Staphylococcus aureus subsp. aureus H19 .1, whole genome [asmbl_id: NC_000000].2783181, GC%: 32.68%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1936724..938190 PHAGE_Staphy_42E: ORF012; PP_00890; phage(gi66395520) 2e-38 Click
2938215..939756 GMP synthase [glutamine-hydrolyzing] [Staphylococcus aureus subsp. aureus ST228] gi|470224030|ref|YP_007622609.1|; PP_00891 0.0 Click
3939745..939765 attL    GAGTGGGAATAATTATATATA 0.0 Click
4complement(939850..940986) PROPHAGE_Oceano_HTE831: integrase; PP_00892; phage(gi23097608) 5e-85 Click
5complement(941070..941456) PHAGE_Lactoc_T: cI repressor; PP_00893; phage(gi14251159) 2e-11 Click
6941825..942085 bovine pathogenicity island protein Orf18 [Staphylococcus aureus subsp. aureus ST398] gi|387601761|ref|YP_005733282.1|; PP_00894 5e-40 Click
7942132..942278 hypothetical protein MW0748 [Staphylococcus aureus subsp. aureus MW2] gi|21282477|ref|NP_645565.1|; PP_00895 5e-16 Click
8942271..942495 PHAGE_Staphy_PT1028: ORF021; PP_00896; phage(gi66395185) 7e-08 Click
9942496..942795 PHAGE_Staphy_PT1028: ORF016; PP_00897; phage(gi66395180) 6e-41 Click
10942886..945249 PHAGE_Strept_858: orf40; PP_00898; phage(gi168229313) 2e-95 Click
11945909..946253 PHAGE_Staphy_PT1028: ORF013; PP_00899; phage(gi66395177) 5e-09 Click
12946478..946684 conserved hypothetical protein [Staphylococcus aureus subsp. aureus ST398] gi|387601767|ref|YP_005733288.1|; PP_00900 3e-33 Click
13946671..947729 PHAGE_Staphy_2: phage capsid; PP_00901; phage(gi156603997) 5e-15 Click
14947912..948403 PHAGE_Staphy_PT1028: ORF010; PP_00902; phage(gi66395174) 1e-27 Click
15948724..949326 PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp05; PP_00903; phage(gi122891789) 4e-07 Click
16949417..950178 hypothetical protein APJL_0960 [Actinobacillus pleuropneumoniae serovar 3 str. JL03] gi|165976369|ref|YP_001651962.1|; PP_00904 2e-40 Click
17950323..950451 hypothetical; PP_00905 0.0 Click
18complement(950662..951216) PHAGE_Staphy_71: ORF024; PP_00906; phage(gi66396064) 4e-53 Click
19952000..952800 PHAGE_Strept_2: streptococcal superantigen SSA; PP_00907; phage(gi28876204) 2e-84 Click
20complement(952967..953689) PHAGE_Staphy_phiNM3: enterotoxin type A precursor; PP_00908; phage(gi118725111) 6e-30 Click
21953960..953980 attR    GAGTGGGAATAATTATATATA 0.0 Click

Region 2, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2233266..2234234) PHAGE_Ostreo_OsV5: hypothetical protein OsV5_197f; PP_02122; phage(gi163955169) 2e-12 Click
2complement(2234581..2234934) PHAGE_Spirop_R8A2B: putative transposase; PP_02123; phage(gi9626114) 2e-13 Click
3complement(2235098..2235601) PHAGE_Staphy_phiPV83: transposase; PP_02124; phage(gi9635740) 2e-07 Click
4complement(2235710..2236051) putative lipoprotein [Staphylococcus aureus subsp. aureus MSHR1132] gi|379796052|ref|YP_005326051.1|; PP_02125 4e-60 Click
5complement(2236107..2236697) putative exported protein [Staphylococcus aureus subsp. aureus TW20] gi|387144279|ref|YP_005732673.1|; PP_02126 5e-108 Click
6complement(2236704..2237750) PHAGE_Staphy_JD007: tail lysin; PP_02127; phage(gi428783012) 5e-20 Click
7complement(2237740..2239587) PHAGE_Human__8: LANA; PP_02128; phage(gi139472804) 7e-08 Click
8complement(2239592..2240950) PHAGE_Bacill_B4: cell division FtsK/SpoIIIE-like protein; PP_02129; phage(gi410493290) 9e-13 Click

Region 3, total : 140 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12368849..2370462 PHAGE_Clostr_st: botulinum neurotoxin type C1 precursor; PP_02245; phage(gi80159772) 3e-06 Click
22370477..2370776 hypothetical protein SAOV_1792 [Staphylococcus aureus subsp. aureus ED133] gi|384548025|ref|YP_005737278.1|; PP_02246 2e-44 Click
3complement(2371013..2372191) Type I restriction-modification system, specificity subunit S [Staphylococcus aureus subsp. aureus ED133] gi|384548026|ref|YP_005737279.1|; PP_02247 0.0 Click
42371246..2371259 attL    TCATAAATATCAAA 0.0 Click
5complement(2372184..2373401) PHAGE_Acinet_Bphi_B1251: putative restriction-modification protein; PP_02248; phage(gi423261981) 5e-23 Click
6complement(2373425..2373556) Type I restriction-modification system, M subunit [Staphylococcus aureus subsp. aureus ST228] gi|470225039|ref|YP_007623618.1|; PP_02249 7e-07 Click
7complement(2373736..2374452) PHAGE_Dengue_2: Polyprotein; PP_02250; phage(gi159024209) 8e-05 Click
8complement(2374619..2375335) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; PP_02251; phage(gi17426294) 9e-12 Click
9complement(2375460..2376179) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; PP_02252; phage(gi17426294) 4e-13 Click
10complement(2376237..2376959) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; PP_02253; phage(gi17426294) 2e-19 Click
11complement(2377078..2377785) PHAGE_Staphy_phiETA: Staphylococcus aureus exfoliative toxin A; PP_02254; phage(gi17426294) 3e-14 Click
122378850..2379422 PHAGE_Staphy_71: ORF024; PP_02255; phage(gi66396064) 2e-33 Click
13complement(2379897..2380595) hypothetical protein SAB1676c [Staphylococcus aureus RF122] gi|82751398|ref|YP_417139.1|; PP_02256 3e-126 Click
14complement(2380592..2381353) putative lantibiotic ABC transporter protein [Staphylococcus aureus subsp. aureus ED133] gi|384548033|ref|YP_005737286.1|; PP_02257 3e-138 Click
15complement(2381350..2382042) PHAGE_Amsact_: putative ATP-binding cassette transporter; PP_02258; phage(gi9964444) 1e-18 Click
16complement(2382065..2383375) PROPHAGE_Deinoc_R1: serine protease; PP_02259; phage(gi15808000) 4e-13 Click
17complement(2383448..2383966) PHAGE_Fowlpo_virus: HAL3 domain; PP_02260; phage(gi9634784) 3e-13 Click
18complement(2383982..2385226) hypothetical protein SAB1681c [Staphylococcus aureus RF122] gi|82751403|ref|YP_417144.1|; PP_02261 0.0 Click
19complement(2385219..2388212) hypothetical protein SAB1682c [Staphylococcus aureus RF122] gi|82751404|ref|YP_417145.1|; PP_02262 0.0 Click
20complement(2388277..2388420) hypothetical protein SAB1683c [Staphylococcus aureus RF122] gi|82751405|ref|YP_417146.1|; PP_02263 5e-21 Click
21complement(2389454..2390434) PHAGE_Staphy_phi5967PVL: Panton-Valentine leukocidin chain S; PP_02264; phage(gi431810286) 1e-158 Click
22complement(2390436..2391371) PHAGE_Staphy_phiPV83: LukM precursor; PP_02265; phage(gi9635736) 2e-134 Click
232392810..2392926 hypothetical protein SAR1909 [Staphylococcus aureus subsp. aureus MRSA252] gi|49484062|ref|YP_041286.1|; PP_02266 9e-13 Click
242393025..2393621 hypothetical protein SAB1690 [Staphylococcus aureus RF122] gi|82751412|ref|YP_417153.1|; PP_02267 6e-107 Click
252393788..2394051 hypothetical protein SAB1691 [Staphylococcus aureus RF122] gi|82751413|ref|YP_417154.1|; PP_02268 3e-40 Click
262394204..2395133 PHAGE_Clostr_phiCD6356: putative phage tail tape measure protein; PP_02269; phage(gi326536862) 4e-07 Click
272395703..2395939 hypothetical protein HMPREF0772_11324 [Staphylococcus aureus subsp. aureus TCH60] gi|384867210|ref|YP_005747406.1|; PP_02270 4e-39 Click
282395960..2396736 PHAGE_Lactob_Lj965: hypothetical protein Ljo_0291; PP_02271; phage(gi41179221) 3e-27 Click
29complement(2397306..2398082) PHAGE_Strept_2: streptococcal superantigen SSA; PP_02272; phage(gi28876204) 2e-47 Click
30complement(2398373..2398870) PHAGE_Staphy_phiNM3: enterotoxin type A precursor; PP_02273; phage(gi118725111) 6e-38 Click
31complement(2399167..2399430) PHAGE_Strept_2: streptococcal superantigen SSA; PP_02274; phage(gi28876204) 5e-29 Click
32complement(2399519..2399899) PHAGE_Strept_2: streptococcal superantigen SSA; PP_02275; phage(gi28876204) 3e-33 Click
33complement(2400107..2400835) PHAGE_Staphy_phiNM3: enterotoxin type A precursor; PP_02276; phage(gi118725111) 4e-31 Click
34complement(2400870..2401589) PHAGE_Staphy_phiNM3: enterotoxin type A precursor; PP_02277; phage(gi118725111) 3e-27 Click
35complement(2401872..2402636) PHAGE_Staphy_phiN315: enterotoxin P; PP_02278; phage(gi30043936) 9e-40 Click
36complement(2402883..2402971) tRNA 0.0 Click
37complement(2403026..2403097) tRNA 0.0 Click
38complement(2403099..2403173) tRNA 0.0 Click
39complement(2403188..2403261) tRNA 0.0 Click
40complement(2403277..2403352) tRNA 0.0 Click
41complement(2403366..2403438) tRNA 0.0 Click
42complement(2403455..2403530) tRNA 0.0 Click
43complement(2403552..2403625) tRNA 0.0 Click
44complement(2404132..2404686) Putative uncharacterized protein [Staphylococcus aureus subsp. aureus ST228] gi|470225056|ref|YP_007623635.1|; PP_02279 3e-104 Click
45complement(2405006..2406406) putative protoporphyrinogen oxidase [Staphylococcus aureus subsp. aureus HO 5096 0412] gi|386831418|ref|YP_006238072.1|; PP_02280 0.0 Click
46complement(2406430..2407353) Ferrochelatase [Staphylococcus aureus subsp. aureus ST228] gi|470225058|ref|YP_007623637.1|; PP_02281 6e-180 Click
47complement(2407411..2408448) uroporphyrinogen decarboxylase [Staphylococcus aureus subsp. aureus ST398] gi|387603166|ref|YP_005734687.1|; PP_02282 0.0 Click
482408710..2409213 RNAIII-activating protein TRAP [Staphylococcus aureus subsp. aureus TCH60] gi|384867196|ref|YP_005747392.1|; PP_02283 1e-94 Click
49complement(2409337..2410560) ABC transporter permease EscB [Staphylococcus aureus subsp. aureus M013] gi|379021596|ref|YP_005298258.1|; PP_02284 0.0 Click
50complement(2410553..2411293) PHAGE_Plankt_PaV_LD: ABC transporter; PP_02285; phage(gi371496158) 3e-18 Click
512411427..2411849 PHAGE_Strept_phiSASD1: gp4; PP_02286; phage(gi298103512) 8e-08 Click
522411991..2412356 hypothetical protein SAVC_08425 [Staphylococcus aureus subsp. aureus VC40] gi|379015041|ref|YP_005291277.1|; PP_02287 1e-61 Click
532413089..2413646 Putative uncharacterized protein [Staphylococcus aureus subsp. aureus ST228] gi|470225063|ref|YP_007623642.1|; PP_02288 1e-103 Click
542413851..2414813 PHAGE_Lactoc_lato: putative tail lysin; PP_02289; phage(gi30089904) 1e-06 Click
55complement(2414934..2415875) 3'-5' exoribonuclease YhaM [Staphylococcus aureus subsp. aureus VC40] gi|379015044|ref|YP_005291280.1|; PP_02290 2e-179 Click
56complement(2415872..2418808) PHAGE_Glossi_virus: hypothetical protein SGHV062; PP_02291; phage(gi168804078) 3e-15 Click
57complement(2418798..2419994) PHAGE_Bacill_phiAGATE: putative recombination exonuclease; PP_02292; phage(gi448261013) 5e-12 Click
58complement(2420927..2421271) hypothetical protein SAVC_08465 [Staphylococcus aureus subsp. aureus VC40] gi|379015047|ref|YP_005291283.1|; PP_02293 1e-56 Click
59complement(2421340..2422464) hypothetical protein SAB1779c [Staphylococcus aureus RF122] gi|82751500|ref|YP_417241.1|; PP_02294 0.0 Click
60complement(2422643..2423107) Putative uncharacterized protein [Staphylococcus aureus subsp. aureus ST228] gi|470225070|ref|YP_007623649.1|; PP_02295 1e-85 Click
61complement(2423469..2424092) DNA-binding response regulator [Staphylococcus aureus subsp. aureus VC40] gi|379015050|ref|YP_005291286.1|; PP_02296 6e-113 Click
62complement(2424114..2425226) putative sensor histidine kinase [Staphylococcus aureus subsp. aureus VC40] gi|379015051|ref|YP_005291287.1|; PP_02297 0.0 Click
632425389..2426210 ribosomal large subunit pseudouridine synthase [Staphylococcus aureus subsp. aureus TCH60] gi|384867180|ref|YP_005747376.1|; PP_02298 2e-154 Click
64complement(2426675..2428060) fumarate hydratase, class II [Staphylococcus aureus subsp. aureus ST398] gi|387603184|ref|YP_005734705.1|; PP_02299 0.0 Click
65complement(2428256..2428651) hypothetical protein SAB1785c [Staphylococcus aureus RF122] gi|82751506|ref|YP_417247.1|; PP_02300 9e-66 Click
66complement(2429598..2429750) hypothetical protein SAVC_08515 [Staphylococcus aureus subsp. aureus VC40] gi|379015056|ref|YP_005291292.1|; PP_02301 1e-21 Click
67complement(2429775..2430374) glucosamine-6-phosphate isomerase [Staphylococcus aureus subsp. aureus TCH60] gi|384867176|ref|YP_005747372.1|; PP_02302 1e-106 Click
68complement(2430533..2431003) RNA methyltransferase [Staphylococcus aureus subsp. aureus TCH60] gi|384867175|ref|YP_005747371.1|; PP_02303 7e-89 Click
69complement(2431008..2432135) Iron-sulfur (Fe-S) cluster-binding protein [Staphylococcus aureus subsp. aureus ST228] gi|470225077|ref|YP_007623656.1|; PP_02304 0.0 Click
70complement(2432285..2433013) PHAGE_Plankt_PaV_LD: ABC transporter; PP_02305; phage(gi371496158) 2e-38 Click
71complement(2433000..2434457) substrate-binding glutamine ABC transporter [Staphylococcus aureus subsp. aureus ED133] gi|384548078|ref|YP_005737331.1|; PP_02306 0.0 Click
72complement(2434715..2435776) PHAGE_Strept_5093: putative antireceptor protein; PP_02307; phage(gi238801907) 2e-05 Click
73complement(2436322..2436405) tRNA 0.0 Click
74complement(2436444..2436518) tRNA 0.0 Click
75complement(2436622..2436696) tRNA 0.0 Click
76complement(2436704..2436777) tRNA 0.0 Click
77complement(2436783..2436854) tRNA 0.0 Click
78complement(2436866..2436938) tRNA 0.0 Click
79complement(2436941..2437014) tRNA 0.0 Click
80complement(2437030..2437110) tRNA 0.0 Click
81complement(2437116..2437191) tRNA 0.0 Click
82complement(2437199..2437271) tRNA 0.0 Click
83complement(2437290..2437365) tRNA 0.0 Click
84complement(2437411..2437486) tRNA 0.0 Click
85complement(2437497..2437586) tRNA 0.0 Click
86complement(2437596..2437669) tRNA 0.0 Click
87complement(2437695..2437771) tRNA 0.0 Click
88complement(2437793..2437868) tRNA 0.0 Click
89complement(2437886..2437959) tRNA 0.0 Click
90complement(2437969..2438042) tRNA 0.0 Click
91complement(2438061..2438149) tRNA 0.0 Click
92complement(2438160..2438234) tRNA 0.0 Click
93complement(2438238..2438319) tRNA 0.0 Click
94complement(2438323..2438398) tRNA 0.0 Click
95complement(2438404..2438479) tRNA 0.0 Click
96complement(2438496..2438571) tRNA 0.0 Click
97complement(2439223..2439669) FUR family transcriptional regulator [Staphylococcus aureus subsp. aureus VC40] gi|379015064|ref|YP_005291300.1|; PP_02308 4e-82 Click
98complement(2439766..2440716) PHAGE_Acanth_1: hypothetical protein ATCV1_Z295L; PP_02309; phage(gi155371242) 3e-10 Click
99complement(2440722..2441177) Similar to bacterioferritin comigratory protein [Staphylococcus aureus subsp. aureus ST228] gi|470225083|ref|YP_007623662.1|; PP_02310 1e-81 Click
1002441258..2442547 PHAGE_Mycoba_Myrna: gp183; PP_02311; phage(gi203454746) 3e-06 Click
1012442840..2443934 Putative uncharacterized protein [Staphylococcus aureus subsp. aureus ST228] gi|470225085|ref|YP_007623664.1|; PP_02312 0.0 Click
102complement(2444125..2445861) PHAGE_Bacill_SPBc2: ABC transporter; PP_02313; phage(gi9630145) 3e-43 Click
103complement(2446152..2446694) UPF0374 protein SAOUHSC_02004 [Staphylococcus aureus subsp. aureus ST228] gi|470225087|ref|YP_007623666.1|; PP_02314 6e-107 Click
104complement(2446997..2448034) A/G-specific adenine glycosylase [Staphylococcus aureus subsp. aureus M013] gi|379021628|ref|YP_005298290.1|; PP_02315 0.0 Click
1052448186..2449163 YfhP protein [Staphylococcus aureus subsp. aureus ST398] gi|387603201|ref|YP_005734722.1|; PP_02316 0.0 Click
106complement(2449424..2450260) teichoic acid ABC superfamily ATP binding cassette transporter, membrane protein [Staphylococcus aureus subsp. aureus JKD6159] gi|384550686|ref|YP_005739938.1|; PP_02317 7e-153 Click
107complement(2450269..2451786) PHAGE_Amsact_: putative ATP-binding cassette transporter; PP_02318; phage(gi9964444) 8e-07 Click
108complement(2451801..2452115) hypothetical protein SAVC_08615 [Staphylococcus aureus subsp. aureus VC40] gi|379015075|ref|YP_005291311.1|; PP_02319 5e-53 Click
109complement(2452093..2452911) PHAGE_Glossi_virus: hypothetical protein SGHV062; PP_02320; phage(gi168804078) 1e-05 Click
110complement(2453172..2453981) Putative Monofunctional biosynthetic peptidoglycan transglycosylase [Staphylococcus aureus subsp. aureus ST228] gi|470225093|ref|YP_007623672.1|; PP_02321 8e-153 Click
111complement(2454321..2454836) Uncharacterized protein SAOUHSC_02013 [Staphylococcus aureus subsp. aureus ST228] gi|470225094|ref|YP_007623673.1|; PP_02322 3e-93 Click
112complement(2454966..2455127) hypothetical protein SAVC_08635 [Staphylococcus aureus subsp. aureus VC40] gi|379015079|ref|YP_005291315.1|; PP_02323 1e-22 Click
113complement(2455667..2456281) PHAGE_Staphy_P954: hypothetical protein; PP_02324; phage(gi257136425) 3e-113 Click
114complement(2456278..2456454) PHAGE_Staphy_P954: hypothetical protein; PP_02325; phage(gi257136424) 3e-26 Click
115complement(2456965..2458410) PHAGE_Staphy_55: ORF007; PP_02326; phage(gi66396120) 0.0 Click
116complement(2458391..2458828) PHAGE_Staphy_phiMR11: putative holin protein; PP_02327; phage(gi162290172) 5e-77 Click
117complement(2458884..2459279) PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp66; PP_02328; phage(gi122891780) 3e-71 Click
118complement(2459285..2460457) PHAGE_Staphy_TEM123: phage tail fiber protein; PP_02329; phage(gi388570329) 0.0 Click
119complement(2460470..2462344) PHAGE_Staphy_phiMR11: tail tip protein; PP_02330; phage(gi162290169) 0.0 Click
120complement(2462481..2462780) PHAGE_Staphy_phi7401PVL: hypothetical protein; PP_02331; phage(gi448244681) 2e-52 Click
121complement(2462821..2463003) PHAGE_Staphy_52A: ORF084; PP_02332; phage(gi66396324) 1e-30 Click
122complement(2463004..2463381) PHAGE_Staphy_85: ORF040; PP_02333; phage(gi66394905) 3e-65 Click
123complement(2463381..2465204) PHAGE_Staphy_phiETA: similar to phage phi105 ORF42; PP_02334; phage(gi17426285) 0.0 Click
124complement(2465204..2467102) PHAGE_Staphy_phiETA: similar to phage LL-H gp89; PP_02335; phage(gi17426284) 0.0 Click
125complement(2467115..2469001) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp57; PP_02336; phage(gi122891841) 0.0 Click
126complement(2469012..2469953) PHAGE_Staphy_ROSA: ORF039; PP_02337; phage(gi66396002) 0.0 Click
127complement(2469968..2473111) PHAGE_Staphy_96: ORF001; PP_02338; phage(gi66395886) 0.0 Click
128complement(2473115..2473399) PHAGE_Staphy_EW: ORF057; PP_02339; phage(gi66395854) 1e-33 Click
129complement(2473444..2473950) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp53; PP_02340; phage(gi122891837) 3e-94 Click
130complement(2474017..2474574) PHAGE_Staphy_phiETA3: major tail protein; PP_02341; phage(gi122891836) 3e-105 Click
131complement(2474575..2475000) PHAGE_Staphy_phiETA3: tail protein; PP_02342; phage(gi122891835) 7e-73 Click
132complement(2475013..2475420) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp50; PP_02343; phage(gi122891834) 9e-62 Click
133complement(2475407..2475742) PHAGE_Staphy_vB_SepiS_phiIPLA5: head tail adaptor; PP_02344; phage(gi399528904) 3e-39 Click
134complement(2475754..2476104) PHAGE_Staphy_phiETA3: head completion protein; PP_02345; phage(gi122891832) 1e-62 Click
135complement(2476265..2477179) PHAGE_Staphy_phiETA3: major capsid protein; PP_02346; phage(gi122891830) 1e-172 Click
136complement(2477196..2477780) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp45; PP_02347; phage(gi122891829) 1e-103 Click
137complement(2477883..2478089) PHAGE_Staphy_96: ORF066; PP_02348; phage(gi66395943) 9e-32 Click
138complement(2478091..2479044) PHAGE_Staphy_phiETA3: minor head protein; PP_02349; phage(gi122891827) 5e-178 Click
139complement(2479013..2480437) PHAGE_Staphy_phiETA3: portal protein; PP_02350; phage(gi122891826) 0.0 Click
140complement(2480434..2481657) PHAGE_Staphy_phiETA3: large terminase; PP_02351; phage(gi122891825) 0.0 Click
141complement(2481650..2482144) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp40; PP_02352; phage(gi122891824) 3e-79 Click
142complement(2482472..2482894) PHAGE_Staphy_ROSA: ORF028; PP_02353; phage(gi66395992) 4e-77 Click
143complement(2482918..2483064) PHAGE_Staphy_ROSA: ORF128; PP_02354; phage(gi66396034) 3e-20 Click
144complement(2483065..2483430) PHAGE_Staphy_ROSA: ORF037; PP_02355; phage(gi66396000) 4e-64 Click
145complement(2483431..2483604) PHAGE_Staphy_29: ORF085; PP_02356; phage(gi66396255) 6e-25 Click
146complement(2483597..2483833) PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p32; PP_02357; phage(gi9635707) 1e-40 Click
147complement(2483858..2484025) PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p31; PP_02358; phage(gi19343454) 5e-21 Click
148complement(2484208..2484642) PHAGE_Staphy_3A: ORF020; PP_02359; phage(gi66395608) 1e-40 Click
149complement(2484646..2485002) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp28; PP_02360; phage(gi122891812) 2e-64 Click
150complement(2485130..2485435) PHAGE_Staphy_69: ORF047; PP_02361; phage(gi66395335) 2e-52 Click
151complement(2485436..2485621) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp26; PP_02362; phage(gi122891810) 4e-30 Click
152complement(2485626..2486030) PHAGE_Staphy_77: 77ORF028; PP_02363; phage(gi41189541) 3e-75 Click
153complement(2486040..2486261) PHAGE_Staphy_3: hypothetical protein SPTP3103_gp22; PP_02364; phage(gi156604039) 3e-36 Click
154complement(2486274..2486432) PHAGE_Staphy_ROSA: ORF117; PP_02365; phage(gi66396032) 4e-24 Click
155complement(2486426..2487205) PHAGE_Staphy_phi5967PVL: hypothetical protein; PP_02366; phage(gi431810260) 1e-150 Click
156complement(2487215..2487955) PHAGE_Staphy_phiETA3: Rep protein; PP_02367; phage(gi122891805) 9e-143 Click
1572488021..2488302 PHAGE_Staphy_CN125: hypothetical protein CURR004; PP_02368; phage(gi239507426) 2e-51 Click
158complement(2488441..2489112) PHAGE_Staphy_3: hypothetical protein SPTP3103_gp17; PP_02369; phage(gi156604034) 6e-129 Click
159complement(2489125..2489676) PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp15; PP_02370; phage(gi118430739) 2e-106 Click
160complement(2489705..2490493) PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp14; PP_02371; phage(gi118430738) 1e-147 Click
161complement(2490486..2490707) PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp15; PP_02372; phage(gi122891729) 5e-37 Click
162complement(2490717..2490977) PHAGE_Staphy_X2: ORF062; PP_02373; phage(gi66394721) 5e-46 Click
163complement(2491242..2491505) PHAGE_Staphy_phi5967PVL: hypothetical protein; PP_02374; phage(gi431810252) 2e-48 Click
164complement(2491766..2492077) PHAGE_Staphy_phi5967PVL: hypothetical protein; PP_02375; phage(gi431810251) 3e-55 Click
1652492133..2492372 PHAGE_Staphy_EW: ORF065; PP_02376; phage(gi66395858) 3e-42 Click
166complement(2492362..2492541) PHAGE_Staphy_phiETA: hypothetical protein phiETA_08; PP_02377; phage(gi17426236) 3e-28 Click
167complement(2492556..2492999) PHAGE_Staphy_2: hypothetical protein SPTP3102_gp07; PP_02378; phage(gi156603956) 6e-79 Click
168complement(2493012..2493260) PHAGE_Staphy_ROSA: ORF063; PP_02379; phage(gi66396019) 6e-41 Click
1692493424..2493747 PHAGE_Staphy_phi7401PVL: phage repressor; PP_02380; phage(gi448244648) 3e-55 Click
1702493760..2494221 PHAGE_Staphy_ROSA: ORF026; PP_02381; phage(gi66395990) 5e-85 Click
1712494242..2494733 PHAGE_Staphy_ROSA: ORF025; PP_02382; phage(gi66395989) 5e-89 Click
172complement(2494859..2495038) PHAGE_Staphy_phiNM: excisionase; PP_02383; phage(gi118430726) 5e-28 Click
1732494956..2494969 attR    TCATAAATATCAAA 0.0 Click
1742495151..2496197 PHAGE_Staphy_phiNM: integrase; PP_02384; phage(gi118430725) 0.0 Click

Region 4, total : 72 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2571072..2571422) PHAGE_Staphy_phiN315: hypothetical protein SA1754; PP_02463; phage(gi30043928) 9e-59 Click
22572104..2572553 PHAGE_Staphy_phiN315: hypothetical protein SA1755; PP_02464; phage(gi30043929) 4e-81 Click
3complement(2572756..2572941) PHAGE_Staphy_12: peptidoglycan hydrolase; PP_02465; phage(gi29028666) 1e-31 Click
42573429..2573458 attL    AAAAATAGGCAAGTACCGAAGTACCTGCCT 0.0 Click
5complement(2573631..2574122) PHAGE_Staphy_phiN315: STAPHYLOKINASE PRECURSOR; PP_02466; phage(gi30043932) 1e-88 Click
6complement(2574312..2575067) PHAGE_Staphy_3: amidase; PP_02467; phage(gi156604072) 1e-152 Click
7complement(2575079..2575333) PHAGE_Staphy_phiN315: holin homolog; PP_02468; phage(gi30043934) 3e-43 Click
8complement(2575545..2575679) PHAGE_Staphy_phiN315: hypothetical protein SAS059; PP_02469; phage(gi30043935) 9e-16 Click
9complement(2575864..2576238) PHAGE_Staphy_phiN315: hypothetical protein SA1762; PP_02470; phage(gi30043938) 1e-64 Click
10complement(2576294..2576581) PHAGE_Staphy_phiN315: hypothetical protein SA1763; PP_02471; phage(gi30043939) 1e-46 Click
11complement(2576627..2576779) PHAGE_Staphy_phiN315: hypothetical protein SAS061; PP_02472; phage(gi30043940) 2e-22 Click
12complement(2576772..2580554) PHAGE_Staphy_phiN315: hypothetical protein SA1764; PP_02473; phage(gi30043941) 0.0 Click
13complement(2580570..2582054) PHAGE_Staphy_phiN315: hypothetical protein SA1765; PP_02474; phage(gi30043942) 0.0 Click
14complement(2582051..2586583) PHAGE_Staphy_phiN315: hypothetical protein SA1766; PP_02475; phage(gi30043943) 0.0 Click
15complement(2586640..2586777) PHAGE_Staphy_77: 77ORF100; PP_02476; phage(gi41189576) 8e-20 Click
16complement(2586828..2587178) PHAGE_Staphy_phiN315: hypothetical protein SA1767; PP_02477; phage(gi30043944) 1e-61 Click
17complement(2587236..2587367) PHAGE_Staphy_phiNM3: hypothetical protein; PP_02478; phage(gi118725102) 5e-16 Click
18complement(2587493..2588137) PHAGE_Staphy_phiN315: hypothetical protein SA1768; PP_02479; phage(gi30043945) 8e-121 Click
19complement(2588138..2588545) PHAGE_Staphy_phiN315: hypothetical protein SA1769; PP_02480; phage(gi30043946) 2e-75 Click
20complement(2588542..2588946) PHAGE_Staphy_phiN315: hypothetical protein SA1770; PP_02481; phage(gi30043947) 2e-71 Click
21complement(2588943..2589305) PHAGE_Staphy_phiN315: hypothetical protein SA1771; PP_02482; phage(gi30043948) 2e-67 Click
22complement(2589289..2589573) PHAGE_Staphy_phiN315: hypothetical protein SA1772; PP_02483; phage(gi30043949) 2e-48 Click
23complement(2589682..2589846) PHAGE_Staphy_phiN315: hypothetical protein SA1773; PP_02484; phage(gi30043950) 1e-25 Click
24complement(2589866..2591011) PHAGE_Staphy_phiN315: hypothetical protein SA1774; PP_02485; phage(gi30043951) 0.0 Click
25complement(2591035..2591772) PHAGE_Staphy_phiN315: hypothetical protein, similar to scaffolding protein; PP_02486; phage(gi30043952) 3e-134 Click
26complement(2591756..2592028) PHAGE_Staphy_phiN315: hypothetical protein SA1776; PP_02487; phage(gi30043953) 6e-47 Click
27complement(2592085..2592942) PHAGE_Staphy_phiN315: hypothetical protein SA1776; PP_02488; phage(gi30043953) 3e-155 Click
28complement(2592958..2594619) PHAGE_Staphy_phiN315: hypothetical protein SA1777; PP_02489; phage(gi30043954) 0.0 Click
29complement(2594616..2594960) PHAGE_Staphy_phiN315: hypothetical protein SA1778; PP_02490; phage(gi30043955) 3e-60 Click
30complement(2595091..2595390) PHAGE_Staphy_phiN315: hypothetical protein SA1779; PP_02491; phage(gi30043956) 4e-57 Click
31complement(2595622..2596038) PHAGE_Staphy_phiN315: hypothetical protein SA1780; PP_02492; phage(gi30043957) 6e-79 Click
32complement(2596066..2596266) PHAGE_Staphy_phiN315: hypothetical protein SA1781; PP_02493; phage(gi30043958) 3e-32 Click
33complement(2596266..2596415) PHAGE_Staphy_phiN315: hypothetical protein SAS062; PP_02494; phage(gi30043959) 4e-21 Click
34complement(2596412..2596798) PHAGE_Staphy_2: hypothetical protein SPTP3102_gp36; PP_02495; phage(gi156603985) 9e-69 Click
35complement(2596791..2597027) PHAGE_Staphy_69: ORF061; PP_02496; phage(gi66395342) 8e-41 Click
36complement(2597020..2597223) PHAGE_Staphy_77: 77ORF072; PP_02497; phage(gi41189571) 3e-33 Click
37complement(2597220..2597414) PHAGE_Staphy_phiMR25: hypothetical protein; PP_02498; phage(gi189427158) 1e-30 Click
38complement(2597411..2597617) PHAGE_Staphy_phiN315: hypothetical protein SA1782; PP_02499; phage(gi30043960) 3e-31 Click
39complement(2597634..2597807) PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp35; PP_02500; phage(gi122891749) 1e-26 Click
40complement(2597844..2598350) PHAGE_Staphy_69: ORF026; PP_02501; phage(gi66395318) 3e-93 Click
41complement(2598343..2598513) PHAGE_Staphy_2: hypothetical protein SPTP3102_gp31; PP_02502; phage(gi156603980) 2e-25 Click
42complement(2598500..2598754) PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp32; PP_02503; phage(gi122891816) 5e-40 Click
43complement(2598920..2599129) PHAGE_Staphy_phiPV83: phi PVL ORF 51 homologue; PP_02504; phage(gi9635703) 5e-34 Click
44complement(2599130..2599747) PHAGE_Staphy_92: ORF023; PP_02505; phage(gi66396429) 4e-109 Click
45complement(2599748..2599933) PHAGE_Staphy_X2: ORF088; PP_02506; phage(gi66394732) 9e-29 Click
46complement(2599938..2600342) PHAGE_Staphy_77: 77ORF028; PP_02507; phage(gi41189541) 3e-74 Click
47complement(2600353..2600574) PHAGE_Staphy_phiETA: hypothetical protein phiETA_24; PP_02508; phage(gi17426252) 2e-37 Click
48complement(2600577..2600756) PHAGE_Staphy_phiMR11: hypothetical protein; PP_02509; phage(gi162290127) 1e-30 Click
49complement(2600789..2602030) PHAGE_Staphy_P954: helicase DnaB; PP_02510; phage(gi257136378) 0.0 Click
50complement(2602027..2602383) PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp18; PP_02511; phage(gi215401188) 3e-64 Click
51complement(2602383..2603198) PHAGE_Staphy_29: ORF015; PP_02512; phage(gi66396206) 3e-146 Click
52complement(2603170..2603865) PHAGE_Staphy_P954: hypothetical protein; PP_02513; phage(gi257136375) 1e-128 Click
53complement(2603879..2604307) PHAGE_Staphy_85: ORF033; PP_02514; phage(gi66394900) 2e-77 Click
54complement(2604307..2604945) PHAGE_Staphy_92: ORF022; PP_02515; phage(gi66396428) 1e-116 Click
55complement(2604945..2605424) PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p16; PP_02516; phage(gi9635693) 3e-86 Click
56complement(2605417..2605653) PHAGE_Staphy_StB27: hypothetical protein; PP_02517; phage(gi431809688) 7e-19 Click
57complement(2605661..2605921) PHAGE_Staphy_26: hypothetical protein SAP26_gp39; PP_02518; phage(gi304443277) 8e-46 Click
58complement(2606173..2606493) PHAGE_Staphy_phiN315: hypothetical protein SA1799; PP_02519; phage(gi30043978) 2e-53 Click
592606548..2606928 PHAGE_Staphy_phiN315: hypothetical protein SA1800; PP_02520; phage(gi30043979) 2e-71 Click
60complement(2606915..2607112) PHAGE_Staphy_phiN315: hypothetical protein SAS064; PP_02521; phage(gi30043980) 3e-33 Click
61complement(2607128..2607877) PHAGE_Staphy_IPLA88: anti-repressor; PP_02522; phage(gi215401177) 8e-139 Click
622607928..2608257 PHAGE_Staphy_phiN315: hypothetical protein SA1802; PP_02523; phage(gi30043982) 8e-55 Click
63complement(2608246..2608461) PHAGE_Staphy_phiN315: hypothetical protein SA1803; PP_02524; phage(gi30043983) 3e-35 Click
64complement(2608552..2608740) PHAGE_Staphy_phiN315: hypothetical transcriptional regulator; PP_02525; phage(gi30043984) 2e-29 Click
652608873..2609586 PHAGE_Staphy_phiN315: similar to repressor; PP_02526; phage(gi30043985) 9e-134 Click
662609602..2610534 PHAGE_Staphy_phiN315: probable ATP-dependent helicase; PP_02527; phage(gi30043986) 2e-176 Click
672610540..2610881 PHAGE_Staphy_phiNM3: hypothetical protein; PP_02528; phage(gi118725057) 2e-59 Click
682611085..2611252 PHAGE_Staphy_80alpha: hypothetical protein SPV-80A_gp05; PP_02529; phage(gi148717847) 3e-26 Click
692611532..2612623 PHAGE_Clostr_phiC2: putative abortive infection bacteriophage resistance protein ORF 37; PP_02530; phage(gi134287370) 2e-10 Click
702612684..2613709 PHAGE_Staphy_phiN315: integrase; PP_02531; phage(gi30043990) 0.0 Click
712613777..2614601 phospholipase C [Staphylococcus aureus subsp. aureus VC40] gi|379015143|ref|YP_005291379.1|; PP_02532 2e-163 Click
72complement(2614853..2615869) PHAGE_Staphy_phiPV83: LukF-PV(P83) precursor; PP_02533; phage(gi9635737) 1e-58 Click
73complement(2615891..2616946) PHAGE_Staphy_phiPV83: LukM precursor; PP_02534; phage(gi9635736) 5e-44 Click
742622909..2622938 attR    AAAAATAGGCAAGTACCGAAGTACCTGCCT 0.0 Click

Region 5, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12618850..2618868 attL    TTTCTTTTCGAAATTCTCT 0.0 Click
2complement(2625552..2626121) PHAGE_Staphy_PT1028: ORF009; PP_02541; phage(gi66395173) 5e-105 Click
3complement(2626118..2626459) PHAGE_Staphy_PT1028: ORF014; PP_02542; phage(gi66395178) 4e-62 Click
4complement(2626462..2626989) PHAGE_Staphy_PT1028: ORF010; PP_02543; phage(gi66395174) 6e-96 Click
5complement(2627042..2627695) PHAGE_Staphy_PT1028: ORF007; PP_02544; phage(gi66395171) 2e-121 Click
6complement(2627726..2628070) PHAGE_Staphy_PT1028: ORF015; PP_02545; phage(gi66395179) 5e-54 Click
7complement(2628398..2628532) hypothetical; PP_02546 0.0 Click
8complement(2628778..2629419) PHAGE_Staphy_PT1028: ORF008; PP_02547; phage(gi66395172) 2e-112 Click
9complement(2629416..2629796) PHAGE_Staphy_PT1028: ORF013; PP_02548; phage(gi66395177) 2e-69 Click
10complement(2630126..2631826) PHAGE_Staphy_PT1028: ORF001; PP_02549; phage(gi66395165) 0.0 Click
11complement(2631840..2632709) PHAGE_Staphy_PT1028: ORF003; PP_02550; phage(gi66395167) 7e-167 Click
12complement(2632775..2633101) PHAGE_Staphy_PT1028: ORF016; PP_02551; phage(gi66395180) 4e-44 Click
13complement(2633104..2633313) PHAGE_Staphy_PT1028: ORF021; PP_02552; phage(gi66395185) 9e-34 Click
14complement(2633306..2633452) pathogenicity island protein [Staphylococcus aureus subsp. aureus TW20] gi|387142514|ref|YP_005730907.1|; PP_02553 7e-20 Click
15complement(2633449..2633766) Superantigen-encoding pathogenicity islands protein SaPI [Staphylococcus aureus subsp. aureus T0131] gi|384870574|ref|YP_005753288.1|; PP_02554 2e-53 Click
16complement(2633771..2633989) PHAGE_Mycoba_Pacc40: gp43; PP_02555; phage(gi206600122) 7e-05 Click
172634162..2634836 PHAGE_Lactoc_lato: hypothetical protein P335p08; PP_02556; phage(gi30089869) 2e-10 Click
182634850..2636022 PROPHAGE_Oceano_HTE831: integrase; PP_02557; phage(gi23097608) 3e-43 Click
19complement(2636091..2637707) PHAGE_Halocy_JM_2012: chaperonin GroEL; PP_02558; phage(gi389060206) 8e-67 Click
20complement(2637782..2638072) PHAGE_Bacill_36: GroES; PP_02559; phage(gi156564025) 8e-15 Click
212638247..2638990 abortive infection protein [Staphylococcus aureus subsp. aureus TCH60] gi|384867053|ref|YP_005747249.1|; PP_02560 2e-133 Click
22complement(2639015..2640244) PHAGE_Cafete_BV_PW1: hypothetical protein; PP_02561; phage(gi310831380) 1e-26 Click
232641179..2641197 attR    TTTCTTTTCGAAATTCTCT 0.0 Click