Enterococcus faecalis TUSoD Ef11 , whole [asmbl_id: NC_000000].2836650, GC%: 37.68%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 19 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(50528..51625) PHAGE_Entero_1: amidase; HMPREF0347_5091; phage(gi225626379) 3e-38 Click
2complement(51771..52166) PHAGE_Entero_EF62phi: holin; HMPREF0347_5092; phage(gi384519787) 5e-38 Click
3complement(52190..53959) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_5093; phage(gi282598748) 0.0 Click
4complement(53992..55449) PHAGE_Entero_phiEf11: putative phage structural protein; HMPREF0347_5094; phage(gi282598760) 3e-172 Click
5complement(55462..56388) PHAGE_Entero_phiEf11: putative phage tail protein; HMPREF0347_5095; phage(gi282598752) 6e-147 Click
6complement(56390..59323) PHAGE_Strept_Dp_1: TMP; HMPREF0347_5096; phage(gi327198366) 1e-122 Click
7complement(59313..59681) PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_45; HMPREF0347_5097; phage(gi13487846) 5e-11 Click
8complement(59699..60058) PHAGE_Strept_858: orf17; HMPREF0347_5098; phage(gi168229290) 3e-12 Click
9complement(60091..60603) PHAGE_Strept_TP_J34: putative major tail protein; HMPREF0347_5099; phage(gi444475914) 1e-38 Click
10complement(60616..61008) PHAGE_Entero_phiEf11: putative major structural protein; HMPREF0347_5100; phage(gi282598740) 2e-07 Click
11complement(61254..61661) PHAGE_Lactob_Sha1: phage transcriptional activator RinA; HMPREF0347_5101; phage(gi418489798) 1e-18 Click
12complement(61681..62052) conserved hypothetical protein; HMPREF0347_5102 0.0 Click
13complement(62140..62982) PHAGE_Entero_EF62phi: D replication protein DC; HMPREF0347_5103; phage(gi384519773) 2e-27 Click
14complement(63001..63771) PHAGE_Strept_M102: hypothetical protein M102_gp21; HMPREF0347_5104; phage(gi242345592) 8e-36 Click
15complement(63802..63936) conserved hypothetical protein; HMPREF0347_5105 0.0 Click
1664153..64635 PHAGE_Entero_phiEf11: cI-like repressor; HMPREF0347_5106; phage(gi282598745) 3e-20 Click
1764682..65155 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_5107; phage(gi282598746) 1e-62 Click
18complement(65528..65878) ribosome-binding factor A; HMPREF0347_5108 0.0 Click
19complement(65903..68299) PHAGE_Cafete_BV_PW1: putative eIF-2/eIF-5B; HMPREF0347_5109; phage(gi310831102) 2e-23 Click

Region 2, total : 65 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11149029..1149550 PHAGE_Ostreo_2: putative CMP/dCMP deaminase zinc-binding; HMPREF0347_6823; phage(gi314055285) 3e-05 Click
21149643..1149669 attL    ACTAAGCAAGTGCCGCCATGTGTCTGA 0.0 Click
3complement(1149744..1150880) PHAGE_Entero_phiEf11: phage integrase protein; HMPREF0347_6825; phage(gi282598730) 0.0 Click
4complement(1150947..1151519) PHAGE_Entero_phiEf11: putative phage protein; HMPREF0347_6826; phage(gi282598716) 4e-106 Click
5complement(1151580..1151780) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6827; phage(gi282598725) 2e-33 Click
6complement(1151822..1152376) PHAGE_Entero_phiEf11: putative phage protein; HMPREF0347_6828; phage(gi282598715) 1e-101 Click
7complement(1152464..1152937) PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6829; phage(gi282598746) 8e-88 Click
8complement(1152954..1153526) PHAGE_Entero_phiEf11: cI-like repressor; HMPREF0347_6830; phage(gi282598745) 4e-106 Click
91153685..1153918 PHAGE_Entero_phiEf11: cro-like repressor; HMPREF0347_6831; phage(gi282598722) 2e-40 Click
101154000..1154719 PHAGE_Entero_phiEf11: antirepressor; HMPREF0347_6832; phage(gi282598719) 3e-136 Click
111154735..1154983 PHAGE_Entero_phiEf11: putative phage excisionase protein; HMPREF0347_6833; phage(gi282598765) 1e-44 Click
121155005..1155178 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6834; phage(gi282598741) 9e-27 Click
131155175..1155300 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6835; phage(gi282598721) 4e-18 Click
141155285..1155440 PHAGE_Entero_phiEf11: hypothetical protein PHIEF11_0042; HMPREF0347_6836; phage(gi282598718) 1e-22 Click
151155497..1155733 PHAGE_Entero_phiEf11: hypothetical protein PHIEF11_0043; HMPREF0347_6837; phage(gi282598707) 4e-38 Click
161155734..1156411 PHAGE_Entero_phiEf11: putative single-strand DNA binding protein; HMPREF0347_6838; phage(gi282598727) 3e-126 Click
171156411..1157334 PHAGE_Entero_phiEf11: putative replication protein; HMPREF0347_6839; phage(gi282598768) 3e-168 Click
181157331..1158011 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6840; phage(gi282598737) 7e-131 Click
191158016..1158972 PHAGE_Entero_phiEf11: putative phage replisome organizer; HMPREF0347_6841; phage(gi282598734) 0.0 Click
201158976..1159500 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6842; phage(gi282598762) 5e-98 Click
211159628..1159855 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6843; phage(gi282598739) 1e-37 Click
221159912..1160376 PHAGE_Entero_phiEf11: putative methyltransferase; HMPREF0347_6844; phage(gi282598709) 1e-84 Click
231160782..1161129 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6845; phage(gi282598710) 8e-63 Click
241161126..1161293 PHAGE_Entero_phiEf11: hypothetical protein PHIEF11_0053; HMPREF0347_6846; phage(gi282598733) 8e-25 Click
251161286..1161891 PHAGE_Entero_phiEf11: asch domain protein; HMPREF0347_6847; phage(gi282598726) 1e-115 Click
261161905..1162390 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6848; phage(gi282598755) 6e-92 Click
271162391..1162573 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6849; phage(gi282598754) 1e-27 Click
281162756..1162956 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6850; phage(gi282598761) 3e-34 Click
291162919..1163038 PHAGE_Entero_phiEf11: hypothetical protein PHIEF11_0059; HMPREF0347_6851; phage(gi282598767) 6e-17 Click
301163101..1163517 PHAGE_Entero_phiEf11: phage autolysin transcriptional regulator ArpU family; HMPREF0347_6852; phage(gi282598742) 3e-72 Click
311163742..1163814 tRNA 0.0 Click
321163981..1164430 PHAGE_Entero_phiEf11: SbcC domain protein; HMPREF0347_6854; phage(gi282598758) 1e-78 Click
331164485..1165006 PHAGE_Entero_phiEf11: ParB-like nuclease domain protein; HMPREF0347_6855; phage(gi282598764) 2e-97 Click
341164993..1165601 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6856; phage(gi282598763) 3e-118 Click
351165738..1165926 PHAGE_Entero_phiEf11: conserved domain protein; HMPREF0347_6857; phage(gi282598729) 3e-29 Click
361165971..1166891 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6858; phage(gi282598759) 3e-172 Click
371166939..1167733 PHAGE_Entero_phiEf11: phage terminase A domain protein; HMPREF0347_6859; phage(gi282598724) 2e-147 Click
381167726..1169180 PHAGE_Entero_phiEf11: putative phage terminase B protein; HMPREF0347_6860; phage(gi282598712) 0.0 Click
391169185..1170798 PHAGE_Entero_phiEf11: phage portal protein; HMPREF0347_6861; phage(gi282598717) 0.0 Click
401170804..1171742 PHAGE_Entero_phiEf11: phage Mu protein F-like protein; HMPREF0347_6862; phage(gi282598757) 2e-178 Click
411171878..1172012 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6863; phage(gi282598771) 3e-18 Click
421172017..1172136 PHAGE_Entero_phiEf11: hypothetical protein PHIEF11_0006; HMPREF0347_6864; phage(gi282598766) 5e-17 Click
431172105..1172383 PHAGE_Entero_phiEf11: putative phage protein; HMPREF0347_6865; phage(gi282598756) 4e-50 Click
441172513..1173154 PHAGE_Entero_phiEf11: putative phage scaffold protein; HMPREF0347_6866; phage(gi282598711) 1e-117 Click
451173167..1173508 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6867; phage(gi282598728) 2e-59 Click
461173531..1174544 PHAGE_Entero_phiEf11: putative head protein; HMPREF0347_6868; phage(gi282598750) 0.0 Click
471174837..1174950 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6869; phage(gi282598735) 2e-15 Click
481174947..1175282 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6870; phage(gi282598747) 2e-59 Click
491175257..1175637 PHAGE_Entero_phiEf11: phage protein HK97; HMPREF0347_6871; phage(gi282598738) 1e-67 Click
501175721..1176023 PHAGE_Entero_phiEf11: putative major structural protein; HMPREF0347_6872; phage(gi282598740) 3e-51 Click
511176039..1176632 PHAGE_Entero_phiEf11: phage major tail protein; HMPREF0347_6873; phage(gi282598708) 6e-109 Click
521176648..1177106 PHAGE_Entero_phiEf11: putative phage major tail protein; HMPREF0347_6874; phage(gi282598736) 8e-82 Click
531177161..1177511 PHAGE_Entero_phiEf11: putative phage protein; HMPREF0347_6875; phage(gi282598743) 9e-61 Click
541177634..1177861 PHAGE_Entero_phiEf11: putative phage protein; HMPREF0347_6876; phage(gi282598753) 1e-37 Click
551177877..1181284 PHAGE_Entero_phiEf11: putative phage tape measure protein; HMPREF0347_6877; phage(gi282598751) 0.0 Click
561181285..1182214 PHAGE_Entero_phiEf11: putative phage tail protein; HMPREF0347_6878; phage(gi282598752) 3e-180 Click
571182231..1184246 PHAGE_Entero_phiEf11: putative phage structural protein; HMPREF0347_6879; phage(gi282598760) 0.0 Click
581184247..1184420 PHAGE_Entero_phiEf11: hypothetical protein PHIEF11_0022; HMPREF0347_6880; phage(gi282598732) 7e-26 Click
591184431..1186194 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6881; phage(gi282598748) 0.0 Click
601186274..1186396 PHAGE_Entero_phiEf11: conserved hypothetical protein; HMPREF0347_6882; phage(gi282598731) 4e-15 Click
611186542..1186694 PHAGE_Entero_phiEf11: phage holin; HMPREF0347_6883; phage(gi282598749) 1e-21 Click
621186699..1187958 PHAGE_Entero_phiEf11: endolysin; HMPREF0347_6884; phage(gi282598713) 0.0 Click
631187971..1188351 PHAGE_Entero_phiEf11: putative phage autolysin regulator; HMPREF0347_6885; phage(gi282598769) 2e-67 Click
641188440..1189705 PHAGE_Entero_phiEf11: putative N-acetylmuramoyl-L-alanine amidase; HMPREF0347_6886; phage(gi282598744) 0.0 Click
65complement(1189769..1191271) PHAGE_Entero_phiEf11: putative membrane protein; HMPREF0347_6887; phage(gi282598720) 0.0 Click
66complement(1191637..1192218) PHAGE_Entero_phiEf11: LysM domain protein; HMPREF0347_6888; phage(gi282598770) 3e-106 Click
671192464..1192490 attR    ACTAAGCAAGTGCCGCCATGTGTCTGA 0.0 Click
68complement(1192589..1192969) PHAGE_Lactoc_ul36: hypothetical protein ul36_02; HMPREF0347_6889; phage(gi21716074) 4e-17 Click

Region 3, total : 52 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11300237..1300249 attL    CACAGATTTACCA 0.0 Click
2complement(1300254..1301402) PHAGE_Clostr_phiC2: putative integrase; HMPREF0347_6986; phage(gi134287379) 1e-32 Click
3complement(1301477..1301806) PHAGE_Lactob_Lj928: hypothetical protein Ljo_1464; HMPREF0347_6987; phage(gi41179289) 5e-19 Click
4complement(1301821..1302585) PHAGE_Entero_phiEf11: LysM domain protein; HMPREF0347_6988; phage(gi282598770) 2e-06 Click
5complement(1302703..1303341) PHAGE_Entero_phiFL4A: hypothetical protein; HMPREF0347_6989; phage(gi281416437) 6e-11 Click
6complement(1303355..1303699) PHAGE_Strept_6: putative repressor; HMPREF0347_6990; phage(gi28876485) 5e-18 Click
71303990..1304181 PHAGE_Strept_MM1: hypothetical protein MM1p05; HMPREF0347_6991; phage(gi15088748) 5e-06 Click
81304193..1304504 conserved hypothetical protein; HMPREF0347_6992 0.0 Click
91304543..1305265 PHAGE_Entero_phiFL1A: anti-repressor protein; HMPREF0347_6993; phage(gi281416331) 5e-47 Click
10complement(1305305..1305487) conserved hypothetical protein; HMPREF0347_6994 0.0 Click
111305540..1305734 PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF0347_6995; phage(gi281416334) 5e-28 Click
121305725..1305910 PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF0347_6996; phage(gi281416335) 8e-25 Click
131305954..1306277 PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF0347_6997; phage(gi281416336) 8e-49 Click
141306277..1306504 PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF0347_6998; phage(gi281416337) 9e-37 Click
151306489..1306605 PHAGE_Entero_phiFL1A: hypothetical protein; HMPREF0347_6999; phage(gi281416338) 8e-14 Click
161306602..1307546 PHAGE_Entero_phiFL1A: endonuclease YqaJ superfamily; HMPREF0347_7000; phage(gi281416339) 3e-179 Click
171307546..1308439 PHAGE_Entero_phiFL1A: RecT family protein; HMPREF0347_7001; phage(gi281416340) 2e-168 Click
181308476..1309477 PHAGE_Entero_phiFL1A: recombinase; HMPREF0347_7002; phage(gi281416341) 1e-111 Click
191309481..1309783 PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF0347_7003; phage(gi281416234) 1e-50 Click
201309784..1310083 PHAGE_Entero_phiFL1A: DNA binding protein; HMPREF0347_7004; phage(gi281416342) 1e-45 Click
211310101..1310526 PHAGE_Entero_phiFL1A: resolvase; HMPREF0347_7005; phage(gi281416343) 1e-73 Click
221311433..1311849 PHAGE_Entero_phiFL1A: transcriptional regulator ArpU family; HMPREF0347_7006; phage(gi281416357) 2e-69 Click
231312234..1312305 tRNA 0.0 Click
241312843..1313076 conserved hypothetical protein; HMPREF0347_7008 0.0 Click
251313220..1313798 PHAGE_Entero_P4: hypothetical protein P4p03; HMPREF0347_7009; phage(gi9627510) 1e-12 Click
26complement(1313836..1314753) PHAGE_Entero_P4: hypothetical protein P4p02; HMPREF0347_7010; phage(gi9627509) 2e-08 Click
271315022..1315825 PHAGE_Entero_phiFL1A: terminase small subunit; HMPREF0347_7011; phage(gi281416361) 3e-103 Click
281315818..1317086 PHAGE_Brocho_NF5: gp2; HMPREF0347_7012; phage(gi327197586) 0.0 Click
291317098..1318585 PHAGE_Deep_s_D6E: portal protein; HMPREF0347_7013; phage(gi423262330) 8e-42 Click
301318560..1320317 PHAGE_Entero_phiFL1A: phage head protein; HMPREF0347_7014; phage(gi281416365) 6e-20 Click
311320326..1320535 conserved hypothetical protein; HMPREF0347_7015 0.0 Click
321320600..1320920 conserved hypothetical protein; HMPREF0347_7016 0.0 Click
331321138..1321761 PHAGE_Strept_5: hypothetical protein SpyM3_1323; HMPREF0347_7017; phage(gi28876405) 3e-06 Click
341321775..1322662 PHAGE_Pseudo_UFV_P2: major head protein; HMPREF0347_7018; phage(gi410491826) 2e-09 Click
351322691..1322873 conserved hypothetical protein; HMPREF0347_7019 0.0 Click
361322887..1323231 conserved hypothetical protein; HMPREF0347_7020 0.0 Click
371323228..1323596 PHAGE_Clostr_CD119: hypothetical protein CDBPCV119_gp11; HMPREF0347_7021; phage(gi90592647) 3e-10 Click
381323589..1323987 PHAGE_Clostr_phiC2: hypothetical protein phiC2p11; HMPREF0347_7022; phage(gi134287346) 6e-06 Click
391323990..1324364 conserved hypothetical protein; HMPREF0347_7023 0.0 Click
401324365..1325213 PHAGE_Cronob_phiES15: putative major tail protein; HMPREF0347_7024; phage(gi401817602) 1e-12 Click
411325266..1325616 conserved domain protein; HMPREF0347_7025 0.0 Click
421325837..1328761 PHAGE_Brocho_NF5: gp14; HMPREF0347_7026; phage(gi327197599) 3e-96 Click
431328751..1329485 PHAGE_Lactob_1: tail protein; HMPREF0347_7027; phage(gi219563208) 3e-16 Click
441329482..1332274 PHAGE_Lactoc_bIL285: endopeptidase; HMPREF0347_7028; phage(gi13095734) 6e-158 Click
451332293..1333174 PHAGE_Lactoc_bIL285: Orf55; HMPREF0347_7029; phage(gi13095735) 4e-18 Click
461333167..1333763 PHAGE_Ralsto_RSL1: unnamed protein product; HMPREF0347_7030; phage(gi189426961) 9e-11 Click
471333760..1334047 PHAGE_Weisse_phiYS61: putative tail fiber protein; HMPREF0347_7031; phage(gi399528395) 4e-09 Click
481334047..1334538 PHAGE_Entero_1: host specificity protein; HMPREF0347_7032; phage(gi225626383) 4e-07 Click
491334552..1334872 conserved hypothetical protein; HMPREF0347_7033 0.0 Click
501334874..1335029 PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp56; HMPREF0347_7034; phage(gi215401226) 1e-05 Click
511335064..1335285 PHAGE_Entero_phiFL3A: hypothetical protein; HMPREF0347_7035; phage(gi281416274) 2e-34 Click
521335278..1335511 PHAGE_Entero_phiFL3A: holin; HMPREF0347_7036; phage(gi281416275) 4e-32 Click
531335512..1336696 PHAGE_Entero_phiFL1A: endolysin; HMPREF0347_7037; phage(gi281416383) 1e-157 Click
541337595..1337795 PHAGE_Lactoc_bIL312: Csp; HMPREF0347_7038; phage(gi13095918) 1e-26 Click
551345472..1345484 attR    CACAGATTTACCA 0.0 Click

Region 4, total : 18 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12205612..2205623 attL    TCGCCACTTTTG 0.0 Click
22211287..2211525 PHAGE_Spirop_R8A2B: putative transposase; HMPREF0347_5642; phage(gi9626114) 5e-05 Click
3complement(2211659..2213062) conserved hypothetical protein; HMPREF0347_5643 0.0 Click
42213261..2213272 attL    AGAAAGCTTTTC 0.0 Click
5complement(2213330..2213929) PHAGE_Strept_1: site-specific recombinase; HMPREF0347_5644; phage(gi28876169) 3e-28 Click
62214455..2215393 2-dehydropantoate 2-reductase; HMPREF0347_5645 0.0 Click
72215419..2216456 PHAGE_Lactob_KC5a: putative minor tail protein; HMPREF0347_5646; phage(gi90592623) 3e-11 Click
8complement(2216902..2217738) PHAGE_Lactob_phiAT3: putative transposase B; HMPREF0347_5647; phage(gi48697274) 4e-32 Click
9complement(2217774..2218064) PHAGE_Lactob_phiAT3: putative transposase A; HMPREF0347_5648; phage(gi48697273) 3e-07 Click
10complement(2218133..2218789) zeta toxin; HMPREF0347_5649 0.0 Click
11complement(2218791..2219063) epsilon-antitoxin; HMPREF0347_5650 0.0 Click
12complement(2219080..2219289) omega transcriptional repressor; HMPREF0347_5651 0.0 Click
132219347..2219358 attL    TGATTTGTGATT 0.0 Click
14complement(2219359..2220213) PHAGE_Entero_EF62phi: chromosome partitioning ATPase; HMPREF0347_5652; phage(gi384519759) 5e-25 Click
152220321..2220611 PHAGE_Lactob_phiAT3: putative transposase A; HMPREF0347_5653; phage(gi48697273) 8e-07 Click
162220647..2221483 PHAGE_Lactob_phiAT3: putative transposase B; HMPREF0347_5654; phage(gi48697274) 6e-31 Click
172221652..2221663 attR    TGATTTGTGATT 0.0 Click
18complement(2221699..2223417) PHAGE_Cafete_BV_PW1: putative DNA topoisomerase IA; HMPREF0347_5656; phage(gi310831073) 4e-20 Click
192223339..2224142 PHAGE_Entero_EF62phi: chromosome partitioning ATPase; HMPREF0347_5655; phage(gi384519759) 1e-30 Click
202224144..2224515 conserved hypothetical protein; HMPREF0347_5657 0.0 Click
212224801..2225790 PHAGE_Spirop_R8A2B: putative transposase; HMPREF0347_5658; phage(gi9626114) 1e-22 Click
222225963..2226340 PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p118; HMPREF0347_5659; phage(gi9630243) 6e-15 Click
232231362..2231373 attR    AGAAAGCTTTTC 0.0 Click
242237468..2237479 attR    TCGCCACTTTTG 0.0 Click