Escherichia coli FVEC1302 .1, whole genome shotgun sequence. [asmbl_id: NC_000000].5291786, GC%: 50.63%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 44 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11196900..1196946 attL    CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT 0.0 Click
2complement(1196960..1198123) PHAGE_Salmon_epsilon34: Tyrosine integrase; PP_01203; phage(gi221328640) 0.0 Click
3complement(1198648..1198866) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF8; PP_01204; phage(gi157165993) 7e-34 Click
4complement(1198959..1199180) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_01205; phage(gi20065893) 5e-35 Click
5complement(1199257..1199370) PHAGE_Entero_HK630: hypothetical protein; PP_01206; phage(gi428782820) 2e-13 Click
6complement(1199600..1200280) PHAGE_Entero_4795: putative exonuclease; PP_01207; phage(gi157165997) 4e-132 Click
7complement(1200277..1201062) PHAGE_Stx2_c_I: Bet protein; PP_01208; phage(gi20065900) 2e-151 Click
8complement(1201068..1201295) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_01209; phage(gi116222045) 2e-37 Click
9complement(1201292..1201624) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_01210; phage(gi116222045) 5e-30 Click
10complement(1201700..1201906) PHAGE_Entero_mEp237: Kil protein; PP_01211; phage(gi435439298) 7e-29 Click
11complement(1202389..1203321) PHAGE_Entero_mEpX1: hypothetical protein; PP_01212; phage(gi428781913) 4e-90 Click
12complement(1203873..1204487) PHAGE_Entero_ST104: CI; PP_01213; phage(gi46358671) 3e-89 Click
131204667..1204897 PHAGE_Escher_HK639: cro; PP_01214; phage(gi356870651) 2e-19 Click
141204967..1205506 PHAGE_Entero_mEp237: CII protein; PP_01215; phage(gi435439306) 5e-64 Click
151205503..1206522 PHAGE_Stx2_c_I: O protein; PP_01216; phage(gi20065919) 3e-114 Click
161206519..1207220 PHAGE_Entero_4795: putative replication protein P; PP_01217; phage(gi157166012) 8e-130 Click
171207217..1207519 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; PP_01218; phage(gi20065923) 3e-45 Click
18complement(1207983..1209269) PHAGE_Entero_ES18: gp19; PP_01219; phage(gi62362232) 5e-87 Click
191210082..1210690 PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p08; PP_01220; phage(gi31544005) 3e-33 Click
201211184..1211450 hypothetical protein O3K_17695 [Escherichia coli O104:H4 str. 2011C-3493] gi|407483064|ref|YP_006780213.1|; PP_01221 3e-31 Click
211211629..1212084 PHAGE_Cronob_phiES15: hypothetical protein; PP_01222; phage(gi401817579) 1e-61 Click
221212247..1212537 PHAGE_Entero_mEp237: hypothetical protein; PP_01223; phage(gi435439317) 5e-48 Click
231212534..1212896 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_01224; phage(gi435439318) 1e-61 Click
241212893..1213030 PHAGE_Entero_mEp237: hypothetical protein; PP_01225; phage(gi435439319) 2e-09 Click
251213116..1213499 PHAGE_Entero_2008: antitermination protein Q; PP_01226; phage(gi209427762) 6e-57 Click
26complement(1213689..1214771) outer membrane porin [Escherichia coli S88] gi|218558048|ref|YP_002390961.1|; PP_01227 0.0 Click
271215345..1215560 PHAGE_Stx2_c_II: holin; PP_01228; phage(gi302393164) 4e-28 Click
281215560..1216057 PHAGE_Stx2_c_1717: phage-related lysozyme; PP_01229; phage(gi209447172) 3e-87 Click
291216054..1216521 PHAGE_Salmon_SPN9CC: endopeptidase; PP_01230; phage(gi389060532) 2e-78 Click
301216518..1216661 PHAGE_Entero_mEp460: hypothetical protein; PP_01231; phage(gi428782374) 4e-20 Click
31complement(1217471..1217590) hypothetical; PP_01232 0.0 Click
321217820..1217963 hypothetical protein ECIAI1_1590 [Escherichia coli IAI1] gi|218554109|ref|YP_002387022.1|; PP_01233 5e-19 Click
331218103..1218498 PHAGE_Entero_mEp237: terminase small subunit nu1; PP_01234; phage(gi435439266) 1e-58 Click
341218896..1219258 PHAGE_Entero_mEp237: Holliday junction resolvase RusA; PP_01235; phage(gi435439318) 1e-61 Click
351219255..1219395 PHAGE_Entero_mEp237: hypothetical protein; PP_01236; phage(gi435439319) 5e-11 Click
361219481..1220185 PHAGE_Entero_mEp237: terminase small subunit nu1; PP_01237; phage(gi435439266) 4e-84 Click
371220340..1220903 PHAGE_Entero_mEp237: terminase large subunit A; PP_01238; phage(gi435439267) 9e-93 Click
381221072..1221224 regulatory peptide MokC [Shigella sonnei 53G] gi|383177147|ref|YP_005455152.1|; PP_01239 3e-20 Click
39complement(1221333..1221521) hypothetical; PP_01240 0.0 Click
401221486..1223600 PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_01241; phage(gi148609400) 0.0 Click
41complement(1224023..1224571) PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_01242; phage(gi399528893) 1e-05 Click
421224595..1224786 hypothetical protein CE10_1789 [Escherichia coli O7:K1 str. CE10] gi|386624138|ref|YP_006143866.1|; PP_01243 2e-19 Click
431224783..1226030 PHAGE_Escher_bV_EcoS_AKFV33: putative tail fiber protein; PP_01244; phage(gi388570497) 2e-56 Click
441226027..1226308 hypothetical protein CE10_1786 [Escherichia coli O7:K1 str. CE10] gi|386624137|ref|YP_006143865.1|; PP_01245 2e-46 Click
451226318..1227022 PHAGE_Brocho_BL3: gp19; PP_01246; phage(gi327409411) 1e-07 Click
461230377..1230423 attR    CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT 0.0 Click

Region 2, total : 54 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11453997..1454011 attL    GCTTTTTTATACTAA 0.0 Click
2complement(1454085..1455155) PHAGE_Entero_HK97: integrase; PP_01480; phage(gi9634162) 0.0 Click
3complement(1455466..1455810) PHAGE_Entero_SfV: hypothetical protein SfVp28; PP_01481; phage(gi19549015) 8e-33 Click
4complement(1455807..1456685) PHAGE_Entero_lambda: NinC protein; PP_01482; phage(gi9626299) 2e-143 Click
5complement(1456676..1457212) PHAGE_Salmon_ST64B: hypothetical protein sb35; PP_01483; phage(gi23505479) 5e-66 Click
6complement(1457340..1458164) PHAGE_Salmon_ST64B: hypothetical protein sb36; PP_01484; phage(gi23505480) 6e-85 Click
7complement(1458230..1458592) PHAGE_Salmon_ST64B: hypothetical protein sb37; PP_01485; phage(gi23505481) 2e-33 Click
81459286..1459495 hypothetical protein EFER_0579 [Escherichia fergusonii ATCC 35469] gi|218547974|ref|YP_002381765.1|; PP_01486 2e-35 Click
9complement(1459467..1459673) hypothetical protein APECO78_04690 [Escherichia coli APEC O78] gi|443616263|ref|YP_007380119.1|; PP_01487 3e-31 Click
10complement(1460021..1460668) PHAGE_Salmon_ST64B: regulatory protein; PP_01488; phage(gi23505482) 4e-95 Click
111460811..1461071 PHAGE_Salmon_ST64B: DNA binding protein; PP_01489; phage(gi23505483) 4e-25 Click
121461064..1461615 PHAGE_Salmon_ST64B: hypothetical protein sb40; PP_01490; phage(gi23505484) 2e-33 Click
131461960..1462598 PHAGE_Entero_phiP27: hypothetical protein P27p17; PP_01491; phage(gi18249881) 3e-41 Click
141462606..1462902 PHAGE_Entero_HK140: DNA replication protein O; PP_01492; phage(gi428781991) 1e-13 Click
151462899..1463387 PHAGE_Salmon_ST64B: putative transcriptional activator; PP_01493; phage(gi23505487) 4e-59 Click
161463387..1463713 PHAGE_Entero_cdtI: RecA-mediated autopeptidases; PP_01494; phage(gi148609430) 2e-54 Click
171463710..1464099 PHAGE_Salmon_ST64B: holiday-junction resolvase; PP_01495; phage(gi23505489) 1e-58 Click
181464119..1464928 PHAGE_Salmon_ST64B: hypothetical protein sb46; PP_01496; phage(gi23505490) 2e-114 Click
191464936..1465925 PHAGE_Salmon_ST64B: hypothetical protein sb47; PP_01497; phage(gi23505491) 1e-118 Click
20complement(1466279..1467493) hypothetical protein O3O_15225 [Escherichia coli O104:H4 str. 2009EL-2071] gi|407469710|ref|YP_006783847.1|; PP_01498 0.0 Click
21complement(1467496..1468671) PHAGE_Pseudo_F116: nucleoid-associated protein; PP_01499; phage(gi56692913) 8e-09 Click
221469041..1469289 PHAGE_Entero_SfV: holin; PP_01500; phage(gi19549036) 2e-41 Click
231469293..1469769 PHAGE_Entero_SfV: lysin; PP_01501; phage(gi19549037) 2e-89 Click
241469753..1470145 PHAGE_Entero_SfV: putative Rz lytic protein; PP_01502; phage(gi19549038) 1e-64 Click
251470102..1470287 PHAGE_Entero_SfV: putative Rz1 lytic protein; PP_01503; phage(gi19549039) 2e-24 Click
261470706..1471056 PHAGE_Salmon_ST64B: hypothetical protein sb56; PP_01504; phage(gi23505500) 2e-64 Click
271471182..1471676 PHAGE_Salmon_ST64B: terminase small subunit; PP_01505; phage(gi23505446) 1e-84 Click
281471673..1473406 PHAGE_Salmon_ST64B: Terminase large subunit; PP_01506; phage(gi23505447) 0.0 Click
291473424..1473600 PHAGE_Salmon_ST64B: putative integral membrane protein; PP_01507; phage(gi23505448) 2e-27 Click
301473600..1474841 PHAGE_Salmon_ST64B: Portal Protein; PP_01508; phage(gi23505449) 0.0 Click
311474819..1475469 PHAGE_Salmon_ST64B: Pro-head protease; PP_01509; phage(gi23505450) 4e-117 Click
321475484..1476689 PHAGE_Salmon_ST64B: Major capsid protein precursor; PP_01510; phage(gi23505451) 0.0 Click
331476738..1476938 PHAGE_Salmon_ST64B: hypothetical protein sb7; PP_01511; phage(gi23505452) 3e-23 Click
341476941..1477264 PHAGE_Salmon_ST64B: hypothetical protein sb8; PP_01512; phage(gi23505453) 3e-52 Click
351477261..1477671 PHAGE_Salmon_ST64B: hypothetical protein sb9; PP_01513; phage(gi23505454) 1e-40 Click
36complement(1477622..1477747) hypothetical; PP_01514 0.0 Click
371477748..1478152 PHAGE_Salmon_ST64B: hypothetical protein sb10; PP_01515; phage(gi23505455) 2e-57 Click
381478149..1478709 PHAGE_Salmon_ST64B: hypothetical protein sb11; PP_01516; phage(gi23505456) 6e-76 Click
391478718..1478888 PHAGE_Salmon_ST64B: hypothetical protein sb12; PP_01517; phage(gi23505457) 5e-22 Click
401478872..1480368 PHAGE_Salmon_ST64B: Tail Sheath protein; PP_01518; phage(gi23505458) 0.0 Click
411480368..1480724 PHAGE_Salmon_ST64B: Tail tube protein; PP_01519; phage(gi23505459) 6e-52 Click
421480721..1481044 PHAGE_Salmon_ST64B: hypothetical protein sb15; PP_01520; phage(gi23505501) 2e-37 Click
431481129..1483036 PHAGE_Salmon_ST64B: tail protein; PP_01521; phage(gi23505460) 0.0 Click
441483061..1484437 PHAGE_Salmon_ST64B: tail/DNA circulation protein; PP_01522; phage(gi23505461) 5e-99 Click
451484434..1485513 PHAGE_Salmon_ST64B: Tail protein; PP_01523; phage(gi23505462) 2e-135 Click
461485513..1486061 PHAGE_Salmon_ST64B: putative base plate assembly protein; PP_01524; phage(gi23505463) 7e-58 Click
471486061..1486486 PHAGE_Salmon_ST64B: putative tail protein; PP_01525; phage(gi23505464) 2e-40 Click
481486473..1487531 PHAGE_Salmon_ST64B: putative head assembly protein; PP_01526; phage(gi23505465) 2e-52 Click
491487522..1488106 PHAGE_Salmon_ST64B: putative tail protein; PP_01527; phage(gi23505467) 7e-61 Click
501488110..1489042 PHAGE_Klebsi_JD001: putative tail-fiber protein; PP_01528; phage(gi448245166) 1e-50 Click
511489043..1489447 PHAGE_Entero_HK630: tail fiber assembly protein; PP_01529; phage(gi428782810) 2e-19 Click
52complement(1489749..1491236) PHAGE_Entero_ST64T: O-antigen conversion protein C; PP_01530; phage(gi24371535) 9e-35 Click
53complement(1491223..1492152) PHAGE_Salmon_SPN9CC: O-antigen conversion protein; PP_01531; phage(gi389060490) 1e-158 Click
541492855..1492869 attR    GCTTTTTTATACTAA 0.0 Click
55complement(1492960..1493436) putative phosphatidylethanolamine-binding protein [Escherichia coli 042] gi|387606322|ref|YP_006095178.1|; PP_01532 1e-91 Click
56complement(1493495..1494727) PHAGE_Mycoba_Myrna: gp183; PP_01533; phage(gi203454746) 3e-06 Click

Region 3, total : 138 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11857641..1857652 attL    AATCAAAATAAT 0.0 Click
2complement(1857885..1859003) PHAGE_Entero_mEp235: integrase; PP_01888; phage(gi428781836) 2e-52 Click
3complement(1858972..1859241) putative excisionase for prophage [Escherichia coli str. 'clone D i2'] gi|386628767|ref|YP_006148487.1|; PP_01889 3e-46 Click
4complement(1859303..1859527) PHAGE_Entero_mEp460: putative exonuclease; PP_01890; phage(gi428782342) 1e-23 Click
5complement(1859668..1861998) PHAGE_Salmon_SPN3UB: RecE; PP_01891; phage(gi423262421) 4e-101 Click
6complement(1862076..1862279) phage protein [Escherichia coli 042] gi|387606768|ref|YP_006095624.1|; PP_01892 4e-32 Click
7complement(1862475..1863329) PHAGE_Entero_mEp460: regulatory protein Rha; PP_01893; phage(gi428782357) 1e-65 Click
81863562..1863708 phage protein [Salmonella enterica subsp. enterica serovar Enteritidis str. P125109] gi|207857405|ref|YP_002244056.1|; PP_01894 1e-05 Click
9complement(1863860..1864234) PHAGE_Escher_TL_2011c: hypothetical protein; PP_01895; phage(gi418487085) 4e-06 Click
10complement(1864246..1864398) PHAGE_Salico_CGphi29: hypothetical protein; PP_01896; phage(gi472340166) 8e-09 Click
11complement(1864605..1865012) PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; PP_01897; phage(gi401817574) 1e-32 Click
121865089..1865316 PHAGE_Pectob_ZF40: putative cro anti-repressor; PP_01898; phage(gi422936651) 2e-09 Click
131865300..1865851 hypothetical protein EC55989_1031 [Escherichia coli 55989] gi|218694457|ref|YP_002402124.1|; PP_01899 2e-101 Click
141865823..1866863 PHAGE_Escher_TL_2011b: hypothetical protein; PP_01900; phage(gi418487646) 1e-43 Click
151866895..1867317 PHAGE_Escher_HK639: replication protein 14; PP_01901; phage(gi356870655) 1e-28 Click
161867351..1868121 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; PP_01902; phage(gi116222030) 6e-06 Click
171868137..1868529 putative phage regulatory protein [Escherichia coli 042] gi|387606780|ref|YP_006095636.1|; PP_01903 6e-69 Click
181868532..1868822 PHAGE_Klebsi_phiKO2: Gp58; PP_01904; phage(gi46402144) 2e-27 Click
191868819..1869280 PHAGE_Entero_lambda: ea22; PP_01905; phage(gi9626276) 3e-11 Click
201869258..1869614 PHAGE_Stx2_c_I: hypothetical protein Stx2Ip073; PP_01906; phage(gi20065868) 9e-08 Click
211869710..1870117 PHAGE_Entero_2008: hypothetical protein YYZ_gp06; PP_01907; phage(gi209427732) 2e-25 Click
221870119..1870484 PHAGE_Entero_HK225: HNH endonuclease; PP_01908; phage(gi428782431) 2e-35 Click
231870481..1871467 PHAGE_Escher_P13374: hypothetical protein; PP_01909; phage(gi410491607) 7e-40 Click
241871588..1871767 hypothetical protein ECW_m1725 [Escherichia coli W] gi|386608951|ref|YP_006124437.1|; PP_01910 2e-26 Click
251872571..1872822 hypothetical protein SFV_1543 [Shigella flexneri 5 str. 8401] gi|110805507|ref|YP_689027.1|; PP_01911 6e-40 Click
261873169..1874227 PHAGE_Entero_mEp460: hypothetical protein; PP_01912; phage(gi428782365) 3e-91 Click
271874228..1874596 PHAGE_Escher_HK75: RusA-like protein; PP_01913; phage(gi356870726) 2e-35 Click
281874589..1875278 PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; PP_01914; phage(gi169257244) 7e-72 Click
291875491..1875688 PHAGE_Entero_phiP27: hypothetical protein P27p23; PP_01915; phage(gi18249887) 1e-27 Click
301875664..1875777 hypothetical; PP_01916 0.0 Click
31complement(1876059..1876244) PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; PP_01917; phage(gi209447168) 8e-22 Click
32complement(1876520..1876669) hypothetical protein i02_1307 [Escherichia coli str. 'clone D i2'] gi|386628791|ref|YP_006148511.1|; PP_01918 3e-20 Click
331876655..1876843 PHAGE_Entero_2008: hypothetical protein YYZ_gp42; PP_01919; phage(gi209427766) 5e-29 Click
341876840..1877001 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp03; PP_01920; phage(gi116221995) 2e-16 Click
351877160..1877366 PHAGE_Stx2_c_II: holin; PP_01921; phage(gi302393164) 2e-33 Click
361877371..1878261 PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp05; PP_01922; phage(gi116221997) 2e-109 Click
371878298..1878831 PHAGE_Entero_4795: putative R protein; PP_01923; phage(gi157166033) 2e-102 Click
381879024..1879170 hypothetical protein ECED1_1125 [Escherichia coli ED1a] gi|218688934|ref|YP_002397146.1|; PP_01924 2e-18 Click
391879185..1879316 PHAGE_Escher_P13374: hypothetical protein; PP_01925; phage(gi410491648) 5e-12 Click
401879328..1879786 PHAGE_Entero_4795: putative endopeptidase Rz; PP_01926; phage(gi157166036) 4e-68 Click
411880630..1880767 hypothetical protein ECS88_1189 [Escherichia coli S88] gi|218558054|ref|YP_002390967.1|; PP_01927 1e-17 Click
42complement(1880974..1881090) hypothetical protein ECIAI39_1981 [Escherichia coli IAI39] gi|218700323|ref|YP_002407952.1|; PP_01928 6e-14 Click
431881382..1881891 PHAGE_Entero_N15: gp1; PP_01929; phage(gi9630465) 4e-19 Click
441881944..1883791 PHAGE_Entero_lambda: DNA packaging protein; PP_01930; phage(gi9626245) 0.0 Click
451883775..1883981 PHAGE_Entero_mEp237: head-tail connector; PP_01931; phage(gi435439268) 5e-13 Click
461883978..1885570 PHAGE_Gifsy_1: bacteriophage portal protein; Lambda gpB homolog; PP_01932; phage(gi169257233) 0.0 Click
471885560..1887008 PHAGE_Entero_lambda: capsid component; PP_01933; phage(gi9626248) 1e-107 Click
481887045..1887392 PHAGE_Entero_lambda: head-DNA stabilization protein; PP_01934; phage(gi9626250) 6e-25 Click
491887450..1888478 PHAGE_Entero_lambda: capsid component; PP_01935; phage(gi9626251) 2e-118 Click
501888530..1888904 PHAGE_Entero_HK225: head assembly protein Fi; PP_01936; phage(gi428782384) 1e-07 Click
511888897..1889250 PHAGE_Entero_lambda: head-tail joining protein; PP_01937; phage(gi9626253) 5e-43 Click
521889266..1889799 PHAGE_Entero_lambda: tail component; PP_01938; phage(gi9626254) 8e-64 Click
531889796..1890191 PHAGE_Entero_lambda: tail component; PP_01939; phage(gi9626255) 8e-59 Click
541890199..1890948 PHAGE_Entero_lambda: tail component; PP_01940; phage(gi9626256) 1e-109 Click
551890967..1891398 PHAGE_Entero_lambda: tail component; PP_01941; phage(gi9626257) 2e-46 Click
561891449..1891838 PHAGE_Entero_lambda: tail component; PP_01942; phage(gi9626258) 7e-43 Click
571891819..1893480 PHAGE_Entero_lambda: tail component; PP_01943; phage(gi9626259) 0.0 Click
581893506..1894564 PHAGE_Entero_lambda: tail component; PP_01944; phage(gi9626259) 0.0 Click
591894561..1894890 PHAGE_Entero_lambda: tail component; PP_01945; phage(gi9626260) 2e-45 Click
601894890..1895588 PHAGE_Entero_2008: putative tail protein; PP_01946; phage(gi209427787) 4e-127 Click
611895599..1896342 PHAGE_Entero_4795: putative tail fiber component; PP_01947; phage(gi157166055) 2e-148 Click
621896339..1896920 PHAGE_Stx2_c_1717: putative tail component; PP_01948; phage(gi209447195) 3e-104 Click
631897264..1900956 PHAGE_Entero_2008: phage-related tail protein; PP_01949; phage(gi209427791) 0.0 Click
641901024..1901623 PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; PP_01950; phage(gi148609401) 3e-107 Click
65complement(1902272..1902886) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01951; phage(gi9626267) 6e-53 Click
66complement(1902898..1903059) hypothetical; PP_01952 0.0 Click
67complement(1903061..1903207) PHAGE_Entero_lambda: hypothetical protein lambdap90; PP_01953; phage(gi9626267) 8e-12 Click
681903284..1904801 PHAGE_Entero_lambda: Tail fiber; PP_01954; phage(gi9626268) 1e-89 Click
691904801..1905385 PHAGE_Entero_lambda: Putative fiber assembly protein; PP_01955; phage(gi9626269) 2e-104 Click
70complement(1905440..1905613) hypothetical protein SSON_2178 [Shigella sonnei Ss046] gi|74312645|ref|YP_311064.1|; PP_01956 3e-25 Click
711906165..1906431 PHAGE_Entero_lambda: Putative fiber assembly protein; PP_01957; phage(gi9626269) 1e-19 Click
72complement(1906663..1907496) spermidine/putrescine ABC transporter membrane protein [Escherichia coli O127:H6 str. E2348/69] gi|215486379|ref|YP_002328810.1|; PP_01958 1e-153 Click
73complement(1907510..1908646) PHAGE_Plankt_PaV_LD: ABC transporter; PP_01959; phage(gi371496158) 7e-27 Click
74complement(1908625..1908840) hypothetical protein i02_1348 [Escherichia coli str. 'clone D i2'] gi|386628832|ref|YP_006148552.1|; PP_01960 2e-35 Click
751908896..1910122 peptidase T [Shigella sonnei Ss046] gi|74311686|ref|YP_310105.1|; PP_01961 0.0 Click
76complement(1910171..1911292) YcfD protein [Escherichia coli O55:H7 str. CB9615] gi|291282146|ref|YP_003498964.1|; PP_01962 0.0 Click
77complement(1911368..1912828) sensor protein PhoQ [Escherichia coli O55:H7 str. CB9615] gi|291282164|ref|YP_003498982.1|; PP_01963 0.0 Click
78complement(1912828..1913499) DNA-binding transcriptional regulator PhoP [Shigella sonnei Ss046] gi|74311689|ref|YP_310108.1|; PP_01964 3e-121 Click
79complement(1913668..1915038) adenylosuccinate lyase [Escherichia coli str. 'clone D i2'] gi|386628837|ref|YP_006148557.1|; PP_01965 0.0 Click
80complement(1915042..1915683) hypothetical protein ECDH1ME8569_1067 [Escherichia coli DH1] gi|387620841|ref|YP_006128468.1|; PP_01966 5e-113 Click
81complement(1915719..1916825) tRNA (5-methylaminomethyl-2-thiouridylate)- methyltransferase [Escherichia coli SE15] gi|387829086|ref|YP_003349023.1|; PP_01967 0.0 Click
82complement(1916879..1917340) PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; PP_01968; phage(gi34419395) 5e-05 Click
83complement(1917350..1917973) ribosomal large subunit pseudouridine synthase E (rRNA pseudouridylate synthase E) [Escherichia coli 042] gi|387606661|ref|YP_006095517.1|; PP_01969 2e-115 Click
841918175..1919425 isocitrate dehydrogenase [Shigella flexneri 5 str. 8401] gi|110805164|ref|YP_688684.1|; PP_01970 0.0 Click
85complement(1919539..1920681) PHAGE_Entero_mEp235: integrase; PP_01971; phage(gi428781836) 1e-61 Click
86complement(1921047..1921163) hypothetical protein i02_1361 [Escherichia coli str. 'clone D i2'] gi|386628845|ref|YP_006148565.1|; PP_01972 5e-14 Click
87complement(1921334..1921552) PHAGE_Entero_4795: hypothetical protein PBV4795_ORF8; PP_01973; phage(gi157165993) 2e-33 Click
88complement(1921651..1921866) PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; PP_01974; phage(gi20065893) 2e-33 Click
891921879..1922064 hypothetical; PP_01975 0.0 Click
90complement(1922286..1922966) PHAGE_Stx2_c_1717: exonuclease; PP_01976; phage(gi209447136) 4e-132 Click
91complement(1922963..1923748) PHAGE_Entero_lambda: bet; PP_01977; phage(gi9626281) 4e-150 Click
92complement(1923851..1924273) PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; PP_01978; phage(gi116222045) 3e-51 Click
93complement(1924348..1924491) PHAGE_Entero_lambda: host-killing protein; PP_01979; phage(gi9626283) 2e-20 Click
94complement(1924697..1925065) PHAGE_Entero_lambda: Putative single-stranded DNA binding protein; PP_01980; phage(gi9626285) 2e-68 Click
951925326..1925907 PHAGE_Entero_HK140: superinfection exclusion protein; PP_01981; phage(gi428781984) 2e-107 Click
961926186..1926446 hypothetical; PP_01982 0.0 Click
97complement(1926675..1927574) hypothetical protein E2348C_0671 [Escherichia coli O127:H6 str. E2348/69] gi|215485809|ref|YP_002328240.1|; PP_01983 5e-149 Click
98complement(1927704..1928411) PHAGE_Stx2_c_I: CI protein; PP_01984; phage(gi20065916) 4e-133 Click
991928490..1928717 PHAGE_Stx2_c_I: Cro protein; PP_01985; phage(gi20065917) 1e-37 Click
1001928824..1929123 PHAGE_Entero_Min27: regulatory protein CII; PP_01986; phage(gi170783637) 1e-49 Click
1011929156..1930103 PHAGE_Entero_lambda: DNA replication protein; PP_01987; phage(gi9626295) 3e-173 Click
1021930100..1930801 PHAGE_Entero_lambda: DNA replication protein; PP_01988; phage(gi9626296) 2e-131 Click
1031930798..1931088 PHAGE_Entero_lambda: ren exclusion protein; PP_01989; phage(gi9626297) 2e-49 Click
1041931384..1931602 PHAGE_Entero_lambda: NinB; PP_01990; phage(gi9626298) 1e-35 Click
1051931599..1932135 PHAGE_Entero_HK544: putative N-6-adenine-methyltransferase; PP_01991; phage(gi428783266) 2e-79 Click
1061932221..1932598 PHAGE_Entero_2008: antitermination protein Q; PP_01992; phage(gi209427762) 5e-56 Click
107complement(1932755..1933279) PHAGE_Acanth_mimivirus: putative lipocalin; PP_01993; phage(gi311978291) 1e-13 Click
1081933471..1934430 hypothetical protein EFER_2704 [Escherichia fergusonii ATCC 35469] gi|218550019|ref|YP_002383810.1|; PP_01994 1e-175 Click
1091934749..1935480 araC-type regulatory protein from bacteriophage origin [Escherichia fergusonii ATCC 35469] gi|218550018|ref|YP_002383809.1|; PP_01995 6e-111 Click
1101935648..1935863 PHAGE_Stx2_c_II: holin; PP_01996; phage(gi302393164) 2e-26 Click
1111935863..1936360 PHAGE_Entero_cdtI: lysin; PP_01997; phage(gi148609440) 2e-93 Click
1121936357..1936818 PHAGE_Entero_lambda: cell lysis protein; PP_01998; phage(gi9626310) 2e-81 Click
113complement(1936850..1937143) PHAGE_Entero_lambda: Bor protein precursor; PP_01999; phage(gi19263395) 1e-46 Click
1141938086..1938517 PHAGE_Entero_lambda: DNA packaging protein; PP_02000; phage(gi9626244) 1e-69 Click
1151939027..1940007 PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_02001; phage(gi16129935) 0.0 Click
116complement(1940164..1940466) PROPHAGE_Escher_Sakai: putative transposase; PP_02002; phage(gi15834436) 4e-48 Click
1171940597..1941628 PROPHAGE_Escher_Sakai: putative transposase; PP_02003; phage(gi38704244) 4e-162 Click
1181941797..1941943 hypothetical protein ECED1_2198 [Escherichia coli ED1a] gi|218689926|ref|YP_002398138.1|; PP_02004 1e-18 Click
1191941981..1942838 PROPHAGE_Escher_Sakai: putative transposase; PP_02005; phage(gi38704244) 1e-151 Click
1201942939..1943622 PROPHAGE_Escher_MG1655: predicted transposase; PP_02006; phage(gi16131356) 6e-111 Click
121complement(1943666..1943782) hypothetical protein CE10_1832 [Escherichia coli O7:K1 str. CE10] gi|386624180|ref|YP_006143908.1|; PP_02007 1e-12 Click
1221944388..1944546 PHAGE_Entero_lambda: capsid assembly protein; PP_02008; phage(gi9626249) 5e-22 Click
1231944556..1944888 PHAGE_Entero_lambda: head-DNA stabilization protein; PP_02009; phage(gi9626250) 5e-57 Click
1241944917..1945969 PHAGE_Entero_lambda: capsid component; PP_02010; phage(gi9626251) 0.0 Click
1251946011..1946406 PHAGE_Entero_lambda: DNA packaging protein; PP_02011; phage(gi9626252) 3e-57 Click
1261946418..1946771 PHAGE_Entero_lambda: head-tail joining protein; PP_02012; phage(gi9626253) 5e-62 Click
1271947115..1947468 PHAGE_Entero_lambda: tail component; PP_02013; phage(gi9626258) 2e-63 Click
1281947461..1949209 PHAGE_Entero_lambda: tail component; PP_02014; phage(gi9626259) 0.0 Click
1291949395..1949676 PHAGE_Entero_lambda: tail component; PP_02015; phage(gi9626260) 9e-45 Click
1301949676..1950374 PHAGE_Entero_lambda: tail component; PP_02016; phage(gi9626261) 3e-132 Click
1311950488..1951123 PHAGE_Entero_lambda: tail component; PP_02017; phage(gi9626262) 1e-116 Click
1321951409..1951528 PHAGE_Entero_lambda: tail component; PP_02018; phage(gi9626263) 1e-10 Click
1331951566..1951709 PHAGE_Entero_lambda: tail component; PP_02019; phage(gi9626263) 4e-06 Click
1341951744..1954215 PHAGE_Entero_cdtI: putative tail tip assembly protein; PP_02020; phage(gi148609400) 0.0 Click
1351954274..1956259 PHAGE_Entero_mEp460: side tail fiber protein; PP_02021; phage(gi428782336) 6e-75 Click
1361956293..1956571 PHAGE_Escher_bV_EcoS_AKFV33: hypothetical protein; PP_02022; phage(gi388570496) 1e-05 Click
1371956584..1956877 PHAGE_Halomo_1: hypothetical protein HAPgp19; PP_02023; phage(gi167832364) 2e-07 Click
138complement(1956969..1957826) SitD protein [Escherichia coli str. 'clone D i2'] gi|386628909|ref|YP_006148629.1|; PP_02024 1e-155 Click
139complement(1957823..1958680) Iron transporter inner membrane component [Escherichia coli NA114] gi|386618821|ref|YP_006138401.1|; PP_02025 2e-157 Click
140complement(1958677..1959504) PHAGE_Plankt_PaV_LD: ABC transporter; PP_02026; phage(gi371496158) 9e-14 Click
1411969668..1969679 attR    AATCAAAATAAT 0.0 Click

Region 4, total : 42 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12342601..2342804 PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; PP_02391; phage(gi410491512) 1e-13 Click
2complement(2342839..2344299) PHAGE_Microm_MpV1: hypothetical protein; PP_02392; phage(gi313768442) 8e-42 Click
3complement(2344389..2345672) PHAGE_Burkho_phi1026b: gp59; PP_02393; phage(gi38707949) 1e-33 Click
42346533..2346691 hypothetical protein ECBD_2249 [Escherichia coli 'BL21-Gold(DE3)pLysS AG'] gi|253773632|ref|YP_003036463.1|; PP_02394 5e-22 Click
52347008..2347598 PHAGE_Escher_D108: G region invertase; PP_02395; phage(gi281199698) 7e-25 Click
6complement(2347696..2348271) PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; PP_02396; phage(gi16129505) 5e-109 Click
7complement(2348271..2349821) PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; PP_02399; phage(gi16129506) 5e-100 Click
8complement(2349782..2349916) hypothetical protein ECNA114_0896 [Escherichia coli NA114] gi|386618413|ref|YP_006137993.1|; PP_02398 5e-18 Click
92349952..2350689 PHAGE_Salmon_1: putative bacteriophage tail fiber protein; Lambda gpN homolog; PP_02397; phage(gi169257204) 1e-12 Click
102351077..2351250 PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; PP_02400; phage(gi157166059) 7e-29 Click
11complement(2351251..2351850) PHAGE_Entero_mEp460: Lom protein; PP_02401; phage(gi428782335) 2e-108 Click
12complement(2351917..2354214) PHAGE_Entero_mEp460: host specificity protein; PP_02402; phage(gi428782334) 0.0 Click
13complement(2354244..2354921) PHAGE_Entero_mEp460: minor tail protein; PP_02403; phage(gi428782331) 9e-126 Click
14complement(2354931..2355260) PHAGE_Entero_mEp460: minor tail protein; PP_02404; phage(gi428782330) 2e-61 Click
15complement(2355260..2356111) PHAGE_Entero_mEp460: tail length tape measure protein; PP_02405; phage(gi428782329) 3e-158 Click
16complement(2356174..2358324) PHAGE_Entero_mEp460: tail length tape measure protein; PP_02406; phage(gi428782329) 0.0 Click
17complement(2358296..2358571) PHAGE_Entero_mEp460: tail assembly protein; PP_02407; phage(gi428782328) 5e-48 Click
18complement(2358634..2359020) PHAGE_Entero_mEp460: minor tail protein; PP_02408; phage(gi428782327) 3e-64 Click
19complement(2359081..2359824) PHAGE_Entero_mEp460: major tail protein; PP_02409; phage(gi428782326) 1e-137 Click
20complement(2359836..2360237) PHAGE_Entero_mEp460: minor tail protein; PP_02410; phage(gi428782325) 7e-74 Click
21complement(2360234..2360812) PHAGE_Entero_mEp460: minor tail protein; PP_02411; phage(gi428782324) 1e-104 Click
22complement(2360824..2361099) PHAGE_Entero_mEp460: hypothetical protein; PP_02412; phage(gi428782323) 4e-47 Click
23complement(2361092..2361415) PHAGE_Entero_mEp460: hypothetical protein; PP_02413; phage(gi428782322) 1e-54 Click
24complement(2361502..2363460) PHAGE_Entero_mEp460: putative protease/scaffold protein; PP_02414; phage(gi428782321) 0.0 Click
25complement(2363474..2364961) PHAGE_Entero_mEp460: portal protein; PP_02415; phage(gi428782320) 0.0 Click
26complement(2364983..2365195) PHAGE_Entero_mEp460: hypothetical protein; PP_02416; phage(gi428782319) 8e-35 Click
27complement(2365192..2367294) PHAGE_Entero_mEp460: terminase large subunit; PP_02417; phage(gi428782318) 0.0 Click
28complement(2367294..2367788) PHAGE_Entero_mEp460: terminase small subunit; PP_02418; phage(gi428782317) 7e-85 Click
29complement(2368351..2368557) PHAGE_Entero_HK630: hypothetical protein; PP_02419; phage(gi428782856) 9e-29 Click
30complement(2370264..2370476) PHAGE_Lactoc_bIL312: Csp; PP_02420; phage(gi13095918) 1e-15 Click
31complement(2370498..2370647) hypothetical protein [Escherichia coli KO11FL] gi|378713017|ref|YP_005277910.1|; PP_02421 3e-19 Click
32complement(2370840..2371322) PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; PP_02422; phage(gi16765210) 2e-53 Click
33complement(2371334..2371867) PHAGE_Entero_mEp460: endolysin; PP_02423; phage(gi428782372) 2e-97 Click
34complement(2371864..2372151) PHAGE_Entero_mEp460: hypothetical protein; PP_02424; phage(gi428782371) 1e-25 Click
35complement(2372180..2372386) PHAGE_Entero_mEp460: porin; PP_02425; phage(gi428782370) 1e-31 Click
36complement(2373149..2373364) PHAGE_Lactoc_bIL312: Csp; PP_02426; phage(gi13095918) 5e-16 Click
372373665..2373877 cold shock protein; Qin prophage [Escherichia fergusonii ATCC 35469] gi|218551642|ref|YP_002385434.1|; PP_02427 5e-32 Click
38complement(2374112..2374267) hypothetical; PP_02428 0.0 Click
39complement(2374299..2375051) PHAGE_Entero_mEp460: late gene regulator; PP_02429; phage(gi428782366) 6e-139 Click
40complement(2375065..2376114) PHAGE_Entero_mEp460: hypothetical protein; PP_02430; phage(gi428782365) 2e-111 Click
41complement(2376461..2376712) hypothetical protein ECED1_1418 [Escherichia coli ED1a] gi|218689209|ref|YP_002397421.1|; PP_02431 6e-40 Click
422377238..2377396 PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PP_02432; phage(gi16131377) 1e-24 Click

Region 5, total : 69 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13264215..3264230 attL    TTGCAGGTTCGATTCC 0.0 Click
23264370..3265563 PHAGE_Entero_HK620: integrase; PP_03290; phage(gi13559824) 0.0 Click
3complement(3265655..3265954) PHAGE_Halomo_1: hypothetical protein HAPgp19; PP_03291; phage(gi167832364) 6e-06 Click
4complement(3265951..3266766) hypothetical; PP_03292 0.0 Click
5complement(3266745..3268007) PHAGE_Entero_HK620: tail spike protein; PP_03293; phage(gi13559880) 7e-57 Click
63268027..3268203 hypothetical; PP_03294 0.0 Click
7complement(3268186..3269013) PHAGE_Stx2_c_1717: phage antirepressor protein; PP_03295; phage(gi209447193) 4e-152 Click
8complement(3269173..3269313) hypothetical; PP_03296 0.0 Click
9complement(3269343..3269483) PHAGE_Salmon_vB_SemP_Emek: Arc; PP_03297; phage(gi399498812) 2e-05 Click
103269589..3269753 PHAGE_Salmon_vB_SemP_Emek: transcriptional repressor protein; PP_03298; phage(gi399498811) 4e-06 Click
113270308..3270685 PHAGE_Entero_HK542: hypothetical protein; PP_03299; phage(gi428783380) 1e-13 Click
12complement(3270755..3270898) hypothetical; PP_03300 0.0 Click
13complement(3270938..3273061) PHAGE_Entero_HK620: DNA transfer protein; PP_03301; phage(gi13559877) 3e-12 Click
14complement(3273046..3274389) PHAGE_Entero_HK620: DNA transfer protein; PP_03302; phage(gi13559876) 2e-112 Click
15complement(3274400..3275092) PHAGE_Entero_HK620: DNA transfer protein; PP_03303; phage(gi13559875) 9e-118 Click
16complement(3275095..3275418) PHAGE_Entero_HK620: head assembly protein; PP_03304; phage(gi13559874) 2e-59 Click
17complement(3275550..3276251) PHAGE_Entero_HK620: DNA stabilization protein; PP_03305; phage(gi13559873) 6e-119 Click
18complement(3276251..3277669) PHAGE_Entero_HK620: DNA stabilization protein; PP_03306; phage(gi13559872) 0.0 Click
19complement(3277678..3278160) PHAGE_Entero_HK620: DNA stabilization protein; PP_03307; phage(gi13559871) 4e-89 Click
20complement(3278135..3278320) PHAGE_Entero_HK620: hypothetical protein HK620p47; PP_03308; phage(gi13559870) 1e-27 Click
21complement(3278363..3279634) PHAGE_Entero_HK620: capsid protein; PP_03309; phage(gi13559869) 0.0 Click
22complement(3279646..3280530) PHAGE_Entero_HK620: scaffold protein; PP_03310; phage(gi13559868) 2e-167 Click
23complement(3280544..3282670) PHAGE_Entero_HK620: portal protein; PP_03311; phage(gi13559867) 0.0 Click
24complement(3282673..3284085) PHAGE_Entero_HK620: terminase large subunit; PP_03312; phage(gi13559866) 0.0 Click
25complement(3284082..3284507) PHAGE_Entero_HK620: terminase small subunit; PP_03313; phage(gi13559865) 5e-69 Click
26complement(3284780..3285169) PHAGE_Salmon_ST160: hypotthetical protein; PP_03314; phage(gi318065947) 5e-38 Click
27complement(3285171..3285413) PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; PP_03315; phage(gi399498861) 6e-38 Click
28complement(3286064..3286252) PHAGE_Acinet_Bphi_B1251: hypothetical protein; PP_03316; phage(gi423262005) 1e-19 Click
29complement(3286303..3286770) PHAGE_Entero_HK620: endopeptidase; PP_03317; phage(gi13559860) 7e-70 Click
30complement(3286767..3287240) PHAGE_Entero_HK140: lysin; PP_03318; phage(gi428782005) 6e-89 Click
31complement(3287227..3287550) PHAGE_Entero_mEp213: holin protein; PP_03319; phage(gi428782657) 1e-55 Click
323287685..3287843 hypothetical protein NRG857_04685 [Escherichia coli O83:H1 str. NRG 857C] gi|387616276|ref|YP_006119298.1|; PP_03320 2e-20 Click
33complement(3287984..3288607) PHAGE_Entero_mEpX1: late gene regulator Q; PP_03321; phage(gi428781929) 7e-118 Click
34complement(3288789..3289151) PHAGE_Entero_HK620: holiday-junction resolvase; PP_03322; phage(gi13559855) 2e-64 Click
35complement(3289148..3289312) PHAGE_Salmon_SPN9CC: hypothetical protein; PP_03323; phage(gi389060524) 1e-26 Click
36complement(3289431..3289643) PHAGE_Entero_c_1: hypothetical protein; PP_03324; phage(gi428781792) 4e-37 Click
37complement(3289805..3289966) PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; PP_03325; phage(gi302861190) 1e-25 Click
38complement(3290765..3291118) PHAGE_Entero_IME10: hypothetical protein; PP_03326; phage(gi422934273) 9e-58 Click
39complement(3291115..3291420) PHAGE_Stx2_c_1717: NinB protein; PP_03327; phage(gi209447158) 6e-54 Click
40complement(3291569..3291775) PHAGE_Entero_HK633: hypothetical protein; PP_03328; phage(gi428782573) 2e-32 Click
41complement(3291852..3293684) PHAGE_Entero_c_1: hypothetical protein; PP_03329; phage(gi428781787) 0.0 Click
423293643..3293801 hypothetical protein CE10_1035 [Escherichia coli O7:K1 str. CE10] gi|386623411|ref|YP_006143139.1|; PP_03330 2e-22 Click
43complement(3293840..3294700) PHAGE_Entero_c_1: DNA replication protein O; PP_03331; phage(gi428781786) 5e-165 Click
44complement(3294874..3295152) PHAGE_Entero_Sf6: gene 41 protein; PP_03332; phage(gi41057318) 1e-45 Click
45complement(3295261..3295455) PHAGE_Entero_HK620: cro; PP_03333; phage(gi13559844) 2e-30 Click
463295562..3296278 PHAGE_Entero_HK620: repressor protein cI; PP_03334; phage(gi13559843) 1e-132 Click
47complement(3296891..3297022) hypothetical; PP_03335 0.0 Click
483297034..3297339 PHAGE_Entero_HK620: antitermination protein N; PP_03336; phage(gi13559841) 6e-28 Click
493297688..3297810 PHAGE_Entero_HK544: restriction alleviation protein; PP_03337; phage(gi428783253) 3e-17 Click
503297850..3298140 PHAGE_Entero_c_1: hypothetical protein; PP_03338; phage(gi428781778) 2e-34 Click
513298140..3298298 PHAGE_Entero_mEp213: hypothetical protein; PP_03339; phage(gi428782637) 4e-24 Click
523298438..3298806 PHAGE_Entero_mEpX2: hypothetical protein; PP_03340; phage(gi428765651) 5e-68 Click
533298841..3299695 PHAGE_Entero_IME10: Orf53; PP_03341; phage(gi422934294) 1e-140 Click
543299948..3300100 PHAGE_Escher_HK75: kil protein; PP_03342; phage(gi356870711) 4e-23 Click
553300097..3300267 PHAGE_Escher_HK75: hypothetical protein; PP_03343; phage(gi356870710) 3e-27 Click
563300221..3300346 PHAGE_Entero_mEp234: hypothetical protein; PP_03344; phage(gi428782284) 2e-18 Click
573300357..3300962 PHAGE_Entero_HK542: essential recombination function protein; PP_03345; phage(gi428783375) 1e-111 Click
583300962..3301345 PHAGE_Entero_mEp213: hypothetical protein; PP_03346; phage(gi428782627) 8e-70 Click
593301369..3301662 PHAGE_Entero_HK633: Abc2 protein; PP_03347; phage(gi428782555) 9e-53 Click
603301673..3301840 PHAGE_Entero_HK620: hypothetical protein HK620p09; PP_03348; phage(gi13559832) 1e-24 Click
613301837..3302136 PHAGE_Entero_Sf6: gene 22 protein; PP_03349; phage(gi41057300) 2e-58 Click
623302138..3302953 PHAGE_Entero_HK620: hypothetical protein HK620p07; PP_03350; phage(gi13559830) 1e-77 Click
633302955..3303551 PHAGE_Entero_P22: EaA; PP_03351; phage(gi9635497) 4e-54 Click
643303707..3303850 PHAGE_Entero_Sf6: gene 20 protein; PP_03352; phage(gi41057298) 2e-22 Click
653303951..3304118 PHAGE_Entero_HK630: hypothetical protein; PP_03353; phage(gi428782816) 2e-28 Click
663304588..3304603 attR    TTGCAGGTTCGATTCC 0.0 Click
673304623..3304823 PHAGE_Entero_HK620: hypothetical protein HK620p03; PP_03354; phage(gi13559826) 3e-34 Click
683305133..3305273 hypothetical protein ECSP_3309 [Escherichia coli O157:H7 str. TW14359] gi|254794323|ref|YP_003079160.1|; PP_03355 2e-16 Click
69complement(3305353..3306600) sucrose transport protein [Escherichia coli O103:H2 str. 12009] gi|260845009|ref|YP_003222787.1|; PP_03356 0.0 Click
70complement(3306662..3307585) aminoimidazole riboside kinase [Escherichia coli O127:H6 str. E2348/69] gi|215487628|ref|YP_002330059.1|; PP_03357 6e-175 Click
713307800..3309233 PHAGE_Bacill_SP10: levanase; PP_03358; phage(gi418489513) 5e-28 Click

Region 6, total : 61 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(3447791..3447943) PHAGE_Escher_TL_2011b: hypothetical protein; PP_03488; phage(gi418487684) 7e-21 Click
23447961..3448152 PHAGE_Escher_TL_2011b: hypothetical protein; PP_03489; phage(gi418487683) 1e-29 Click
33448466..3448981 PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; PP_03490; phage(gi418487638) 7e-93 Click
43448997..3449536 PHAGE_Escher_TL_2011b: hypothetical protein; PP_03491; phage(gi418487682) 4e-95 Click
5complement(3449684..3449881) PROPHAGE_Salmon_Ty2: transposase; PP_03492; phage(gi29143766) 3e-34 Click
6complement(3450536..3451018) PHAGE_Entero_phiV10: putative lysis accessory protein; PP_03493; phage(gi89152449) 3e-79 Click
7complement(3451015..3451644) PHAGE_Entero_phiV10: putative endolysin; PP_03494; phage(gi89152448) 4e-114 Click
8complement(3451929..3452162) PHAGE_Entero_phiV10: putative integral membrane protein; PP_03495; phage(gi89152446) 5e-36 Click
9complement(3452318..3452830) hypothetical protein c3147 [Escherichia coli CFT073] gi|26248989|ref|NP_755029.1|; PP_03496 2e-41 Click
10complement(3452827..3453249) hypothetical; PP_03498 0.0 Click
11complement(3453339..3453464) hypothetical; PP_03497 0.0 Click
12complement(3453725..3455128) PHAGE_Entero_phiV10: putative tail fiber; PP_03499; phage(gi89152445) 4e-56 Click
133455324..3455581 PHAGE_Entero_phiV10: hypothetical protein PhiV10p24; PP_03500; phage(gi89152444) 3e-44 Click
143455897..3456607 PHAGE_Entero_phiV10: putative anti-immunity protein; PP_03501; phage(gi89152443) 4e-72 Click
153456707..3456874 hypothetical protein ECNA114_4790 [Escherichia coli NA114] gi|386622333|ref|YP_006141913.1|; PP_03502 1e-24 Click
163456895..3457335 hypothetical protein R2866_1716 [Haemophilus influenzae R2866] gi|386264872|ref|YP_005828365.1|; PP_03503 2e-23 Click
173457428..3457589 PHAGE_Escher_TL_2011b: putative transmembrane anchored protein; PP_03504; phage(gi418487635) 1e-24 Click
18complement(3457628..3457750) hypothetical; PP_03505 0.0 Click
19complement(3458051..3460525) PHAGE_Entero_phiV10: hypothetical protein PhiV10p20; PP_03506; phage(gi89152441) 0.0 Click
20complement(3460531..3462333) PHAGE_Entero_phiV10: hypothetical protein PhiV10p19; PP_03507; phage(gi89152440) 0.0 Click
21complement(3462330..3464780) PHAGE_Entero_phiV10: hypothetical structural protein; PP_03508; phage(gi89152439) 0.0 Click
22complement(3464843..3465388) PHAGE_Entero_phiV10: hypothetical protein PhiV10p17; PP_03509; phage(gi89152438) 1e-98 Click
23complement(3465388..3465852) PHAGE_Entero_phiV10: hypothetical protein PhiV10p16; PP_03510; phage(gi89152437) 2e-86 Click
24complement(3465852..3468323) PHAGE_Entero_phiV10: hypothetical protein PhiV10p15; PP_03511; phage(gi89152436) 0.0 Click
25complement(3468323..3468928) PHAGE_Entero_phiV10: hypothetical protein PhiV10p14; PP_03512; phage(gi89152435) 3e-112 Click
26complement(3469107..3469439) PHAGE_Entero_phiV10: hypothetical protein PhiV10p13; PP_03513; phage(gi89152434) 4e-47 Click
27complement(3469490..3469825) PHAGE_Entero_phiV10: hypothetical protein PhiV10p12; PP_03514; phage(gi89152433) 4e-49 Click
28complement(3469836..3470273) PHAGE_Entero_phiV10: hypothetical protein PhiV10p11; PP_03515; phage(gi89152432) 2e-73 Click
29complement(3470325..3471311) PHAGE_Entero_phiV10: hypothetical protein PhiV10p10; PP_03516; phage(gi89152431) 0.0 Click
30complement(3471326..3472021) PHAGE_Entero_phiV10: hypothetical protein PhiV10p09; PP_03517; phage(gi89152430) 4e-126 Click
31complement(3472024..3472320) PHAGE_Entero_phiV10: hypothetical protein PhiV10p08; PP_03518; phage(gi89152429) 3e-50 Click
32complement(3472317..3473996) PHAGE_Entero_phiV10: putative head-to-tail-joining protein; PP_03519; phage(gi89152428) 0.0 Click
33complement(3474011..3474217) PHAGE_Entero_phiV10: hypothetical protein PhiV10p06; PP_03520; phage(gi89152427) 2e-31 Click
343474645..3474721 tRNA 0.0 Click
35complement(3474651..3474902) PHAGE_Entero_phiV10: hypothetical protein PhiV10p04; PP_03521; phage(gi155370094) 2e-42 Click
363474687..3474698 attL    GTTGGTCGCAGG 0.0 Click
373474920..3475291 PHAGE_Entero_phiV10: hypothetical protein PhiV10p03; PP_03522; phage(gi89152424) 2e-58 Click
38complement(3475382..3476857) PHAGE_Entero_phiV10: putative terminase large subunit; PP_03523; phage(gi89152423) 0.0 Click
39complement(3476854..3477528) PHAGE_Entero_phiV10: putative terminase small subunit; PP_03524; phage(gi155370097) 1e-123 Click
40complement(3477569..3477907) PHAGE_Entero_phiV10: hypothetical protein PhiV10p55; PP_03525; phage(gi89152469) 1e-61 Click
41complement(3477900..3478181) PHAGE_Entero_phiV10: hypothetical protein PhiV10p54; PP_03526; phage(gi89152468) 9e-50 Click
42complement(3478174..3478746) PHAGE_Escher_TL_2011c: hypothetical protein; PP_03527; phage(gi418487081) 7e-104 Click
43complement(3478750..3478899) hypothetical protein [Escherichia coli O55:H7 str. RM12579] gi|387504813|ref|YP_006157152.1|; PP_03528 6e-22 Click
44complement(3479252..3479812) PHAGE_Entero_phiV10: hypothetical protein PhiV10p48; PP_03529; phage(gi89152464) 2e-30 Click
45complement(3479809..3480453) PHAGE_Pseudo_F116: hypothetical protein F116p06; PP_03530; phage(gi56692933) 1e-10 Click
46complement(3480446..3480706) hypothetical protein ECO111_1418 [Escherichia coli O111:H- str. 11128] gi|260867503|ref|YP_003233905.1|; PP_03531 1e-31 Click
47complement(3480703..3481137) PHAGE_Entero_phiV10: eae-like protein; PP_03532; phage(gi89152462) 5e-25 Click
48complement(3481199..3481543) PHAGE_Entero_phiV10: hypothetical protein PhiV10p45; PP_03533; phage(gi89152461) 2e-62 Click
49complement(3481661..3482446) PHAGE_Entero_phiV10: putative replication protein p; PP_03534; phage(gi155370096) 2e-153 Click
50complement(3482443..3483258) PHAGE_Entero_phiV10: putative primosomal protein; PP_03535; phage(gi89152459) 1e-155 Click
51complement(3483274..3483474) PHAGE_Entero_phiV10: hypothetical protein PhiV10p42; PP_03536; phage(gi89152475) 6e-34 Click
52complement(3483637..3483867) PHAGE_Entero_phiV10: hypothetical protein PhiV10p41; PP_03537; phage(gi89152458) 4e-41 Click
533484022..3484606 PHAGE_Entero_phiV10: putative transcriptional repressor; PP_03538; phage(gi89152457) 2e-107 Click
543484760..3484912 PHAGE_Entero_phiV10: hypothetical protein PhiV10p39; PP_03539; phage(gi89152456) 1e-26 Click
553484915..3485214 PHAGE_Entero_phiV10: hypothetical protein PhiV10p38; PP_03540; phage(gi89152455) 4e-48 Click
563485211..3486032 PHAGE_Entero_phiV10: putative recET; PP_03541; phage(gi89152454) 1e-156 Click
573486029..3486910 PHAGE_Entero_phiV10: putative recET; PP_03542; phage(gi89152454) 1e-124 Click
583486960..3487208 PHAGE_Entero_phiV10: putative transcriptional regulator; PP_03543; phage(gi89152453) 3e-44 Click
593487610..3488260 PHAGE_Entero_phiV10: putative adenine methylase; PP_03544; phage(gi89152451) 2e-126 Click
603488257..3488451 PHAGE_Entero_phiV10: hypothetical protein PhiV10p32; PP_03545; phage(gi89152473) 4e-28 Click
61complement(3488455..3489705) PHAGE_Entero_phiV10: putative integrase; PP_03546; phage(gi89152450) 0.0 Click
62complement(3489898..3491475) GMP synthase [Escherichia coli str. 'clone D i2'] gi|386630274|ref|YP_006149994.1|; PP_03547 0.0 Click
63complement(3491544..3493055) PHAGE_Staphy_42E: ORF012; PP_03548; phage(gi66395520) 4e-32 Click
643502891..3502902 attR    GTTGGTCGCAGG 0.0 Click

Region 7, total : 60 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
15242280..5243656 PHAGE_Ectoca_1: EsV-1-186; PP_05287; phage(gi13242656) 8e-11 Click
25243653..5244978 PHAGE_Ectoca_1: EsV-1-65; PP_05288; phage(gi13242537) 2e-09 Click
3complement(5244975..5246264) phosphoribosylglycineamide synthetase [Escherichia coli 042] gi|387609797|ref|YP_006098653.1|; PP_05289 0.0 Click
4complement(5246276..5247865) PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; PP_05290; phage(gi61806062) 4e-71 Click
55247983..5248105 hypothetical protein ECOK1_4483 [Escherichia coli IHE3034] gi|386602043|ref|YP_006103549.1|; PP_05291 3e-15 Click
6complement(5248505..5249326) PROPHAGE_Escher_MG1655: IS4 transposase; PP_05292; phage(gi16132099) 3e-158 Click
7complement(5249317..5249850) PROPHAGE_Escher_MG1655: IS4 transposase; PP_05293; phage(gi16132099) 2e-85 Click
85250080..5251129 PHAGE_Stx2_c_1717: transposase; PP_05294; phage(gi209447153) 0.0 Click
95251350..5251661 PROPHAGE_Xantho_33913: ISxac3 transposase; PP_05295; phage(gi21231087) 1e-06 Click
105251850..5252671 PHAGE_Entero_Sf6: putative transposase OrfB; PP_05296; phage(gi41057343) 9e-81 Click
115252681..5253013 PHAGE_Entero_HK629: head decoration protein; PP_05297; phage(gi428782018) 5e-52 Click
125253069..5254094 PHAGE_Entero_HK629: major head subunit; PP_05298; phage(gi428782019) 0.0 Click
135254136..5254531 PHAGE_Entero_HK629: DNA packaging protein Fi; PP_05299; phage(gi428782020) 1e-58 Click
145254543..5254896 PHAGE_Entero_HK629: head-tail connector Fii; PP_05300; phage(gi428782021) 1e-62 Click
155254908..5255219 PHAGE_Entero_HK629: minor tail protein; PP_05301; phage(gi428782025) 2e-22 Click
165255201..5255635 PHAGE_Entero_HK629: tail assembly protein; PP_05302; phage(gi428782026) 2e-79 Click
175255628..5257418 PHAGE_Entero_HK629: tail length tape measure protein; PP_05303; phage(gi428782027) 0.0 Click
185257402..5257515 PHAGE_Entero_HK629: minor tail protein; PP_05304; phage(gi428782028) 4e-12 Click
195257515..5258213 PHAGE_Entero_HK629: minor tail protein; PP_05305; phage(gi428782029) 6e-132 Click
205258363..5258962 PHAGE_Entero_HK629: tail component protein; PP_05306; phage(gi428782030) 1e-121 Click
215258959..5261010 PHAGE_Entero_HK629: tail component protein; PP_05307; phage(gi428782031) 8e-53 Click
22complement(5261266..5261904) PHAGE_Burkho_KS14: gp37; PP_05308; phage(gi327198306) 8e-24 Click
23complement(5262489..5262743) hypothetical protein ECNA114_4692, partial [Escherichia coli NA114] gi|386622235|ref|YP_006141815.1|; PP_05309 6e-19 Click
245262835..5264136 Putative mobilization protein [Escherichia coli NA114] gi|386622236|ref|YP_006141816.1|; PP_05310 0.0 Click
255264133..5265095 PHAGE_Entero_HK629: terminase large subunit A; PP_05311; phage(gi428782013) 0.0 Click
265265092..5265298 PHAGE_Entero_HK629: head-tail connector; PP_05312; phage(gi428782014) 4e-32 Click
275265295..5266896 PHAGE_Entero_HK629: portal protein; PP_05313; phage(gi428782015) 0.0 Click
285266877..5268196 PHAGE_Entero_HK629: head maturation protease; PP_05314; phage(gi428782016) 0.0 Click
295268200..5268508 PHAGE_Entero_HK629: head decoration protein; PP_05315; phage(gi428782018) 2e-41 Click
305268520..5269098 PHAGE_Entero_HK629: minor tail protein; PP_05316; phage(gi428782022) 7e-101 Click
315269095..5269490 PHAGE_Entero_HK629: minor tail protein; PP_05317; phage(gi428782023) 2e-70 Click
325269498..5270238 PHAGE_Entero_HK629: major tail protein; PP_05318; phage(gi428782024) 3e-137 Click
33complement(5270519..5271007) PHAGE_Entero_HK629: minor tail protein; PP_05319; phage(gi428782025) 5e-66 Click
34complement(5271023..5271763) PHAGE_Entero_HK629: major tail protein; PP_05320; phage(gi428782024) 3e-134 Click
35complement(5271771..5272166) PHAGE_Entero_HK629: minor tail protein; PP_05321; phage(gi428782023) 4e-72 Click
36complement(5272163..5272663) PHAGE_Entero_HK629: minor tail protein; PP_05322; phage(gi428782022) 6e-87 Click
375272946..5273545 PHAGE_Entero_HK629: tail component protein; PP_05323; phage(gi428782030) 2e-117 Click
385273590..5274090 PHAGE_Entero_HK629: tail component protein; PP_05324; phage(gi428782031) 2e-64 Click
395274151..5274774 PHAGE_Entero_HK629: tail fiber; PP_05325; phage(gi428782032) 1e-105 Click
405274853..5275374 PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; PP_05326; phage(gi17546156) 5e-13 Click
415275587..5276174 PROPHAGE_Ralsto_GMI1000: isrso11-transposase orfb protein; PP_05327; phage(gi17546155) 3e-62 Click
42complement(5276158..5276364) hypothetical; PP_05328 0.0 Click
435276491..5277219 PHAGE_Entero_HK629: tail length tape measure protein; PP_05329; phage(gi428782027) 6e-131 Click
445277216..5277497 PHAGE_Entero_HK629: minor tail protein; PP_05330; phage(gi428782028) 1e-43 Click
455277501..5278793 PHAGE_Entero_HK629: tail fiber; PP_05331; phage(gi428782032) 0.0 Click
465279032..5279760 PHAGE_Entero_HK629: tail length tape measure protein; PP_05332; phage(gi428782027) 2e-128 Click
475280058..5280327 PHAGE_Entero_HK629: tail component protein; PP_05333; phage(gi428782031) 8e-44 Click
485280388..5280933 PHAGE_Entero_HK629: tail fiber; PP_05334; phage(gi428782032) 6e-83 Click
49complement(5281518..5281814) PHAGE_Entero_mEp213: DNA N-6-adenine-methyltransferase (Dam); PP_05335; phage(gi428782650) 4e-50 Click
50complement(5281860..5282690) PHAGE_Stx2_c_1717: transposase; PP_05336; phage(gi209447153) 1e-152 Click
515282738..5283034 PHAGE_Entero_HK629: tail component protein; PP_05337; phage(gi428782031) 2e-48 Click
52complement(5283551..5284357) PHAGE_Equid__4: envelope glycoprotein J; PP_05338; phage(gi9629801) 2e-05 Click
53complement(5284317..5285144) PHAGE_Entero_HK629: terminase large subunit A; PP_05339; phage(gi428782013) 4e-157 Click
54complement(5285141..5287024) PHAGE_Entero_HK629: terminase large subunit A; PP_05340; phage(gi428782013) 1e-159 Click
55complement(5287029..5287352) PHAGE_Entero_HK629: minor tail protein; PP_05341; phage(gi428782028) 4e-42 Click
56complement(5287349..5287492) PHAGE_Entero_HK629: tail length tape measure protein; PP_05342; phage(gi428782027) 2e-16 Click
57complement(5287639..5287884) PROPHAGE_Salmon_Ty2: transposase; PP_05343; phage(gi29143766) 2e-43 Click
585288342..5289577 PHAGE_Stx2_c_1717: transposase; PP_05344; phage(gi209447153) 1e-116 Click
595289588..5289974 PHAGE_Entero_HK629: minor tail protein; PP_05345; phage(gi428782025) 2e-65 Click
60complement(5290090..5290839) PHAGE_Cercop_5: envelope protein US28; PP_05346; phage(gi359946607) 4e-06 Click