Lachnospiraceae bacterium 9_1_43BFAA .1, whole genome shotgun [asmbl_id: NC_000000].2840852, GC%: 41.37%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 30 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11100275..1100287 attL    TTCATATTTTTTT 0.0 Click
21107813..1109681 PHAGE_Bacill_Gamma: site-specific recombinase; HMPREF0987_01095; phage(gi77020163) 2e-23 Click
31109674..1110414 hypothetical protein; HMPREF0987_01096 0.0 Click
41110415..1110816 hypothetical protein; HMPREF0987_01097 0.0 Click
51110813..1111766 hypothetical protein; HMPREF0987_01098 0.0 Click
61111769..1112692 PHAGE_Mycoba_Ramsey: gp49; HMPREF0987_01099; phage(gi206600230) 4e-11 Click
7complement(1112702..1114099) PHAGE_Bacill_Gamma: site-specific recombinase; HMPREF0987_01100; phage(gi77020163) 9e-29 Click
8complement(1114056..1115552) PHAGE_Bacill_Gamma: site-specific recombinase; HMPREF0987_01101; phage(gi77020163) 1e-28 Click
9complement(1115701..1116663) PHAGE_Bacill_phi105: hypothetical protein phi105_26; HMPREF0987_01102; phage(gi22855019) 5e-06 Click
10complement(1116694..1117107) PHAGE_Bacill_WBeta: phage holin; HMPREF0987_01103; phage(gi85701395) 2e-25 Click
11complement(1117170..1119080) PHAGE_Lactoc_949: putative tail protein; HMPREF0987_01104; phage(gi327197970) 1e-60 Click
12complement(1119097..1119651) hypothetical protein; HMPREF0987_01105 0.0 Click
13complement(1119663..1121480) PHAGE_Pectob_My1: putative tail protein pb4; HMPREF0987_01106; phage(gi410491160) 6e-05 Click
14complement(1121493..1122950) PHAGE_Clostr_phi8074_B1: putative phage tail protein; HMPREF0987_01107; phage(gi431810378) 1e-24 Click
15complement(1122947..1123597) hypothetical protein; HMPREF0987_01108 0.0 Click
16complement(1123594..1126584) PHAGE_Bacill_1: TMP repeat protein; HMPREF0987_01109; phage(gi155042946) 3e-110 Click
17complement(1126683..1127021) hypothetical protein; HMPREF0987_01110 0.0 Click
18complement(1127074..1127685) hypothetical protein; HMPREF0987_01111 0.0 Click
19complement(1127788..1127952) hypothetical protein; HMPREF0987_01112 0.0 Click
20complement(1127949..1128323) PHAGE_Bacill_1: hypothetical protein BV1_gp29; HMPREF0987_01113; phage(gi155042944) 9e-13 Click
21complement(1128320..1128907) PHAGE_Bacill_1: hypothetical protein BV1_gp28; HMPREF0987_01114; phage(gi155042943) 9e-40 Click
22complement(1128910..1129209) PHAGE_Bacill_1: Putative aminopeptidase; HMPREF0987_01115; phage(gi155042942) 2e-21 Click
23complement(1129226..1129618) PHAGE_Bacill_1: hypothetical protein BV1_gp26; HMPREF0987_01116; phage(gi155042941) 3e-13 Click
24complement(1129596..1129958) PHAGE_Geobac_E2: putative head-tail adaptor; HMPREF0987_01117; phage(gi148747735) 6e-06 Click
25complement(1129958..1130227) PHAGE_Entero_EFRM31: head-tail joining protein; HMPREF0987_01118; phage(gi327198117) 3e-06 Click
26complement(1130245..1131447) PHAGE_Entero_phiP27: putative major capsid protein; HMPREF0987_01119; phage(gi18249904) 4e-41 Click
27complement(1131467..1132174) PHAGE_Geobac_E2: putative Clp peptidase; HMPREF0987_01120; phage(gi148747731) 3e-50 Click
28complement(1132472..1133731) PHAGE_Yersin_PY54: portal protein; HMPREF0987_01121; phage(gi33770511) 1e-74 Click
29complement(1133806..1134849) hypothetical protein; HMPREF0987_01122 0.0 Click
30complement(1134806..1136032) hypothetical protein; HMPREF0987_01123 0.0 Click
31complement(1136104..1137651) PHAGE_Nocard_NBR1: terminase large subunit; HMPREF0987_01124; phage(gi372217589) 4e-86 Click
321145257..1145269 attR    TTCATATTTTTTT 0.0 Click

Region 2, total : 23 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11902959..1902995 attL    AGCCAAGAAAGCCCGTAAAATAGGCATTTCTTGGCTC 0.0 Click
21902959..1902995 attL    AGCCAAGAAAGCCCGTAAAATAGGCATTTCTTGGCTC 0.0 Click
31904407..1904418 attL    TATAATATTAAC 0.0 Click
4complement(1908403..1909464) PHAGE_Clostr_phi3626: putative integrase; HMPREF0987_01828; phage(gi20065985) 1e-107 Click
5complement(1909483..1909674) PHAGE_Clostr_phi3626: Gp27 protein; HMPREF0987_01829; phage(gi20065990) 2e-11 Click
61909841..1910380 PHAGE_Lactoc_phiLC3: phage repressor; HMPREF0987_01830; phage(gi45597387) 1e-09 Click
71910400..1911302 hypothetical protein; HMPREF0987_01831 0.0 Click
8complement(1911706..1912614) PHAGE_Ectoca_1: EsV-1-65; HMPREF0987_01832; phage(gi13242537) 1e-08 Click
9complement(1912618..1913463) hypothetical protein; HMPREF0987_01833 0.0 Click
10complement(1913456..1914409) PHAGE_Plankt_PaV_LD: ABC transporter; HMPREF0987_01834; phage(gi371496158) 6e-17 Click
11complement(1914461..1915144) PHAGE_Ectoca_1: EsV-1-65; HMPREF0987_01835; phage(gi13242537) 3e-05 Click
121915535..1915647 hypothetical protein; HMPREF0987_01836 0.0 Click
131915771..1915941 hypothetical protein; HMPREF0987_01837 0.0 Click
141916242..1916253 attR    TATAATATTAAC 0.0 Click
15complement(1916345..1917550) hypothetical protein; HMPREF0987_01838 0.0 Click
16complement(1917988..1918128) hypothetical protein; HMPREF0987_01839 0.0 Click
17complement(1918387..1918620) hypothetical protein; HMPREF0987_01840 0.0 Click
18complement(1918693..1919694) PHAGE_Pseudo_PAK_P1: primase/helicase; HMPREF0987_01841; phage(gi326804438) 7e-06 Click
19complement(1919828..1920190) hypothetical protein; HMPREF0987_01842 0.0 Click
20complement(1920183..1921268) PHAGE_Clostr_phi3626: putative integrase; HMPREF0987_01843; phage(gi20065985) 1e-90 Click
21complement(1921283..1921471) PHAGE_Clostr_phi3626: Gp27 protein; HMPREF0987_01844; phage(gi20065990) 5e-07 Click
221921648..1922079 PHAGE_Strept_PH15: putative transcriptional repressor; HMPREF0987_01845; phage(gi190151419) 6e-08 Click
231922144..1922180 attR    AGCCAAGAAAGCCCGTAAAATAGGCATTTCTTGGCTC 0.0 Click
24complement(1922429..1922920) hypothetical protein; HMPREF0987_01846 0.0 Click
25complement(1922902..1923006) hypothetical protein; HMPREF0987_01847 0.0 Click
26complement(1923306..1923986) hypothetical protein; HMPREF0987_01848 0.0 Click
27complement(1924206..1924568) hypothetical protein; HMPREF0987_01849 0.0 Click
28complement(1924561..1925646) PHAGE_Clostr_phi3626: putative integrase; HMPREF0987_01850; phage(gi20065985) 3e-91 Click
291926521..1926557 attR    AGCCAAGAAAGCCCGTAAAATAGGCATTTCTTGGCTC 0.0 Click