Click
5complement(4169716..4169976) PHAGE_Burkho_phiE255: gp46; PP_04243; phage(gi134288790) 6e-10 Click
64170419..4170622 PHAGE_Vibrio_kappa: putative regulator; PP_04244; phage(gi165970239) 6e-10 Click
74170644..4170994 hypothetical protein ECSP_2487 [Escherichia coli O157:H7 str. TW14359] gi|254793537|ref|YP_003078374.1|; PP_04245 5e-64 Click
84171005..4171283 hypothetical protein ECSP_2488 [Escherichia coli O157:H7 str. TW14359] gi|254793538|ref|YP_003078375.1|; PP_04246 5e-45 Click
94171295..4171537 hypothetical protein ECSP_2489 [Escherichia coli O157:H7 str. TW14359] gi|254793539|ref|YP_003078376.1|; PP_04247 5e-39 Click
104171534..4171647 prophage membrane protein [Citrobacter rodentium ICC168] gi|283785691|ref|YP_003365556.1|; PP_04248 2e-11 Click
114171740..4172174 hypothetical protein ECSP_2490 [Escherichia coli O157:H7 str. TW14359] gi|254793540|ref|YP_003078377.1|; PP_04249 3e-41 Click
124172505..4172735 hypothetical protein Z2976 [Escherichia coli O157:H7 str. EDL933] gi|15802328|ref|NP_288354.1|; PP_04250 7e-36 Click
134172808..4173173 hypothetical protein ECSP_2493 [Escherichia coli O157:H7 str. TW14359] gi|254793543|ref|YP_003078380.1|; PP_04251 4e-63 Click
144173180..4174958 PHAGE_Entero_mEp460: minor tail protein; PP_04252; phage(gi428782331) 7e-61 Click
15complement(4174979..4175461) PHAGE_Shrimp_virus: wsv238; PP_04253; phage(gi17158342) 3e-11 Click
16complement(4175694..4178342) PHAGE_Entero_2008: putative phage terminase; PP_04254; phage(gi209427774) 1e-60 Click
17complement(4178457..4179065) PHAGE_Entero_2008: putative exonuclease; PP_04255; phage(gi209427739) 2e-94 Click
18complement(4179062..4179775) PHAGE_Stx2_c_I: Bet protein; PP_04256; phage(gi20065900) 2e-131 Click
19complement(4179772..4179993) PHAGE_Entero_2008: hypothetical protein YYZ_gp10; PP_04257; phage(gi209427736) 2e-37 Click
20complement(4180092..4180307) PHAGE_Entero_2008: hypothetical protein YYZ_gp11; PP_04258; phage(gi209427737) 2e-34 Click
21complement(4180711..4181697) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; PP_04259; phage(gi209427775) 8e-116 Click
22complement(4181694..4181936) PHAGE_Entero_2008: putative phage terminase; PP_04260; phage(gi209427774) 5e-35 Click
23complement(4181938..4182051) hypothetical protein ECO26_1133 [Escherichia coli O26:H11 str. 11368] gi|260854298|ref|YP_003228189.1|; PP_04261 4e-13 Click
24complement(4182272..4182805) PHAGE_Entero_2008: putative endolysin; PP_04262; phage(gi209427769) 2e-99 Click
254182923..4183237 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; PP_04263; phage(gi116221998) 4e-18 Click
264183395..4183407 attL    CCTGTTATTGATT 0.0 Click
27complement(4183520..4183684) hypothetical; PP_04264 0.0 Click
284183683..4183847 tail fiber protein [Escherichia coli O157:H7 str. TW14359] gi|254793875|ref|YP_003078712.1|; PP_04265 4e-25 Click
294183868..4184122 PHAGE_Erwini_ENT90: conserved hypothetical tail fiber protein; PP_04266; phage(gi431810959) 2e-08 Click
304184192..4184308 hypothetical; PP_04267 0.0 Click
314184394..4184690 hypothetical; PP_04268 0.0 Click
32complement(4184863..4185534) PHAGE_Entero_2008: phage-related tail protein; PP_04269; phage(gi209427791) 6e-98 Click
334185575..4186426 PHAGE_Entero_phiP27: putative DNA methylase; PP_04270; phage(gi18249888) 6e-144 Click
34complement(4186414..4187052) PHAGE_Entero_2008: putative phage terminase-like protein large subunit; PP_04271; phage(gi209427775) 1e-114 Click
35complement(4187075..4187965) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; PP_04272; phage(gi209447169) 2e-131 Click
364187955..4188323 PHAGE_Entero_2008: Ea10 protein; PP_04273; phage(gi209427743) 2e-68 Click
37complement(4188455..4189156) PHAGE_Entero_2008: hypothetical protein YYZ_gp73; PP_04275; phage(gi209427796) 4e-105 Click
384189205..4189354 hypothetical protein NRG857_07890 [Escherichia coli O83:H1 str. NRG 857C] gi|387616914|ref|YP_006119936.1|; PP_04274 2e-19 Click
394189490..4190215 exonuclease VIII, ds DNA exonuclease, 5' --_ 3' specific encoded by prophage CP-933O [Escherichia coli O157:H7 str. TW14359] gi|254792728|ref|YP_003077565.1|; PP_04276 3e-106 Click
404190302..4190457 PHAGE_Entero_2008: putative integrase; PP_04277; phage(gi209427727) 1e-08 Click
414190787..4190993 PHAGE_Entero_2008: putative integrase; PP_04278; phage(gi209427727) 1e-18 Click
42complement(4191256..4191582) hypothetical protein ECSP_2146 [Escherichia coli O157:H7 str. TW14359] gi|254793199|ref|YP_003078036.1|; PP_04279 6e-59 Click
434191717..4192058 hypothetical protein G2583_1977 [Escherichia coli O55:H7 str. CB9615] gi|291282715|ref|YP_003499533.1|; PP_04280 4e-60 Click
444192059..4192071 attR    CCTGTTATTGATT 0.0 Click
454192093..4192653 PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p012; PP_04281; phage(gi9630137) 1e-08 Click
464193934..4193946 attR    AATATATAAACTT 0.0 Click

Region 10, total : 43 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14322843..4322857 attL    TTTCATAAAAAATAA 0.0 Click
2complement(4327782..4328246) PHAGE_Bacill_36: baseplate hub protein; PP_04411; phage(gi156564128) 2e-08 Click
3complement(4328324..4329073) PHAGE_Plankt_PaV_LD: ABC transporter; PP_04412; phage(gi371496158) 6e-09 Click
4complement(4329073..4329624) PHAGE_Mollus_1: MC066L; PP_04413; phage(gi19744909) 1e-20 Click
5complement(4329687..4330667) vitamin B12 import system permease btuC [Escherichia coli O55:H7 str. CB9615] gi|291282841|ref|YP_003499659.1|; PP_04414 0.0 Click
6complement(4330860..4331405) PHAGE_Bacill_BPS13: putative tail structure protein; PP_04415; phage(gi410492618) 2e-05 Click
7complement(4331398..4331898) PHAGE_Salmon_SPN3UB: hypothetical protein; PP_04416; phage(gi423262401) 4e-09 Click
8complement(4331901..4332839) PHAGE_Salmon_RE_2010: integrase; PP_04417; phage(gi418489683) 1e-64 Click
9complement(4332928..4333236) PHAGE_Yersin_413C: gpC; PP_04418; phage(gi30065734) 4e-20 Click
104333333..4333611 hypothetical protein G2583_2112 [Escherichia coli O55:H7 str. CB9615] gi|291282845|ref|YP_003499663.1|; PP_04419 1e-45 Click
114333626..4333964 hypothetical protein G2583_2113 [Escherichia coli O55:H7 str. CB9615] gi|291282846|ref|YP_003499664.1|; PP_04420 3e-60 Click
124333975..4334262 hypothetical protein G2583_2114 [Escherichia coli O55:H7 str. CB9615] gi|291282847|ref|YP_003499665.1|; PP_04421 4e-46 Click
134334274..4334516 hypothetical protein SSON53_08345 [Shigella sonnei 53G] gi|383178214|ref|YP_005456219.1|; PP_04422 1e-38 Click
144334513..4334626 hypothetical protein SSON53_08340 [Shigella sonnei 53G] gi|383178213|ref|YP_005456218.1|; PP_04423 2e-11 Click
154334783..4335031 hypothetical protein ECSP_2490 [Escherichia coli O157:H7 str. TW14359] gi|254793540|ref|YP_003078377.1|; PP_04424 2e-19 Click
16complement(4335039..4335179) hypothetical; PP_04425 0.0 Click
174335174..4335791 PHAGE_Entero_mEp460: regulatory protein Rha; PP_04426; phage(gi428782357) 7e-14 Click
184335818..4336177 hypothetical protein O3K_11605 [Escherichia coli O104:H4 str. 2011C-3493] gi|407481863|ref|YP_006779012.1|; PP_04427 6e-65 Click
194336174..4336734 PHAGE_Salmon_RE_2010: replication protein; PP_04428; phage(gi418489692) 5e-06 Click
204336794..4337741 PHAGE_Salmon_RE_2010: replication protein; PP_04429; phage(gi418489692) 5e-67 Click
214337746..4338057 putative plasmid partition protein [Escherichia coli O111:H- str. 11128] gi|260868207|ref|YP_003234609.1|; PP_04430 9e-52 Click
224338572..4338691 hypothetical protein ECO111_2190 [Escherichia coli O111:H- str. 11128] gi|260868208|ref|YP_003234610.1|; PP_04431 1e-14 Click
234338982..4339110 hypothetical protein ECOK1_2572 [Escherichia coli IHE3034] gi|386600215|ref|YP_006101721.1|; PP_04432 1e-12 Click
24complement(4339179..4340225) PHAGE_Salmon_RE_2010: capsid packaging protein; PP_04433; phage(gi418489696) 8e-91 Click
25complement(4340225..4341976) PHAGE_Burkho_KS5: gp42; PP_04434; phage(gi327198040) 8e-139 Click
264342131..4342967 PHAGE_Salmon_RE_2010: capsid scaffolding protein; PP_04435; phage(gi418489698) 5e-45 Click
274342990..4344042 PHAGE_Salmon_RE_2010: major capsid protein; PP_04436; phage(gi418489699) 3e-74 Click
284344088..4344888 PHAGE_Salmon_RE_2010: terminase endonuclease subunit; PP_04437; phage(gi418489700) 2e-33 Click
294344990..4345484 PHAGE_Burkho_2: gp50, phage head completion protein (GPL); PP_04438; phage(gi134288689) 9e-26 Click
304345484..4345684 PHAGE_Salmon_RE_2010: tail component protein; PP_04439; phage(gi418489702) 4e-12 Click
314345687..4346010 PHAGE_Aeromo_phiO18P: putative holin; PP_04440; phage(gi148727161) 1e-09 Click
324346007..4346399 PHAGE_Entero_phiP27: putative endolysin; PP_04441; phage(gi18249894) 1e-53 Click
334346396..4346803 hypothetical protein ECO103_1883 [Escherichia coli O103:H2 str. 12009] gi|260844044|ref|YP_003221822.1|; PP_04442 2e-71 Click
344346941..4347408 PHAGE_Ralsto_phiRSA1: tail completion protein-like protein; PP_04443; phage(gi145708090) 3e-19 Click
354347392..4348036 PHAGE_Pseudo_phiCTX: predicted tail completion; PP_04444; phage(gi17313233) 4e-20 Click
364348033..4348614 PHAGE_Erwini_ENT90: baseplate assembly protein; PP_04445; phage(gi431810950) 3e-48 Click
374348611..4348961 PHAGE_Salmon_RE_2010: baseplate wedge subunit; PP_04446; phage(gi418489710) 2e-21 Click
384348965..4349861 PHAGE_Salmon_RE_2010: baseplate assembly protein J; PP_04447; phage(gi418489711) 4e-85 Click
394349854..4350462 PHAGE_Salmon_RE_2010: tail protein I; PP_04448; phage(gi418489712) 2e-63 Click
404350459..4351802 PROPHAGE_Salmon_Ty2: variable tail fiber protein; PP_04449; phage(gi29143754) 3e-98 Click
41complement(4351920..4352339) PHAGE_Entero_mEp460: host specificity protein; PP_04450; phage(gi428782334) 9e-55 Click
424352771..4353466 PHAGE_Stx2_c_II: CI protein; PP_04451; phage(gi302393138) 8e-135 Click
43complement(4353523..4353663) hypothetical; PP_04452 0.0 Click
444354109..4354489 PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp54; PP_04453; phage(gi302393137) 8e-67 Click
454365391..4365405 attR    TTTCATAAAAAATAA 0.0 Click

Region 11, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4358533..4359345) PHAGE_Helico_2: hypothetical protein; PP_04459; phage(gi370703038) 1e-05 Click
24359429..4360118 PHAGE_Entero_2008: DNA-binding protein Roi; PP_04460; phage(gi209427760) 2e-125 Click
34360118..4360663 PHAGE_Stx2_c_1717: NinG protein; PP_04461; phage(gi209447163) 1e-100 Click
44360660..4361211 PHAGE_Entero_Mu: virion morphogenesis late F orf; PP_04462; phage(gi9633521) 2e-41 Click
54361333..4361773 PHAGE_Entero_Mu: putative virion morphogenesis protein; PP_04463; phage(gi9633522) 3e-35 Click
64361784..4362308 PHAGE_Entero_Mu: virion morphogenesis late F orf; PP_04464; phage(gi9633521) 2e-39 Click
74362427..4362846 PHAGE_Entero_Mu: putative virion morphogenesis protein; PP_04465; phage(gi9633522) 3e-34 Click
8complement(4363053..4363244) putative transposase [Shigella flexneri 2002017] gi|384545979|ref|YP_005711891.1|; PP_04466 2e-25 Click
9complement(4363369..4363638) PROPHAGE_Escher_CFT073: transposase; PP_04467; phage(gi26249432) 5e-38 Click

Region 12, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14368363..4369247 PHAGE_Entero_4795: putative tail component; PP_04472; phage(gi157166057) 5e-141 Click
24369303..4369539 tail fiber protein [Escherichia coli O157:H7 str. TW14359] gi|254793875|ref|YP_003078712.1|; PP_04473 4e-33 Click
34369560..4370003 PHAGE_Entero_mEp213: tail fiber assembly protein; PP_04474; phage(gi428782612) 1e-25 Click
4complement(4369975..4370577) PHAGE_Entero_HK106: tail fiber assembly protein; PP_04475; phage(gi428783304) 1e-97 Click
5complement(4370577..4371074) PHAGE_Entero_HK106: side tail fiber protein; PP_04476; phage(gi428783303) 1e-37 Click
64371049..4373097 PHAGE_Entero_PsP3: gp24; PP_04477; phage(gi41057376) 1e-73 Click
74373110..4373598 PHAGE_Entero_PsP3: gp25; PP_04478; phage(gi41057377) 1e-32 Click
8complement(4373625..4374224) PHAGE_Entero_2: DNA-invertase; PP_04479; phage(gi169936026) 1e-80 Click
9complement(4374262..4374495) PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_04480; phage(gi148609400) 1e-35 Click
10complement(4374577..4374771) PHAGE_Entero_mEp460: host specificity protein; PP_04481; phage(gi428782334) 2e-31 Click
114375246..4375395 PHAGE_Entero_4795: putative tail component; PP_04482; phage(gi157166057) 5e-17 Click
12complement(4375460..4376335) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp77; PP_04483; phage(gi209447200) 4e-114 Click
13complement(4376348..4376863) PHAGE_Entero_HK106: tail fiber assembly protein; PP_04484; phage(gi428783304) 2e-77 Click
14complement(4376863..4377399) PHAGE_Entero_HK106: side tail fiber protein; PP_04485; phage(gi428783303) 8e-40 Click
15complement(4377455..4377589) hypothetical; PP_04486 0.0 Click
16complement(4377610..4379886) PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; PP_04487; phage(gi15800640) 0.0 Click
17complement(4379917..4380237) PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; PP_04488; phage(gi414087232) 2e-05 Click
184380560..4380784 PHAGE_Lactoc_bIL312: Csp; PP_04489; phage(gi13095918) 3e-14 Click
19complement(4380857..4382803) PHAGE_Plankt_PaV_LD: ABC transporter; PP_04490; phage(gi371496158) 4e-40 Click

Region 13, total : 155 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(4505852..4506460) PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; PP_04612; phage(gi148609405) 8e-103 Click
2complement(4507560..4508552) Non-LEE encoded type III effector C [Escherichia coli O55:H7 str. CB9615] gi|291281765|ref|YP_003498583.1|; PP_04613 0.0 Click
34508168..4508179 attL    ATTGAATATCAT 0.0 Click
4complement(4508613..4509593) PHAGE_Salmon_ST64B: hypothetical protein sb26; PP_04614; phage(gi23505470) 3e-90 Click
5complement(4509770..4511218) PHAGE_Entero_4795: putative tail fiber protein; PP_04615; phage(gi157166060) 0.0 Click
6complement(4511278..4511877) PHAGE_Entero_mEp460: Lom protein; PP_04616; phage(gi428782335) 1e-104 Click
7complement(4511948..4512466) PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_04617; phage(gi148609400) 1e-94 Click
8complement(4512514..4513683) PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_04618; phage(gi148609400) 0.0 Click
9complement(4513744..4514256) PHAGE_Entero_mEp460: tail assembly protein; PP_04619; phage(gi428782333) 6e-87 Click
10complement(4514226..4514648) PHAGE_Entero_mEp460: minor tail protein; PP_04620; phage(gi428782331) 2e-67 Click
11complement(4514658..4514987) PHAGE_Entero_mEp460: minor tail protein; PP_04621; phage(gi428782330) 2e-61 Click
12complement(4514987..4518052) PHAGE_Entero_mEp460: tail length tape measure protein; PP_04622; phage(gi428782329) 0.0 Click
13complement(4518024..4518299) PHAGE_Entero_mEp460: tail assembly protein; PP_04623; phage(gi428782328) 5e-48 Click
14complement(4518362..4518751) PHAGE_Entero_cdtI: putative tail component; PP_04624; phage(gi148609393) 1e-65 Click
15complement(4518809..4519552) PHAGE_Entero_mEp460: major tail protein; PP_04625; phage(gi428782326) 4e-137 Click
16complement(4519563..4519964) PHAGE_Entero_cdtI: putative tail component; PP_04626; phage(gi148609391) 8e-73 Click
17complement(4519961..4520539) PHAGE_Entero_mEp460: minor tail protein; PP_04627; phage(gi428782324) 2e-103 Click
18complement(4520551..4520826) PHAGE_Entero_mEp460: hypothetical protein; PP_04628; phage(gi428782323) 4e-47 Click
19complement(4520819..4521142) PHAGE_Entero_mEp460: hypothetical protein; PP_04629; phage(gi428782322) 1e-54 Click
20complement(4521229..4523187) PHAGE_Entero_mEp213: head maturation protease; PP_04630; phage(gi428782594) 0.0 Click
21complement(4523201..4523563) PHAGE_Entero_mEp460: portal protein; PP_04631; phage(gi428782320) 3e-66 Click
22complement(4523658..4524710) PHAGE_Entero_mEp460: portal protein; PP_04632; phage(gi428782320) 0.0 Click
23complement(4524710..4524922) PHAGE_Entero_mEp460: hypothetical protein; PP_04633; phage(gi428782319) 8e-35 Click
24complement(4524919..4526238) PHAGE_Entero_mEp460: terminase large subunit; PP_04634; phage(gi428782318) 0.0 Click
25complement(4526281..4527021) PHAGE_Entero_mEp460: terminase large subunit; PP_04635; phage(gi428782318) 7e-143 Click
26complement(4527021..4527188) PHAGE_Entero_mEp460: terminase small subunit; PP_04636; phage(gi428782317) 2e-24 Click
27complement(4528186..4528329) PHAGE_Entero_mEp460: hypothetical protein; PP_04637; phage(gi428782374) 1e-19 Click
28complement(4528326..4528793) PHAGE_Salmon_SPN9CC: endopeptidase; PP_04638; phage(gi389060532) 2e-78 Click
29complement(4528790..4528957) PHAGE_Salmon_vB_SemP_Emek: lysin; PP_04639; phage(gi399498856) 5e-27 Click
30complement(4528950..4529096) PHAGE_Stx2_c_1717: holin protein S-like protein; PP_04640; phage(gi209447171) 2e-21 Click
31complement(4529467..4529613) hypothetical; PP_04641 0.0 Click
32complement(4529855..4530544) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_04642; phage(gi169257244) 3e-81 Click
334531019..4531978 systemic factor protein A [Escherichia coli O26:H11 str. 11368] gi|260854026|ref|YP_003227917.1|; PP_04643 0.0 Click
34complement(4532286..4532423) hypothetical protein ECO111_2582 [Escherichia coli O111:H- str. 11128] gi|260868593|ref|YP_003234995.1|; PP_04644 3e-19 Click
35complement(4532582..4533115) PHAGE_Stx2_c_II: endolysin; PP_04645; phage(gi302393165) 3e-102 Click
364533623..4533871 PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; PP_04646; phage(gi148609412) 2e-41 Click
374534521..4535096 PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_04647; phage(gi16129505) 6e-90 Click
38complement(4535140..4535616) serine acetlyltransferase of prophage CP-933T [Escherichia coli O157:H7 str. TW14359] gi|254793550|ref|YP_003078387.1|; PP_04648 4e-88 Click
39complement(4535869..4536357) PROPHAGE_Salmon_Ty2: putative phage tail protein; PP_04649; phage(gi29143763) 1e-39 Click
40complement(4536370..4537071) tail fiber protein of prophage CP-933T [Escherichia coli O157:H7 str. EDL933] gi|15802338|ref|NP_288364.1|; PP_04650 7e-128 Click
41complement(4537083..4538417) PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; PP_04651; phage(gi428782750) 3e-75 Click
424538483..4538890 hypothetical protein ECSP_1433 [Escherichia coli O157:H7 str. TW14359] gi|254792514|ref|YP_003077351.1|; PP_04652 7e-71 Click
434538922..4540361 PROPHAGE_Escher_Sakai: phage transposase; PP_04653; phage(gi15834199) 0.0 Click
444540456..4541388 PHAGE_Entero_Mu: DNA transposition protein; PP_04654; phage(gi9633513) 3e-73 Click
454541391..4541645 hypothetical protein SSON53_15640 [Shigella sonnei 53G] gi|383179631|ref|YP_005457636.1|; PP_04655 3e-23 Click
464541629..4541877 hypothetical protein SSON53_15635 [Shigella sonnei 53G] gi|383179630|ref|YP_005457635.1|; PP_04656 2e-40 Click
474541879..4542067 PHAGE_Pseudo_MP38: host nuclease inhibitor protein; PP_04657; phage(gi215479937) 9e-06 Click
484542156..4542428 hypothetical protein SSON53_15625 [Shigella sonnei 53G] gi|383179628|ref|YP_005457633.1|; PP_04658 1e-32 Click
494542433..4542726 hypothetical protein ROD_46981 [Citrobacter rodentium ICC168] gi|283788236|ref|YP_003368101.1|; PP_04659 2e-45 Click
504542738..4543088 PHAGE_Entero_Mu: Gam; PP_04660; phage(gi9633500) 1e-30 Click
514543094..4543267 PHAGE_Entero_Mu: Gam; PP_04661; phage(gi9633500) 2e-14 Click
524543365..4543907 hypothetical; PP_04662 0.0 Click
534543911..4544444 PHAGE_Entero_Mu: hypothetical protein Mup11; PP_04663; phage(gi9633501) 2e-67 Click
544544444..4544959 PHAGE_Entero_Mu: hypothetical protein Mup12; PP_04664; phage(gi9633502) 4e-48 Click
554544966..4545514 prophage DNA binding protein [Citrobacter rodentium ICC168] gi|283788241|ref|YP_003368106.1|; PP_04665 5e-86 Click
564545550..4545822 hypothetical protein ROD_47041 [Citrobacter rodentium ICC168] gi|283788242|ref|YP_003368107.1|; PP_04666 1e-47 Click
574545795..4546187 hypothetical protein SSON53_15590 [Shigella sonnei 53G] gi|383179621|ref|YP_005457626.1|; PP_04667 4e-54 Click
584546203..4546565 hypothetical protein SSON53_15585 [Shigella sonnei 53G] gi|383179620|ref|YP_005457625.1|; PP_04668 2e-24 Click
594546635..4547159 PHAGE_Entero_Mu: putative transcription regulator; PP_04669; phage(gi9633511) 5e-17 Click
604547131..4547631 PHAGE_Xantho_CP1: hypothetical protein; PP_04670; phage(gi431811023) 5e-28 Click
614547696..4548094 PHAGE_Bacter_2: hypothetical protein APSE213; PP_04671; phage(gi212499718) 1e-05 Click
624548078..4548296 PHAGE_Entero_SfV: putative Rz1 lytic protein; PP_04672; phage(gi19549039) 1e-08 Click
634548306..4548533 PHAGE_Vibrio_VP882: conjugative transfer protein; PP_04673; phage(gi126010902) 2e-05 Click
644548514..4548822 PHAGE_Entero_Mu: hypothetical protein Mup25; PP_04674; phage(gi9633516) 1e-09 Click
654548819..4549109 PHAGE_Entero_Mu: hypothetical protein Mup26; PP_04675; phage(gi9633517) 3e-26 Click
664549112..4549693 PHAGE_Entero_Mu: hypothetical protein Mup27; PP_04676; phage(gi9633518) 6e-55 Click
674549693..4550613 PHAGE_Entero_Mu: putative portal protein; PP_04677; phage(gi9633519) 3e-136 Click
68complement(4550638..4550760) hypothetical; PP_04678 0.0 Click
694550780..4551046 PHAGE_Entero_Mu: putative portal protein; PP_04679; phage(gi9633519) 1e-24 Click
704551021..4551353 PHAGE_Entero_Mu: putative portal protein; PP_04680; phage(gi9633519) 7e-35 Click
714551353..4551745 PHAGE_Entero_Mu: hypothetical protein Mup29; PP_04681; phage(gi9633520) 7e-31 Click
724551760..4552053 PHAGE_Entero_Mu: hypothetical protein Mup29; PP_04682; phage(gi9633520) 3e-13 Click
734552050..4552205 PHAGE_Entero_Mu: hypothetical protein Mup29; PP_04683; phage(gi9633520) 6e-12 Click
744552210..4552584 PHAGE_Entero_Mu: hypothetical protein Mup29; PP_04684; phage(gi9633520) 1e-36 Click
754552636..4552836 hypothetical; PP_04685 0.0 Click
764552820..4553518 PHAGE_Entero_Mu: virion morphogenesis late F orf; PP_04686; phage(gi9633521) 1e-75 Click
774553634..4554758 PHAGE_Entero_Mu: putative protease protein; PP_04687; phage(gi9633523) 3e-81 Click
784554758..4555705 PHAGE_Entero_Mu: major head subunit; PP_04688; phage(gi9633525) 5e-123 Click
794555749..4556117 PHAGE_Entero_Mu: hypothetical protein Mup35; PP_04689; phage(gi9633526) 4e-06 Click
804556114..4556533 PHAGE_Entero_Mu: hypothetical protein Mup36; PP_04690; phage(gi9633527) 2e-28 Click
814556530..4557090 PHAGE_Entero_Mu: hypothetical protein Mup37; PP_04691; phage(gi9633528) 4e-34 Click
824557091..4557336 PHAGE_Entero_Mu: hypothetical protein Mup38; PP_04692; phage(gi9633529) 3e-09 Click
834557333..4558835 PHAGE_Entero_Mu: major tail subunit; PP_04693; phage(gi9633530) 7e-139 Click
844558844..4559209 PHAGE_Entero_Mu: hypothetical protein Mup40; PP_04694; phage(gi9633531) 4e-27 Click
854559224..4559700 PHAGE_Entero_Mu: hypothetical protein Mup41; PP_04695; phage(gi9633532) 3e-24 Click
864559827..4561902 PHAGE_Entero_Mu: putative tape measure protein; PP_04696; phage(gi9633533) 7e-103 Click
874561889..4563238 PHAGE_Entero_Mu: putative DNA circulation protein; PP_04697; phage(gi9633534) 2e-71 Click
884563222..4564346 PHAGE_Entero_Mu: putative tail protein; PP_04698; phage(gi9633535) 6e-92 Click
894564336..4564950 PHAGE_Entero_Mu: putative baseplate assembly protein; PP_04699; phage(gi9633536) 6e-54 Click
904564943..4565380 PHAGE_Entero_Mu: hypothetical protein Mup46; PP_04700; phage(gi9633537) 1e-40 Click
914565380..4566462 PHAGE_Entero_Mu: hypothetical protein Mup47; PP_04701; phage(gi9633538) 2e-100 Click
924566453..4567013 PHAGE_Entero_Mu: hypothetical protein Mup48; PP_04702; phage(gi9633539) 1e-44 Click
934567013..4567912 PHAGE_Entero_Mu: tail fiber; PP_04703; phage(gi9633540) 3e-36 Click
94complement(4567947..4568468) PHAGE_Entero_Mu: tail fiber assembly protein; PP_04704; phage(gi19584573) 6e-18 Click
95complement(4568549..4568695) PROPHAGE_Escher_Sakai: putative tail fiber protein; PP_04705; phage(gi15834245) 1e-22 Click
964568962..4569522 PHAGE_Entero_Mu: Gin; PP_04706; phage(gi9633542) 8e-78 Click
974569622..4571661 PHAGE_Entero_4795: hypothetical protein YjhS; PP_04707; phage(gi157166028) 0.0 Click
984571808..4571990 PHAGE_Escher_P13374: hypothetical protein; PP_04708; phage(gi410491643) 2e-12 Click
994572026..4572271 PHAGE_Escher_TL_2011c: hypothetical protein; PP_04709; phage(gi418487098) 3e-07 Click
1004573265..4573780 PHAGE_Entero_Mu: Mom; PP_04710; phage(gi9633544) 5e-76 Click
1014573869..4574261 PHAGE_Cronob_phiES15: hypothetical protein; PP_04711; phage(gi401817580) 1e-13 Click
1024574263..4574553 PHAGE_Entero_mEp460: hypothetical protein; PP_04712; phage(gi428782365) 9e-21 Click
1034574704..4574862 hypothetical protein ECP_1165 [Escherichia coli 536] gi|110641347|ref|YP_669077.1|; PP_04713 2e-16 Click
1044574943..4575488 PHAGE_Entero_HK630: terminase small subunit nu1; PP_04714; phage(gi428782788) 2e-82 Click
1054575463..4576065 PHAGE_Entero_HK630: terminase large subunit A; PP_04715; phage(gi428782789) 3e-94 Click
106complement(4576157..4576780) PHAGE_Entero_mEp235: hypothetical protein; PP_04716; phage(gi428781847) 1e-109 Click
107complement(4576842..4577225) PHAGE_Stx2_c_86: anti-termination protein N; PP_04717; phage(gi116222050) 6e-68 Click
108complement(4577714..4577878) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip115; PP_04718; phage(gi20065910) 1e-24 Click
109complement(4577881..4578927) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip116; PP_04719; phage(gi20065911) 0.0 Click
110complement(4578921..4579247) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip117; PP_04720; phage(gi20065912) 1e-54 Click
111complement(4579450..4579791) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip119; PP_04721; phage(gi20065914) 2e-64 Click
112complement(4579852..4580559) PHAGE_Stx2_c_I: CI protein; PP_04722; phage(gi20065916) 2e-134 Click
1134580638..4580865 PHAGE_Stx2_c_I: Cro protein; PP_04723; phage(gi20065917) 1e-37 Click
1144581004..4581300 PHAGE_Entero_mEp234: CII protein; PP_04724; phage(gi428782295) 2e-49 Click
1154581333..4581494 PHAGE_Escher_HK75: hypothetical protein; PP_04725; phage(gi356870717) 2e-24 Click
1164581481..4581825 PHAGE_Entero_2008: DNA replication protein; PP_04726; phage(gi209427753) 3e-57 Click
1174582172..4582303 PHAGE_Salmon_SPN9CC: bacteriophage replication protein O; PP_04727; phage(gi389060512) 2e-20 Click
1184582300..4582422 PHAGE_Salmon_vB_SemP_Emek: DnaB helicase; PP_04728; phage(gi399498841) 7e-16 Click
1194582854..4583678 PHAGE_Entero_mEp213: replicative DNA helicase; PP_04729; phage(gi428782646) 6e-151 Click
1204583832..4583951 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip131; PP_04730; phage(gi20065926) 3e-17 Click
1214583966..4584202 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp32; PP_04731; phage(gi209447157) 3e-42 Click
1224584309..4584605 PHAGE_Stx2_c_1717: NinB protein; PP_04732; phage(gi209447158) 1e-53 Click
1234584602..4585129 PHAGE_Stx2_c_1717: putative DNA N-6-adenine-methyltransferase of bacteriophage; PP_04733; phage(gi209447159) 1e-101 Click
1244585428..4585883 PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp07; PP_04734; phage(gi209447132) 2e-87 Click
1254585885..4586061 PHAGE_Entero_2008: hypothetical protein YYZ_gp08; PP_04735; phage(gi209427734) 2e-29 Click
126complement(4586600..4586998) PHAGE_Entero_HK225: head assembly protein Fi; PP_04736; phage(gi428782384) 7e-21 Click
127complement(4587040..4588092) PHAGE_Entero_HK630: major head subunit E; PP_04737; phage(gi428782795) 0.0 Click
128complement(4588121..4588453) PHAGE_Entero_HK630: head decoration protein D; PP_04738; phage(gi428782794) 7e-58 Click
129complement(4588463..4589782) PHAGE_Entero_HK630: head maturation protease C; PP_04739; phage(gi428782792) 0.0 Click
130complement(4589763..4591364) PHAGE_Entero_HK630: portal protein B; PP_04740; phage(gi428782791) 0.0 Click
131complement(4591361..4591567) PHAGE_Entero_HK630: head-tail connector W; PP_04741; phage(gi428782790) 1e-31 Click
132complement(4591564..4592790) PHAGE_Entero_HK630: terminase large subunit A; PP_04742; phage(gi428782789) 0.0 Click
133complement(4592885..4593487) PHAGE_Entero_HK630: terminase large subunit A; PP_04743; phage(gi428782789) 3e-113 Click
134complement(4593462..4594007) PHAGE_Entero_HK630: terminase small subunit nu1; PP_04744; phage(gi428782788) 3e-96 Click
135complement(4594604..4594810) PHAGE_Entero_HK630: hypothetical protein; PP_04745; phage(gi428782856) 1e-32 Click
1364595096..4595506 PHAGE_Entero_HK629: putative envelope protein; PP_04746; phage(gi428782079) 2e-74 Click
1374595798..4596091 PHAGE_Entero_HK630: Bor protein; PP_04747; phage(gi428782854) 6e-50 Click
138complement(4596083..4596370) PHAGE_Entero_HK630: cell lysis protein Rz; PP_04748; phage(gi428782852) 2e-39 Click
139complement(4596367..4596843) PHAGE_Escher_HK75: lysozyme; PP_04749; phage(gi356870730) 6e-85 Click
140complement(4596830..4597135) PHAGE_Salmon_ST160: Gp13; PP_04750; phage(gi318065943) 3e-39 Click
141complement(4597457..4598146) PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_04751; phage(gi169257244) 4e-84 Click
142complement(4598143..4598283) PHAGE_Entero_mEp237: hypothetical protein; PP_04752; phage(gi435439319) 4e-12 Click
143complement(4598280..4598642) PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_04753; phage(gi435439318) 3e-61 Click
144complement(4598639..4598929) PHAGE_Entero_mEp237: hypothetical protein; PP_04754; phage(gi435439317) 3e-48 Click
145complement(4598922..4599092) PHAGE_Escher_HK639: NinE; PP_04755; phage(gi356870663) 1e-14 Click
146complement(4599092..4599547) PHAGE_Cronob_phiES15: hypothetical protein; PP_04756; phage(gi401817579) 3e-58 Click
1474599730..4599741 attR    ATTGAATATCAT 0.0 Click
148complement(4600049..4601575) PHAGE_Bacill_WBeta: putative site-specific recombinase; PP_04757; phage(gi85701406) 5e-09 Click
149complement(4601633..4601755) hypothetical protein NRG857_05587 [Escherichia coli O83:H1 str. NRG 857C] gi|387616458|ref|YP_006119480.1|; PP_04758 6e-06 Click
150complement(4601820..4602152) PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; PP_04759; phage(gi311992758) 1e-10 Click
151complement(4602220..4602522) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; PP_04760; phage(gi20065923) 6e-44 Click
152complement(4602519..4603220) PHAGE_Entero_4795: putative replication protein P; PP_04761; phage(gi157166012) 1e-131 Click
153complement(4603217..4604041) PHAGE_Entero_4795: putative replication protein O; PP_04762; phage(gi157166011) 1e-99 Click
1544604371..4605513 PHAGE_Entero_mEp235: integrase; PP_04763; phage(gi428781836) 5e-61 Click
155complement(4605627..4606877) isocitrate dehydrogenase [NADP] [Escherichia coli O55:H7 str. CB9615] gi|291282171|ref|YP_003498989.1|; PP_04764 0.0 Click
1564607079..4607702 ribosomal large subunit pseudouridine synthase E [Escherichia coli O55:H7 str. CB9615] gi|291282170|ref|YP_003498988.1|; PP_04765 3e-117 Click
1574607712..4608173 PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; PP_04766; phage(gi34419395) 6e-05 Click

Region 14, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
14840598..4840609 attL    TTCTGATAAACT 0.0 Click
2complement(4845318..4845602) PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf2; PP_05021; phage(gi26989833) 4e-17 Click
3complement(4845840..4847336) PHAGE_Entero_HK629: tail fiber; PP_05022; phage(gi428782032) 0.0 Click
4complement(4847397..4847921) PHAGE_Entero_HK629: tail component protein; PP_05023; phage(gi428782031) 2e-92 Click
5complement(4847903..4848325) PHAGE_Entero_HK629: minor tail protein; PP_05024; phage(gi428782029) 7e-68 Click
6complement(4848325..4848654) PHAGE_Entero_HK629: minor tail protein; PP_05025; phage(gi428782028) 1e-56 Click
7complement(4848651..4851200) PHAGE_Entero_HK629: tail length tape measure protein; PP_05026; phage(gi428782027) 0.0 Click
8complement(4851193..4851627) PHAGE_Entero_HK629: tail assembly protein; PP_05027; phage(gi428782026) 4e-81 Click
9complement(4851609..4852031) PHAGE_Entero_HK629: minor tail protein; PP_05028; phage(gi428782025) 2e-73 Click
10complement(4852047..4852787) PHAGE_Entero_HK629: major tail protein; PP_05029; phage(gi428782024) 3e-133 Click
11complement(4852795..4853190) PHAGE_Entero_HK629: minor tail protein; PP_05030; phage(gi428782023) 2e-72 Click
12complement(4853187..4853765) PHAGE_Entero_HK629: minor tail protein; PP_05031; phage(gi428782022) 6e-101 Click
13complement(4853777..4854043) PHAGE_Entero_HK629: head-tail connector Fii; PP_05032; phage(gi428782021) 5e-44 Click
144854321..4854464 PHAGE_Entero_2008: hypothetical protein YYZ_gp04; PP_05033; phage(gi209427730) 7e-21 Click
154854468..4854602 PHAGE_Entero_2008: hypothetical protein YYZ_gp03; PP_05034; phage(gi209427729) 3e-23 Click
164854735..4854875 PHAGE_Entero_2008: putative excisionase; PP_05035; phage(gi209427728) 8e-23 Click
174854909..4856195 PHAGE_Entero_2008: putative integrase; PP_05036; phage(gi209427727) 0.0 Click
184856270..4856917 DNA-binding transcriptional regulator [Escherichia coli O157:H7 str. TW14359] gi|254794019|ref|YP_003078856.1|; PP_05037 7e-123 Click
19complement(4857065..4857796) transport system permease [Shigella sonnei Ss046] gi|74312652|ref|YP_311071.1|; PP_05038 2e-129 Click
20complement(4857801..4858727) PHAGE_Plankt_PaV_LD: ABC transporter; PP_05039; phage(gi371496158) 4e-25 Click
214870791..4870802 attR    TTCTGATAAACT 0.0 Click

Region 15, total : 6 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15104055..5104070 attL    TTCGATTCCTGCAGGG 0.0 Click
2complement(5104082..5104240) PHAGE_Entero_HK633: hypothetical protein; PP_05267; phage(gi428782546) 7e-16 Click
35104239..5105396 PROPHAGE_Escher_Sakai: putative prophage Sf6-like integrase; PP_05268; phage(gi15832485) 0.0 Click
4complement(5105571..5106707) PHAGE_Entero_IME10: gp20; PP_05269; phage(gi422934289) 2e-67 Click
5complement(5106717..5107397) PHAGE_Entero_IME10: DNA transfer protein; PP_05270; phage(gi422934288) 7e-75 Click
6complement(5107384..5107851) PHAGE_Sodali_phiSG1: hypothetical protein SGPHI_0018; PP_05271; phage(gi89885999) 2e-64 Click
7complement(5107851..5108420) PHAGE_Entero_Sf6: gene 9 protein; PP_05272; phage(gi41057287) 3e-93 Click
85112607..5112622 attR    TTCGATTCCTGCAGGG 0.0 Click

Region 16, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15347666..5347677 attL    CACTGCTGCACG 0.0 Click
2complement(5354151..5355143) PHAGE_Burkho_phi1026b: gp59; PP_05499; phage(gi38707949) 9e-30 Click
35355128..5355691 hypothetical protein ECIAI39_2796 [Escherichia coli IAI39] gi|218701103|ref|YP_002408732.1|; PP_05500 4e-25 Click
45355832..5356041 prophage DNA binding protein [Citrobacter rodentium ICC168] gi|283788241|ref|YP_003368106.1|; PP_05501 2e-26 Click
55356038..5356223 hypothetical; PP_05502 0.0 Click
65356262..5356522 hypothetical protein SSON53_15585 [Shigella sonnei 53G] gi|383179620|ref|YP_005457625.1|; PP_05503 7e-26 Click
7complement(5356526..5356602) tRNA 0.0 Click
8complement(5356703..5356778) tRNA 0.0 Click
9complement(5356807..5357394) AraC family transcriptional regulator [Escherichia coli O157:H7 str. TW14359] gi|254793118|ref|YP_003077955.1|; PP_05504 7e-106 Click
10complement(5357915..5358469) PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; PP_05505; phage(gi399528832) 9e-07 Click
11complement(5358504..5359127) PHAGE_Entero_mEp460: hypothetical protein; PP_05506; phage(gi428782365) 8e-48 Click
12complement(5359490..5359834) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; PP_05507; phage(gi20065865) 8e-59 Click
13complement(5360400..5360957) PHAGE_Escher_TL_2011c: hypothetical protein; PP_05508; phage(gi418487081) 6e-28 Click
14complement(5361305..5361616) PHAGE_Entero_mEp213: hypothetical protein; PP_05509; phage(gi428782634) 9e-21 Click
15complement(5361609..5361836) PHAGE_Escher_TL_2011c: hypothetical protein; PP_05510; phage(gi418487076) 1e-08 Click
16complement(5361833..5362087) hypothetical protein ECO26_2658 [Escherichia coli O26:H11 str. 11368] gi|260855747|ref|YP_003229638.1|; PP_05511 6e-40 Click
17complement(5362147..5362863) hypothetical protein ECSP_2069 [Escherichia coli O157:H7 str. TW14359] gi|254793127|ref|YP_003077964.1|; PP_05512 2e-131 Click
18complement(5362897..5363358) PHAGE_Escher_HK639: replication protein 14; PP_05513; phage(gi356870655) 5e-29 Click
19complement(5363351..5364394) PHAGE_Escher_TL_2011b: hypothetical protein; PP_05514; phage(gi418487646) 3e-48 Click
205364719..5365357 PHAGE_Pectob_ZF40: putative cI repressor; PP_05515; phage(gi422936650) 2e-18 Click
215365650..5365802 PHAGE_Salico_CGphi29: hypothetical protein; PP_05516; phage(gi472340166) 5e-09 Click
225365814..5366452 PHAGE_Escher_TL_2011c: hypothetical protein; PP_05517; phage(gi418487085) 6e-09 Click
23complement(5366453..5366674) hypothetical protein ECO26_2275 [Escherichia coli O26:H11 str. 11368] gi|260855375|ref|YP_003229266.1|; PP_05518 3e-32 Click
245366961..5367149 putative cell division inhibition protein [Escherichia coli O7:K1 str. CE10] gi|386623805|ref|YP_006143533.1|; PP_05519 6e-28 Click
255367146..5367334 hypothetical protein ECO26_2278 [Escherichia coli O26:H11 str. 11368] gi|260855378|ref|YP_003229269.1|; PP_05520 2e-27 Click
265367427..5368032 PHAGE_Entero_mEp237: exonuclease; PP_05521; phage(gi435439296) 2e-09 Click
275368142..5368672 PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; PP_05522; phage(gi169257272) 1e-74 Click
285368543..5368554 attR    CACTGCTGCACG 0.0 Click
295368783..5369205 PHAGE_Entero_2008: putative integrase; PP_05523; phage(gi209427727) 2e-48 Click