Mycobacterium tuberculosis KZN V2475 , whole genome shotgun [asmbl_id: NC_000000].4356301, GC%: 65.48%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 12 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(1147742..1148515) PHAGE_Ectoca_1: EsV-1-65; PP_01150; phage(gi13242537) 1e-06 Click
2complement(1148697..1149188) transposase [Mycobacterium tuberculosis KZN 605] gi|392433377|ref|YP_006474421.1|; PP_01151 1e-92 Click
3complement(1149154..1149840) PHAGE_Burkho_KS9: tail length tape measure protein gp13; PP_01152; phage(gi255033744) 4e-05 Click
4complement(1149874..1150197) unnamed protein product [Mycobacterium tuberculosis UT205] gi|392385744|ref|YP_005307373.1|; PP_01153 3e-57 Click
5complement(1150323..1150607) esxV [Mycobacterium tuberculosis UT205] gi|392388210|ref|YP_005309839.1|; PP_01154 8e-48 Click
6complement(1150634..1150930) esxJ [Mycobacterium tuberculosis UT205] gi|392385746|ref|YP_005307375.1|; PP_01155 9e-50 Click
7complement(1151076..1152209) PHAGE_Pectob_My1: YadA domain-containing protein; PP_01156; phage(gi410491156) 6e-09 Click
8complement(1152328..1153155) PHAGE_Cronob_vB_CsaP_GAP52: hypothetical protein; PP_01157; phage(gi414087485) 5e-07 Click
9complement(1153943..1154059) hypothetical protein MRGA423_06500 [Mycobacterium tuberculosis RGTB423] gi|386004042|ref|YP_005922321.1|; PP_01158 2e-15 Click
10complement(1154088..1154306) hypothetical protein MRGA423_06505 [Mycobacterium tuberculosis RGTB423] gi|386004043|ref|YP_005922322.1|; PP_01159 7e-34 Click
11complement(1154351..1154788) PROPHAGE_Brucel_1330: ISBm1, transposase orfB; PP_01160; phage(gi23501425) 5e-11 Click
12complement(1154871..1155269) PROPHAGE_Shewan_MR-1: ISSod6, transposase; PP_01161; phage(gi24374783) 1e-16 Click

Region 2, total : 15 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12008496..2010463 PHAGE_Cercop_2: transcriptional regulator ICP4; PP_01981; phage(gi56694796) 2e-05 Click
22011044..2012315 PHAGE_Roseob_SIO1: gp7; PP_01982; phage(gi9964615) 6e-06 Click
32012427..2013818 PHAGE_Cyprin_1: membrane protein ORF65; PP_01983; phage(gi422933603) 4e-07 Click
4complement(2013966..2015918) PHAGE_Human__4: EBNA-1; PP_01984; phage(gi82503233) 1e-65 Click
5complement(2016066..2016392) PHAGE_Mycoba_Ramsey: gp56; PP_01985; phage(gi206600237) 3e-05 Click
6complement(2016456..2017340) PHAGE_Burkho_phiE125: ISBt3 transposase subunit protein; PP_01986; phage(gi17975200) 8e-85 Click
7complement(2017391..2017660) PHAGE_Burkho_phiE125: ISBt3 transposase subunit protein; PP_01987; phage(gi17975201) 4e-15 Click
8complement(2018404..2018532) hypothetical; PP_01988 0.0 Click
9complement(2018520..2018654) hypothetical; PP_01989 0.0 Click
102018653..2018772 PE20 [Mycobacterium tuberculosis UT205] gi|392386464|ref|YP_005308093.1|; PP_01990 1e-12 Click
112018787..2019998 PHAGE_Roseob_SIO1: gp7; PP_01991; phage(gi9964615) 1e-06 Click
12complement(2020121..2020240) hypothetical; PP_01992 0.0 Click
132020319..2021551 PHAGE_Celeri_P12053L: putative phage tail fiber protein; PP_01993; phage(gi399528893) 1e-05 Click
142021683..2023089 PHAGE_Pseudo_MP38: putative tail component protein; PP_01994; phage(gi215479964) 1e-06 Click
152023376..2023690 PHAGE_Mycoba_Ramsey: gp56; PP_01995; phage(gi206600237) 3e-10 Click

Region 3, total : 13 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12943451..2943471 attL    CCGCGCAATAAACGCGCAATA 0.0 Click
22943939..2944937 PHAGE_Mycoba_BPs: integrase; PP_02935; phage(gi189043119) 1e-63 Click
32944951..2945415 PHAGE_Staphy_EW: ORF013; PP_02936; phage(gi66395820) 3e-10 Click
4complement(2945382..2945663) PHAGE_Hyposo_ichnovirus: polar residue rich protein-b16.1; PP_02937; phage(gi124484683) 5e-05 Click
5complement(2945825..2947264) PHAGE_Rhodoc_REQ1: putative capsid protein; PP_02938; phage(gi372450101) 5e-51 Click
6complement(2947272..2947805) PHAGE_Marino_P12026: phage prohead protease; PP_02939; phage(gi399528321) 1e-11 Click
7complement(2947958..2948449) PHAGE_Nocard_NBR1: terminase small subunit; PP_02940; phage(gi372217587) 3e-15 Click
8complement(2948616..2948939) phiRv2 phage protein [Mycobacterium tuberculosis KZN 1435] gi|253798265|ref|YP_003031266.1|; PP_02941 3e-57 Click
9complement(2949019..2949264) unnamed protein product [Mycobacterium tuberculosis UT205] gi|392387288|ref|YP_005308917.1|; PP_02942 2e-36 Click
10complement(2949261..2950688) unnamed protein product [Mycobacterium tuberculosis UT205] gi|392387289|ref|YP_005308918.1|; PP_02943 0.0 Click
11complement(2950690..2951082) unnamed protein product [Mycobacterium tuberculosis UT205] gi|392387290|ref|YP_005308919.1|; PP_02944 3e-72 Click
12complement(2951079..2951276) PHAGE_Mycoba_Ramsey: gp43; PP_02945; phage(gi206600224) 2e-09 Click
13complement(2951356..2951718) unnamed protein product [Mycobacterium tuberculosis UT205] gi|392387292|ref|YP_005308921.1|; PP_02946 4e-66 Click
14complement(2951721..2952848) PHAGE_Mycoba_SWU1: integrase; PP_02947; phage(gi388570553) 2e-57 Click
152952863..2952883 attR    CCGCGCAATAAACGCGCAATA 0.0 Click