Clostridium botulinum E1 str. 'BoNT E Beluga' , whole [asmbl_id: NC_000000].3999201, GC%: 27.44%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(571048..572727) PHAGE_Strept_phiNJ2: putative recombinase; CLO_0500; phage(gi414090258) 7e-45 Click
2complement(572744..573490) PHAGE_Staphy_29: ORF022; CLO_0501; phage(gi66396213) 1e-32 Click
3573762..573992 conserved hypothetical protein; CLO_0502 0.0 Click
4574057..574221 hypothetical protein; CLO_0503 0.0 Click
5574359..574520 conserved domain protein; CLO_0504 0.0 Click
6574651..576420 PHAGE_Staphy_StB27: exonuclease; CLO_0505; phage(gi431809689) 5e-32 Click
7576502..576768 hypothetical protein; CLO_0506 0.0 Click
8576769..577740 PHAGE_Lister_B054: gp50; CLO_0507; phage(gi157325334) 6e-37 Click
9577756..577920 hypothetical protein; CLO_0508 0.0 Click
10577910..578521 PHAGE_Strept_Dp_1: hypothetical protein; CLO_0509; phage(gi327198335) 1e-25 Click
11578543..578989 PHAGE_Lactoc_bIL286: SSB; CLO_0510; phage(gi13095758) 2e-28 Click
12579002..579253 hypothetical protein; CLO_0511 0.0 Click
13579301..579843 hypothetical protein; CLO_0512 0.0 Click
14579907..580083 hypothetical protein; CLO_0513 0.0 Click
15580118..580486 PHAGE_Natria_PhiCh1: putative plasmid partitioning protein Soj; CLO_0514; phage(gi22091150) 1e-05 Click
16580550..581140 PHAGE_Clostr_phiCP13O: hypothetical protein; CLO_0515; phage(gi422935104) 5e-30 Click
17581112..581432 phage protein; CLO_0516 0.0 Click
18581498..581668 hypothetical protein; CLO_0517 0.0 Click
19581646..581789 hypothetical protein; CLO_0518 0.0 Click
20581793..582026 conserved hypothetical protein; CLO_0519 0.0 Click
21582031..584631 PHAGE_Abalon_virus: primase; CLO_0520; phage(gi216906077) 4e-06 Click
22584950..585120 hypothetical protein; CLO_0521 0.0 Click
23585169..585345 hypothetical protein; CLO_0522 0.0 Click
24585380..585613 hypothetical protein; CLO_0523 0.0 Click
25585797..585952 hypothetical protein; CLO_0524 0.0 Click
26586062..586337 hypothetical protein; CLO_0525 0.0 Click
27586353..586583 NADPH-dependent f420 reductase; CLO_0526 0.0 Click
28586716..586868 PHAGE_Pseudo_1: hypothetical protein 201phi2-1p308; CLO_0527; phage(gi189490460) 7e-08 Click
29587172..587345 hypothetical protein; CLO_0528 0.0 Click
30587332..587766 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp73; CLO_0529; phage(gi90592709) 4e-20 Click
31587927..588418 PHAGE_Aggreg_S1249: putative terminase small subunit TerS; CLO_0530; phage(gi273809571) 2e-21 Click
32588544..589131 PHAGE_Clostr_phiCD38_2: recombinase/resolvase; CLO_0531; phage(gi333798162) 6e-47 Click
33589839..591185 PHAGE_Clostr_phi8074_B1: putative terminase large subunit; CLO_0532; phage(gi431810360) 8e-118 Click
34591185..592609 PHAGE_Clostr_phiCTP1: hypothetical protein phiCTP1_gp4; CLO_0533; phage(gi304360666) 1e-90 Click
35592656..592853 hypothetical protein; CLO_0534 0.0 Click
36592892..594517 PHAGE_Clostr_phiCTP1: putative head morphogenesis protein; CLO_0535; phage(gi304360668) 9e-34 Click
37594562..594735 hypothetical protein; CLO_0536 0.0 Click
38594792..595157 PHAGE_Bacill_BCP78: hypothetical protein; CLO_0537; phage(gi410492926) 1e-11 Click
39595157..595402 PHAGE_Flavob_11b: hypothetical protein PHG11b_19; CLO_0538; phage(gi53793595) 1e-19 Click
40595449..596063 PHAGE_Clostr_phiCTP1: putative scaffold protein; CLO_0539; phage(gi304360672) 9e-28 Click
41596088..596447 PHAGE_Clostr_phiCTP1: hypothetical protein phiCTP1_gp11; CLO_0540; phage(gi304360673) 2e-16 Click
42596466..597500 PHAGE_Clostr_phiCTP1: hypothetical phage capsid protein; CLO_0541; phage(gi304360674) 1e-81 Click
43597566..597787 hypothetical protein; CLO_0542 0.0 Click
44598081..598446 conserved hypothetical protein; CLO_0543 0.0 Click
45598451..598789 PHAGE_Clostr_phiCTP1: hypothetical protein phiCTP1_gp16; CLO_0544; phage(gi304360678) 2e-13 Click
46598794..599213 PHAGE_Clostr_phiCTP1: hypothetical protein phiCTP1_gp17; CLO_0545; phage(gi304360679) 3e-09 Click
47600148..600588 PHAGE_Clostr_phiCTP1: hypothetical protein phiCTP1_gp20; CLO_0548; phage(gi304360682) 2e-24 Click
48600758..601099 PHAGE_Clostr_phiSM101: hypothetical protein; CLO_0549; phage(gi110804065) 2e-07 Click
49601144..603342 PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; CLO_0550; phage(gi110804068) 6e-110 Click

Region 2, total : 27 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1916242..916254 attL    AGTGATTATAGAA 0.0 Click
2916553..917209 PHAGE_Clostr_phiCD38_2: integrase; CLO_0878; phage(gi333798160) 2e-35 Click
3917595..918296 PHAGE_Clostr_phiCD38_2: recombinase/resolvase; CLO_0879; phage(gi333798162) 5e-09 Click
4918369..918962 PHAGE_Clostr_phiCD38_2: terminase small subunit; CLO_0880; phage(gi333798108) 4e-33 Click
5918955..920208 PHAGE_Clostr_O: large terminase; CLO_0881; phage(gi208429857) 9e-99 Click
6920363..921781 PHAGE_Clostr_phiCD38_2: minor capsid protein; CLO_0882; phage(gi333798110) 1e-149 Click
7921781..922989 PHAGE_Clostr_phiCD38_2: minor capsid protein; CLO_0883; phage(gi333798111) 1e-110 Click
8923128..923493 PHAGE_Bacill_BCP78: hypothetical protein; CLO_0884; phage(gi410492926) 5e-12 Click
9923607..924197 PHAGE_Clostr_phiCD38_2: scaffolding protein; CLO_0885; phage(gi333798113) 4e-31 Click
10924213..925277 PHAGE_Clostr_phiCD38_2: phage coat protein; CLO_0886; phage(gi333798114) 1e-111 Click
11925279..925638 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_0887; phage(gi333798115) 1e-12 Click
12925638..926054 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_0888; phage(gi333798116) 3e-26 Click
13926054..926386 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_0889; phage(gi333798117) 3e-21 Click
14926383..926811 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_0890; phage(gi333798118) 3e-29 Click
15926825..927334 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_0891; phage(gi333798119) 8e-42 Click
16927355..927747 hypothetical protein; CLO_0892 0.0 Click
17927747..928364 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_0893; phage(gi333798121) 2e-53 Click
18928424..928909 hypothetical protein; CLO_0894 0.0 Click
19928944..929096 PHAGE_Escher_D108: Com; CLO_0895; phage(gi281199699) 1e-05 Click
20929175..933320 PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; CLO_0896; phage(gi110804068) 1e-103 Click
21933334..934017 PHAGE_Clostr_phiCD38_2: tail component protein; CLO_0897; phage(gi333798124) 4e-20 Click
22934018..935772 PHAGE_Clostr_O: endopeptidase-endolysin; CLO_0898; phage(gi208429880) 5e-24 Click
23935791..938703 PHAGE_Clostr_PhiS63: gp17; CLO_0899; phage(gi388570646) 3e-32 Click
24938721..939065 phage protein, putative; CLO_0900 0.0 Click
25939095..939340 conserved hypothetical protein; CLO_0901 0.0 Click
26939614..940027 PHAGE_Clostr_phiCTP1: predicted holin; CLO_0902; phage(gi304360690) 1e-35 Click
27940079..940864 PHAGE_Pseudo_PAJU2: putative endolysin; CLO_0903; phage(gi209552446) 4e-18 Click
28941810..942088 PHAGE_Bacill_IEBH: prophage repressor; CLO_0904; phage(gi197261591) 2e-10 Click
29942765..942777 attR    AGTGATTATAGAA 0.0 Click

Region 3, total : 109 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11363608..1363619 attL    TTTAGCTATTAA 0.0 Click
21364665..1365681 PHAGE_Staphy_vB_SepiS_phiIPLA5: integrase; CLO_1333; phage(gi399528924) 1e-11 Click
31365701..1365937 hypothetical protein; CLO_1334 0.0 Click
41366628..1367023 ribonuclease H; CLO_1335 0.0 Click
51367039..1367050 attL    TATTAATTATAA 0.0 Click
61367056..1367067 attL    TTATTTTAATAA 0.0 Click
71367184..1368095 PHAGE_Burkho_BcepMigl: GIY-YIG domain-containing protein; CLO_1336; phage(gi431809901) 1e-07 Click
81368307..1368510 conserved hypothetical protein; CLO_1337 0.0 Click
91369155..1369364 conserved hypothetical protein; CLO_1338 0.0 Click
101369369..1369959 PHAGE_Clanis_virus: LEF-3; CLO_1339; phage(gi113195466) 3e-05 Click
111369982..1370170 hypothetical protein; CLO_1340 0.0 Click
121370403..1371581 PHAGE_Glossi_virus: hypothetical protein SGHV062; CLO_1341; phage(gi168804078) 3e-05 Click
13complement(1371626..1371835) PHAGE_Clostr_st: putative transcriptional regulator; CLO_1342; phage(gi80159825) 3e-21 Click
141372046..1372330 hypothetical protein; CLO_1343 0.0 Click
151372342..1372605 hypothetical protein; CLO_1344 0.0 Click
161373019..1373420 hypothetical protein; CLO_1345 0.0 Click
171373463..1373828 hypothetical protein; CLO_1346 0.0 Click
181373914..1374402 hypothetical protein; CLO_1347 0.0 Click
191374428..1375327 conserved hypothetical protein; CLO_1348 0.0 Click
201375595..1378603 PHAGE_Megavi_lba: putative hydrolase; CLO_1349; phage(gi448825666) 4e-08 Click
211379073..1379861 PHAGE_Helico_1961P: JHP1044-like mosaic region protein; CLO_1350; phage(gi422935773) 6e-05 Click
221380057..1380683 GIY-YIG domain protein; CLO_1351 0.0 Click
231380686..1380931 hypothetical protein; CLO_1352 0.0 Click
241380928..1381110 hypothetical protein; CLO_1353 0.0 Click
251381100..1381474 PHAGE_Lister_A500: gp58; CLO_1354; phage(gi157325017) 2e-09 Click
261381487..1381654 hypothetical protein; CLO_1355 0.0 Click
271381705..1382208 hypothetical protein; CLO_1356 0.0 Click
281382279..1382482 hypothetical protein; CLO_1357 0.0 Click
291382482..1382955 PHAGE_Clostr_phi3626: Gp50 protein; CLO_1358; phage(gi20066012) 8e-05 Click
301383305..1383766 PHAGE_Clostr_phi3626: putative terminase small subunit; CLO_1359; phage(gi20065964) 3e-11 Click
311383763..1385445 PHAGE_Lactob_c5: putative terminase large subunit; CLO_1360; phage(gi418488157) 5e-91 Click
321385498..1386757 PHAGE_Clostr_phi3626: putative portal protein; CLO_1361; phage(gi20065966) 3e-15 Click
331386952..1387545 PHAGE_Clostr_phi3626: putative prohead protease; CLO_1362; phage(gi20065968) 7e-11 Click
341387567..1388799 PHAGE_Lactob_c5: putative major head protein; CLO_1363; phage(gi418488201) 4e-23 Click
351388854..1388865 attL    TATAAAAATGAA 0.0 Click
361388861..1389136 PHAGE_Lactob_c5: hypothetical protein; CLO_1364; phage(gi418488160) 5e-08 Click
371389147..1389488 PHAGE_Lactob_c5: putative head-tail adaptor; CLO_1365; phage(gi418488161) 6e-07 Click
381389488..1389895 hypothetical protein; CLO_1366 0.0 Click
391389900..1390226 PHAGE_Clostr_phiCD6356: hypothetical protein; CLO_1367; phage(gi326536857) 1e-05 Click
401390301..1390900 PHAGE_Geobac_GBSV1: major tail protein; CLO_1368; phage(gi115334636) 8e-05 Click
411390981..1391313 hypothetical protein; CLO_1369 0.0 Click
421391550..1395653 PHAGE_Clostr_phiSM101: phage tail tape measure protein, TP901 family, core region domain protein; CLO_1370; phage(gi110804068) 1e-52 Click
431395658..1396368 PHAGE_Clostr_phi3626: Gp14 protein; CLO_1371; phage(gi20065977) 3e-22 Click
441396443..1398185 PHAGE_Clostr_phi3626: Gp15 protein; CLO_1372; phage(gi20065978) 2e-54 Click
451398517..1399077 conserved hypothetical protein; CLO_1373 0.0 Click
461399150..1401348 PHAGE_Staphy_S24_1: structure protein putative minor tail protein; CLO_1374; phage(gi371671333) 2e-06 Click
471401362..1401700 PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p040; CLO_1375; phage(gi9630165) 2e-05 Click
481401787..1401981 conserved hypothetical protein; CLO_1376 0.0 Click
491402164..1402310 hypothetical protein; CLO_1377 0.0 Click
50complement(1402324..1402974) conserved hypothetical protein; CLO_1378 0.0 Click
511403256..1403480 conserved hypothetical protein; CLO_1379 0.0 Click
521403504..1403920 PHAGE_Clostr_st: hypothetical protein CST144; CLO_1380; phage(gi80159830) 6e-27 Click
531404101..1404868 PHAGE_Clostr_phi8074_B1: endolysin CS74L; CLO_1381; phage(gi431810380) 9e-40 Click
541404861..1405031 conserved domain protein; CLO_1382 0.0 Click
551405043..1405228 conserved domain protein; CLO_1383 0.0 Click
56complement(1405852..1406199) conserved hypothetical protein; CLO_1384 0.0 Click
571406769..1406945 hypothetical protein; CLO_1385 0.0 Click
581407133..1407768 conserved hypothetical protein; CLO_1386 0.0 Click
591407869..1408417 conserved hypothetical protein; CLO_1387 0.0 Click
60complement(1408463..1408933) hypothetical protein; CLO_1388 0.0 Click
61complement(1409311..1409853) hypothetical protein; CLO_1389 0.0 Click
621410136..1410558 hypothetical protein; CLO_1390 0.0 Click
631410667..1412238 alpha-amylase; CLO_1391 0.0 Click
641412439..1413071 stage II sporulation protein M; CLO_1392 0.0 Click
651413192..1414070 PHAGE_Thermu_45: XerD-like integrase; CLO_1393; phage(gi157265299) 8e-14 Click
661414095..1414106 attR    TATAAAAATGAA 0.0 Click
67complement(1414189..1415331) PHAGE_Clostr_phiC2: putative integrase; CLO_1394; phage(gi134287379) 5e-107 Click
68complement(1415435..1415932) PHAGE_Clostr_phi3626: Gp23 protein; CLO_1395; phage(gi20065986) 4e-09 Click
691416204..1417103 hypothetical protein; CLO_1396 0.0 Click
701417123..1417668 hypothetical protein; CLO_1397 0.0 Click
71complement(1417688..1418515) conserved hypothetical protein; CLO_1398 0.0 Click
72complement(1418658..1420208) PHAGE_Strept_1: hypothetical protein EJ-1p03; CLO_1399; phage(gi39653677) 1e-51 Click
73complement(1420314..1420655) PHAGE_Clostr_CD119: RepR; putative repressor; CLO_1400; phage(gi90592681) 9e-11 Click
74complement(1420790..1421137) PHAGE_Staphy_vB_SepiS_phiIPLA7: repressor; CLO_1401; phage(gi399529150) 4e-14 Click
751421290..1421487 conserved domain protein; CLO_1402 0.0 Click
761421612..1422046 putative prophage LambdaCh01, transcriptional regulator; CLO_1403 0.0 Click
771422058..1422273 PHAGE_Clostr_phiC2: hypothetical protein phiC2p59; CLO_1404; phage(gi134287391) 3e-05 Click
781422291..1422434 hypothetical protein; CLO_1405 0.0 Click
791422526..1423281 PHAGE_Lactob_LF1: chromosome partitioning ATPase; CLO_1406; phage(gi418489414) 4e-21 Click
801423266..1424417 PHAGE_Staphy_EW: ORF013; CLO_1407; phage(gi66395820) 7e-18 Click
811424469..1424480 attR    TTATTTTAATAA 0.0 Click
821424532..1425347 PHAGE_Lactob_c5: putative DNA replication protein; CLO_1408; phage(gi418488187) 3e-23 Click
831425349..1426665 PHAGE_Strept_1: putative DNA polymerase III delta prime subunit; CLO_1409; phage(gi28876155) 8e-83 Click
841426670..1426837 hypothetical protein; CLO_1410 0.0 Click
851426830..1426985 hypothetical protein; CLO_1411 0.0 Click
861427091..1427381 hypothetical protein; CLO_1412 0.0 Click
871427428..1427985 hypothetical protein; CLO_1413 0.0 Click
881428157..1428498 hypothetical protein; CLO_1414 0.0 Click
891428724..1429077 conserved hypothetical protein; CLO_1415 0.0 Click
901429151..1429318 conserved domain protein; CLO_1416 0.0 Click
911429318..1429971 PHAGE_Clostr_phiCD38_2: integrase; CLO_1417; phage(gi333798160) 6e-36 Click
921430243..1430737 PHAGE_Strept_SMP: hypothetical protein; CLO_1418; phage(gi119953776) 6e-12 Click
931430737..1431153 PHAGE_Clostr_phi3626: Gp50 protein; CLO_1419; phage(gi20066012) 5e-13 Click
941431268..1431750 PHAGE_Staphy_phiPV83: phi PVL ORF 1 homologue; CLO_1420; phage(gi9635714) 5e-14 Click
951431750..1433531 PHAGE_Clostr_phi3626: putative terminase large subunit; CLO_1421; phage(gi20065965) 7e-112 Click
961433546..1434811 PHAGE_Bacill_WBeta: putative phage portal protein; CLO_1422; phage(gi85701382) 3e-78 Click
971434804..1435565 PHAGE_Clostr_phiMMP04: ATP-dependent Clp protease; CLO_1423; phage(gi414090445) 1e-61 Click
981435604..1436779 PHAGE_Bacill_WBeta: putative major capsid protein; CLO_1424; phage(gi85701384) 1e-41 Click
991436820..1437068 PHAGE_Clostr_phi3626: Gp7 protein; CLO_1425; phage(gi20065970) 2e-06 Click
1001437065..1437385 PHAGE_Clostr_phi3626: Gp8 protein; CLO_1426; phage(gi20065971) 1e-24 Click
1011437394..1437837 PHAGE_Clostr_phi3626: Gp9 protein; CLO_1427; phage(gi20065972) 7e-24 Click
1021437842..1438177 PHAGE_Clostr_phi3626: Gp10 protein; CLO_1428; phage(gi20065973) 2e-15 Click
1031438214..1438813 PHAGE_Clostr_phi3626: major tail protein; CLO_1429; phage(gi20065974) 9e-44 Click
1041438861..1439175 PHAGE_Clostr_phi3626: Gp12 protein; CLO_1430; phage(gi20065975) 6e-15 Click
1051439250..1439681 conserved hypothetical protein; CLO_1431 0.0 Click
1061439753..1443013 PHAGE_Clostr_phi3626: putative tape-measure protein; CLO_1432; phage(gi20065976) 3e-110 Click
1071443018..1443734 PHAGE_Clostr_phiCD38_2: tail component protein; CLO_1433; phage(gi333798124) 2e-27 Click
1081443731..1445416 PHAGE_Lister_2389: Gp14 protein; CLO_1434; phage(gi17488517) 8e-62 Click
1091445427..1446914 PHAGE_Staphy_S24_1: structure protein putative minor tail protein; CLO_1435; phage(gi371671333) 2e-07 Click
1101446927..1447265 hypothetical protein; CLO_1436 0.0 Click
1111447268..1447495 hypothetical protein; CLO_1437 0.0 Click
1121447993..1449015 PHAGE_Cronob_phiES15: putative major tail protein; CLO_1438; phage(gi401817602) 7e-09 Click
1131449088..1449288 bacteriocin UviB; CLO_1439 0.0 Click
1141449301..1449474 putative membrane protein; CLO_1440 0.0 Click
1151449531..1450313 PHAGE_Pseudo_PAJU2: putative endolysin; CLO_1441; phage(gi209552446) 3e-19 Click
1161452145..1452156 attR    TATTAATTATAA 0.0 Click
1171457504..1457515 attR    TTTAGCTATTAA 0.0 Click

Region 4, total : 63 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11547181..1548179 PHAGE_Clostr_phiMMP04: cell wall hydrolase; CLO_1522; phage(gi414090458) 5e-17 Click
21548094..1548163 attL    ATGCTCCGCATACAGGAGATGTTGTAAAAATTTCTACACTTTCAACTTCAAACATGAAGTATGCTGGAAG 0.0 Click
31548276..1549217 PHAGE_Achole_L2: integrase; CLO_1523; phage(gi9626516) 1e-17 Click
4complement(1549257..1549547) PHAGE_Geobac_GBSV1: immunity repressor protein; CLO_1524; phage(gi115334658) 1e-09 Click
5complement(1549683..1549823) hypothetical protein; CLO_1525 0.0 Click
6complement(1550468..1550824) putative DNA-binding protein; CLO_1526 0.0 Click
71551118..1551321 PHAGE_Clostr_PhiS63: gp25; CLO_1527; phage(gi388570654) 6e-06 Click
81551482..1551667 hypothetical protein; CLO_1528 0.0 Click
9complement(1551712..1551915) hypothetical protein; CLO_1529 0.0 Click
101551994..1552758 PHAGE_Cronob_ENT39118: phage antirepressor protein; CLO_1530; phage(gi431811054) 5e-08 Click
111552761..1552913 hypothetical protein; CLO_1531 0.0 Click
121553041..1553406 hypothetical protein; CLO_1532 0.0 Click
131553420..1553710 PHAGE_Bacill_phBC6A51: Transcription state regulatory protein abrB; CLO_1533; phage(gi31415778) 1e-11 Click
14complement(1553846..1554868) PROPHAGE_Mesorh_MAFF303099: transposase; CLO_1534; phage(gi13475314) 3e-16 Click
151554991..1555173 PHAGE_Clostr_PhiS63: gp28; CLO_1535; phage(gi388570672) 4e-05 Click
161555173..1555340 conserved hypothetical protein; CLO_1536 0.0 Click
171555355..1555702 hypothetical protein; CLO_1537 0.0 Click
181555699..1556007 hypothetical protein; CLO_1538 0.0 Click
191556011..1556523 PHAGE_Lactob_Sha1: phage protein; CLO_1539; phage(gi418489843) 9e-24 Click
201556538..1556774 hypothetical protein; CLO_1540 0.0 Click
211556774..1557409 PHAGE_Entero_HK629: hypothetical protein; CLO_1541; phage(gi428782051) 3e-35 Click
221557410..1557670 conserved domain protein; CLO_1542 0.0 Click
231557671..1557985 hypothetical protein; CLO_1543 0.0 Click
241557988..1558320 hypothetical protein; CLO_1544 0.0 Click
251558323..1558895 hypothetical protein; CLO_1545 0.0 Click
261558908..1559066 hypothetical protein; CLO_1546 0.0 Click
271559147..1559725 PHAGE_Clostr_phiCP13O: hypothetical protein; CLO_1547; phage(gi422935104) 1e-41 Click
281559718..1560143 hypothetical protein; CLO_1548 0.0 Click
291560136..1560411 phage protein; CLO_1549 0.0 Click
301560411..1560905 PHAGE_Thermo_THSA_485A: hypothetical protein; CLO_1550; phage(gi397912643) 2e-09 Click
311560886..1561023 hypothetical protein; CLO_1551 0.0 Click
321561029..1561274 hypothetical protein; CLO_1552 0.0 Click
331561290..1563929 PHAGE_Mycoba_Bxz2: gp58; CLO_1553; phage(gi29566077) 9e-05 Click
341564115..1564948 PHAGE_Mycoba_Llij: gp66; CLO_1554; phage(gi109392252) 1e-14 Click
351565023..1565454 PHAGE_Staphy_vB_SepiS_phiIPLA5: YopX family protein; CLO_1555; phage(gi399528952) 5e-16 Click
361565454..1565918 hypothetical protein; CLO_1556 0.0 Click
371565922..1566155 hypothetical protein; CLO_1557 0.0 Click
381566596..1566766 hypothetical protein; CLO_1558 0.0 Click
391566756..1567205 PHAGE_Clostr_phiC2: hypothetical protein phiC2p80; CLO_1559; phage(gi134287412) 1e-24 Click
401567438..1567833 PHAGE_Clostr_phiCP34O: hypothetical protein; CLO_1560; phage(gi422935425) 1e-15 Click
411568175..1569425 PHAGE_Clostr_phi8074_B1: putative terminase large subunit; CLO_1561; phage(gi431810360) 2e-113 Click
421569441..1570850 PHAGE_Staphy_SpaA1: phage portal protein, SPP1; CLO_1562; phage(gi399498867) 5e-22 Click
431570840..1571577 PHAGE_Clostr_CD119: putative head protein; CLO_1563; phage(gi90592642) 4e-13 Click
441571598..1571957 PHAGE_Bacill_BCP78: hypothetical protein; CLO_1564; phage(gi410492926) 5e-13 Click
451571957..1572139 PHAGE_Bacill_SPO1: gp34.82; CLO_1565; phage(gi209973026) 9e-05 Click
461572237..1572833 PHAGE_Staphy_96: ORF019; CLO_1566; phage(gi66395904) 6e-13 Click
471572867..1573802 PHAGE_Clostr_CD119: putative capsid protein; CLO_1567; phage(gi90592716) 3e-92 Click
481573816..1574097 hypothetical protein; CLO_1568 0.0 Click
491574107..1574430 hypothetical protein; CLO_1569 0.0 Click
501574439..1574786 PHAGE_Strept_PH15: putative minor capsid protein; CLO_1570; phage(gi190151457) 1e-06 Click
511574783..1575205 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_1571; phage(gi333798118) 1e-25 Click
521575211..1575708 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_1572; phage(gi333798119) 3e-19 Click
531575728..1576051 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_1573; phage(gi333798120) 1e-13 Click
541576051..1576623 PHAGE_Clostr_phiCD38_2: hypothetical protein; CLO_1574; phage(gi333798121) 2e-44 Click
551576691..1576927 conserved hypothetical protein; CLO_1575 0.0 Click
561576985..1577119 conserved domain protein; CLO_1576 0.0 Click
571577190..1580762 PHAGE_Strept_3: putative human platelet-binding protein; CLO_1577; phage(gi28876274) 3e-66 Click
581580773..1581453 PHAGE_Clostr_PhiS63: gp14; CLO_1578; phage(gi388570643) 4e-12 Click
591581454..1583202 PHAGE_Clostr_PhiS63: gp15; CLO_1579; phage(gi388570644) 4e-19 Click
601583221..1586187 PHAGE_Clostr_PhiS63: gp17; CLO_1580; phage(gi388570646) 5e-19 Click
611586205..1586585 conserved hypothetical protein; CLO_1581 0.0 Click
621586585..1586746 PHAGE_Bacill_phi105: hypothetical protein phi105_24; CLO_1582; phage(gi22855017) 7e-05 Click
631586845..1587264 PHAGE_Clostr_phiCTP1: predicted holin; CLO_1583; phage(gi304360690) 2e-38 Click
641587302..1588093 PHAGE_Strept_1: lysozyme; CLO_1584; phage(gi9629549) 6e-20 Click
651589321..1589390 attR    ATGCTCCGCATACAGGAGATGTTGTAAAAATTTCTACACTTTCAACTTCAAACATGAAGTATGCTGGAAG 0.0 Click

Region 5, total : 94 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11800932..1800943 attL    TTTTAAATATTA 0.0 Click
21803217..1806477 PHAGE_Rachip_MNPV: global transactivator; CLO_1783; phage(gi23577840) 2e-47 Click
31806747..1807445 MgtC/SapB transporter; CLO_1784 0.0 Click
41807609..1808088 PHAGE_Strept_PH10: lysA; CLO_1785; phage(gi238821368) 1e-13 Click
51808276..1809004 PHAGE_Parame_1: hypothetical protein; CLO_1786; phage(gi9631618) 3e-26 Click
61809150..1809413 MgtC/SapB transporter; CLO_1787 0.0 Click
7complement(1809523..1810677) PHAGE_Clostr_phiC2: putative integrase; CLO_1788; phage(gi134287379) 4e-59 Click
8complement(1810674..1810916) PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; CLO_1789; phage(gi397912660) 1e-06 Click
91810947..1810958 attL    TAAATATAATAT 0.0 Click
101811253..1811399 hypothetical protein; CLO_1790 0.0 Click
11complement(1811407..1811790) PHAGE_Staphy_42E: ORF018; CLO_1791; phage(gi66395526) 3e-07 Click
121811909..1812136 PHAGE_Clostr_phiCD27: putative phage repressor; CLO_1792; phage(gi209901282) 9e-08 Click
131812286..1812495 PHAGE_Clostr_phiC2: hypothetical protein phiC2p59; CLO_1793; phage(gi134287391) 3e-07 Click
141812626..1812787 conserved hypothetical protein; CLO_1794 0.0 Click
151812797..1812985 hypothetical protein; CLO_1795 0.0 Click
161812948..1813091 hypothetical protein; CLO_1796 0.0 Click
171813107..1813364 conserved hypothetical protein; CLO_1797 0.0 Click
181813382..1813540 hypothetical protein; CLO_1798 0.0 Click
191813638..1815605 PHAGE_Lister_B054: gp49; CLO_1799; phage(gi157325333) 2e-105 Click
201815605..1816486 PHAGE_Brocho_NF5: gp35; CLO_1800; phage(gi327197620) 4e-56 Click
211816486..1817199 PHAGE_Lister_B054: gp51; CLO_1801; phage(gi157325335) 1e-46 Click
221817318..1818208 PHAGE_Strept_TP_J34: putative primosome component; CLO_1802; phage(gi444475884) 2e-25 Click
231818189..1818467 conserved domain protein; CLO_1803 0.0 Click
241818464..1818772 conserved hypothetical protein; CLO_1804 0.0 Click
251818781..1819551 hypothetical protein; CLO_1805 0.0 Click
261819564..1819797 PHAGE_Bacill_phBC6A51: hypothetical protein BC1874; CLO_1806; phage(gi31415768) 2e-18 Click
271819801..1820415 PHAGE_Bacill_phBC6A51: hypothetical protein BC1875; CLO_1807; phage(gi31415769) 7e-49 Click
281820523..1820816 PHAGE_Clostr_PhiS63: gp30; CLO_1808; phage(gi388570657) 4e-15 Click
291820809..1821222 PHAGE_Clostr_phi3626: putative single stranded DNA binding protein; CLO_1809; phage(gi20066002) 4e-33 Click
301821333..1821596 hypothetical protein; CLO_1810 0.0 Click
311821565..1821699 hypothetical protein; CLO_1811 0.0 Click
321821722..1821955 hypothetical protein; CLO_1812 0.0 Click
331821952..1822545 PHAGE_Salmon_SPN1S: hypothetical protein; CLO_1813; phage(gi374531240) 3e-25 Click
341822538..1822879 conserved hypothetical protein; CLO_1814 0.0 Click
351822889..1823311 hypothetical protein; CLO_1815 0.0 Click
361823354..1824136 PHAGE_Prochl_P_SSM7: DNA adenine methylase; CLO_1816; phage(gi326784623) 6e-70 Click
371824201..1824893 PHAGE_Bacill_SP10: hypothetical protein; CLO_1817; phage(gi418489566) 4e-12 Click
381825084..1825491 hypothetical protein; CLO_1818 0.0 Click
391825591..1826598 PHAGE_Thermu_26: phage XerD-like integrase; CLO_1819; phage(gi157265417) 6e-15 Click
401826621..1827661 PHAGE_Clostr_phiMMP02: hypothetical protein; CLO_1820; phage(gi414090433) 3e-42 Click
411827751..1828464 PHAGE_Clostr_phiCD27: putative antirepressor; CLO_1821; phage(gi209901306) 5e-31 Click
421828478..1829002 hypothetical protein; CLO_1822 0.0 Click
431829078..1829422 PHAGE_Clostr_phiSM101: hypothetical protein; CLO_1823; phage(gi110804067) 4e-25 Click
441829433..1829636 hypothetical protein; CLO_1824 0.0 Click
451829652..1830173 PHAGE_Clostr_phi3626: Gp43 protein; CLO_1825; phage(gi20066006) 3e-13 Click
461830257..1830562 hypothetical protein; CLO_1826 0.0 Click
471830656..1831564 hypothetical protein; CLO_1827 0.0 Click
481831844..1832404 conserved hypothetical protein; CLO_1828 0.0 Click
491832404..1833579 PHAGE_Cellul_phiST: hypothetical protein; CLO_1829; phage(gi472339904) 3e-06 Click
501833645..1833812 hypothetical protein; CLO_1830 0.0 Click
511833818..1833973 hypothetical protein; CLO_1831 0.0 Click
521833975..1834154 hypothetical protein; CLO_1832 0.0 Click
531834196..1835176 PHAGE_Deep_s_D6E: small subunit terminase; CLO_1833; phage(gi423262328) 5e-60 Click
541835169..1836527 PHAGE_Deep_s_D6E: large subunit terminase; CLO_1834; phage(gi423262329) 3e-165 Click
551836527..1838029 PHAGE_Strept_Dp_1: portal protein; CLO_1835; phage(gi327198352) 5e-57 Click
561838032..1839042 PHAGE_Clostr_phiCD27: putative head morphogenesis protein; CLO_1836; phage(gi209901241) 7e-22 Click
571839264..1839935 PHAGE_Acinet_AP22: putative DNA-binding protein; CLO_1837; phage(gi388570841) 6e-07 Click
581840045..1840365 PHAGE_Clostr_phiSM101: hypothetical protein; CLO_1838; phage(gi110804065) 3e-05 Click
591840344..1840688 PHAGE_Clostr_phi8074_B1: hypothetical protein; CLO_1839; phage(gi431810434) 4e-10 Click
601840922..1841332 hypothetical protein; CLO_1840 0.0 Click
611841461..1842087 PHAGE_Bacill_SPP1: hypothetical protein SPP1p020; CLO_1841; phage(gi22855064) 1e-20 Click
621842106..1842492 PHAGE_Clostr_phiCTP1: hypothetical protein phiCTP1_gp11; CLO_1842; phage(gi304360673) 6e-09 Click
631842507..1843562 PHAGE_Clostr_phiCTP1: hypothetical phage capsid protein; CLO_1843; phage(gi304360674) 1e-84 Click
641843621..1843830 conserved hypothetical protein; CLO_1844 0.0 Click
651843833..1844153 PHAGE_Clostr_phiCTP1: hypothetical protein phiCTP1_gp14; CLO_1845; phage(gi304360676) 3e-15 Click
661844153..1844539 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp09; CLO_1846; phage(gi209901246) 2e-13 Click
671844551..1844976 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp10; CLO_1847; phage(gi209901247) 3e-18 Click
681844979..1845806 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp11; CLO_1848; phage(gi209901248) 2e-69 Click
691845812..1846012 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp12; CLO_1849; phage(gi209901249) 2e-09 Click
701846013..1847422 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp13; CLO_1850; phage(gi209901250) 6e-132 Click
711847439..1847861 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp14; CLO_1851; phage(gi209901251) 3e-22 Click
721847922..1848365 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp15; CLO_1852; phage(gi209901252) 7e-22 Click
731848404..1848526 conserved hypothetical protein; CLO_1853 0.0 Click
741848574..1851633 PHAGE_Clostr_phiCD27: putative phage tail tape measure protein; CLO_1854; phage(gi209901253) 5e-78 Click
751851672..1852493 TPR-repeat-containing protein, secreted; CLO_1855 0.0 Click
761852629..1853318 PHAGE_Clostr_phiCD27: putative peptidoglycan-binding LysM; CLO_1856; phage(gi209901255) 1e-39 Click
771853326..1854345 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp19; CLO_1857; phage(gi209901256) 3e-79 Click
781854335..1854676 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp20; CLO_1858; phage(gi209901257) 5e-14 Click
791854669..1855109 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp21; CLO_1859; phage(gi209901258) 1e-26 Click
801855115..1856236 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp22; CLO_1860; phage(gi209901259) 2e-105 Click
811856223..1856873 PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp23; CLO_1861; phage(gi209901260) 2e-29 Click
821856879..1858060 PHAGE_Clostr_phiMMP04: tail fiber; CLO_1862; phage(gi414090463) 9e-46 Click
831858084..1858356 conserved hypothetical protein; CLO_1863 0.0 Click
841858391..1858543 conserved hypothetical protein; CLO_1864 0.0 Click
851858778..1859812 PHAGE_Staphy_SA11: tail protein; CLO_1865; phage(gi422935653) 7e-09 Click
861859893..1860093 bacteriocin UviB; CLO_1866 0.0 Click
871860103..1860342 PHAGE_Clostr_O: holin; CLO_1867; phage(gi208429883) 2e-12 Click
881860398..1861183 PHAGE_Pseudo_PAJU2: putative endolysin; CLO_1868; phage(gi209552446) 2e-20 Click
891861379..1862044 hypothetical protein; CLO_1869 0.0 Click
901862050..1863210 PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; CLO_1870; phage(gi209901309) 4e-45 Click
911863432..1863641 PHAGE_Clostr_phiCD6356: hypothetical protein; CLO_1871; phage(gi326536876) 7e-10 Click
921863751..1864098 PHAGE_Entero_2: DNA-invertase; CLO_1872; phage(gi169936026) 3e-05 Click
931864219..1864932 PHAGE_Strept_MM1: N-acetylmuramoyl-L-alanine amidase; CLO_1873; phage(gi15088793) 2e-12 Click
941865139..1866221 PHAGE_Clostr_st: metallo beta-lactamase family protein; CLO_1874; phage(gi80159792) 1e-89 Click
951866739..1866939 conserved domain protein; CLO_1875 0.0 Click
961867061..1867948 PHAGE_Clostr_phiSM101: putative ATPase; CLO_1876; phage(gi110804060) 2e-29 Click
971875727..1875738 attR    TAAATATAATAT 0.0 Click
981876463..1876474 attR    TTTTAAATATTA 0.0 Click

Region 6, total : 25 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2536747..2538834) PHAGE_Acanth_mimivirus: DNA topoisomerase 1; CLO_2508; phage(gi311977597) 9e-111 Click
2complement(2538885..2539943) DNA protecting protein DprA; CLO_2509 0.0 Click
3complement(2539964..2540857) PROPHAGE_Escher_Sakai: putative ATP-dependent protease; CLO_2510; phage(gi15833954) 7e-42 Click
42540871..2540883 attL    TTTTTATTAAAAT 0.0 Click
5complement(2540927..2542573) PHAGE_Clostr_PhiS63: gp24; CLO_2511; phage(gi388570653) 3e-20 Click
6complement(2542727..2544556) PHAGE_Clostr_PhiS63: gp15; CLO_2512; phage(gi388570644) 6e-74 Click
7complement(2544625..2545362) PHAGE_Clostr_PhiS63: gp14; CLO_2513; phage(gi388570643) 1e-24 Click
8complement(2545355..2548327) PHAGE_Clostr_PhiS63: gp13; CLO_2514; phage(gi388570642) 3e-167 Click
9complement(2548399..2548827) conserved hypothetical protein; CLO_2515 0.0 Click
10complement(2548914..2549228) PHAGE_Clostr_PhiS63: gp12; CLO_2516; phage(gi388570641) 3e-24 Click
11complement(2549280..2549882) PHAGE_Clostr_PhiS63: gp11; CLO_2517; phage(gi388570640) 8e-31 Click
12complement(2549931..2550266) PHAGE_Clostr_PhiS63: gp10; CLO_2518; phage(gi388570639) 2e-19 Click
13complement(2550272..2550715) PHAGE_Clostr_PhiS63: gp9; CLO_2519; phage(gi388570638) 5e-25 Click
14complement(2550725..2551042) PHAGE_Clostr_PhiS63: gp8; CLO_2520; phage(gi388570637) 5e-24 Click
15complement(2551035..2551325) PHAGE_Clostr_PhiS63: gp7; CLO_2521; phage(gi388570636) 7e-11 Click
16complement(2551384..2552472) PHAGE_Clostr_PhiS63: gp6; CLO_2522; phage(gi388570635) 5e-85 Click
17complement(2552525..2553121) PHAGE_Clostr_phi3626: putative prohead protease; CLO_2523; phage(gi20065968) 5e-33 Click
18complement(2553114..2554337) PHAGE_Clostr_PhiS63: gp4; CLO_2524; phage(gi388570634) 8e-82 Click
19complement(2554349..2554555) hypothetical protein; CLO_2525 0.0 Click
20complement(2554575..2556245) PHAGE_Clostr_PhiS63: gp2; CLO_2526; phage(gi388570632) 0.0 Click
21complement(2556242..2556613) PHAGE_Clostr_PhiS63: gp1; CLO_2527; phage(gi388570631) 2e-23 Click
22complement(2557079..2557264) PHAGE_Clostr_PhiS63: gp43; CLO_2528; phage(gi388570669) 3e-16 Click
23complement(2557359..2557871) YfbU domain superfamily; CLO_2529 0.0 Click
24complement(2558025..2558228) conserved hypothetical protein; CLO_2530 0.0 Click
25complement(2558280..2558531) hypothetical protein; CLO_2531 0.0 Click
26complement(2558622..2560238) PHAGE_Tsukam_TPA2: helicase; CLO_2532; phage(gi326425076) 9e-39 Click
272571620..2571632 attR    TTTTTATTAAAAT 0.0 Click