Ruminococcus flavefaciens FD-1 .1.2.118, whole genome [asmbl_id: NC_000000].4573608, GC%: 45.02%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 49 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11195286..1196215 PHAGE_Lactoc_P087: putative cysteine synthase; PP_01110; phage(gi229605000) 4e-70 Click
21196601..1196642 attL    TTATTCGATCCCTGCCTGCTGTTTAGCAGCTGTGAGGGTATT 0.0 Click
3complement(1196691..1197845) PHAGE_Temper_1: integrase-like protein; PP_01111; phage(gi16271777) 3e-22 Click
4complement(1197913..1198401) PHAGE_Clostr_phiCD38_2: hypothetical protein; PP_01112; phage(gi333798122) 8e-12 Click
5complement(1198414..1199388) PHAGE_Strept_PH15: putative transcriptional repressor; PP_01113; phage(gi190151419) 2e-10 Click
61199575..1199784 PHAGE_Clostr_phiMMP02: phage repressor, XRE family; PP_01114; phage(gi414090411) 8e-06 Click
71199805..1200011 DNA-binding protein, excisionase family [Desulfomonile tiedjei DSM 6799] gi|392413687|ref|YP_006450294.1|; PP_01115 5e-05 Click
81200008..1200250 hypothetical; PP_01116 0.0 Click
91200256..1200681 hypothetical; PP_01117 0.0 Click
101200681..1200929 hypothetical; PP_01118 0.0 Click
111200926..1201222 hypothetical; PP_01119 0.0 Click
121201300..1201515 hypothetical; PP_01120 0.0 Click
131201505..1201834 hypothetical; PP_01121 0.0 Click
141201844..1203160 PHAGE_Strept_3: hypothetical protein SpyM3_1130; PP_01122; phage(gi28876300) 1e-20 Click
151203157..1203450 hypothetical; PP_01123 0.0 Click
161203482..1204246 PHAGE_Lactob_LP65: hypothetical protein LP65_gp070; PP_01124; phage(gi56693118) 3e-07 Click
171204249..1205541 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp13; PP_01125; phage(gi56694881) 6e-160 Click
181205556..1206674 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp14; PP_01126; phage(gi56694882) 5e-64 Click
191206688..1207281 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp15; PP_01127; phage(gi56694883) 3e-28 Click
201207306..1208895 PHAGE_Bacill_BCJA1c: DEAD box family helicase; PP_01128; phage(gi56694884) 0.0 Click
211208897..1211128 PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp22; PP_01129; phage(gi56694890) 0.0 Click
221211277..1211681 PHAGE_Bacill_BCJA1c: rus; PP_01130; phage(gi56694892) 7e-30 Click
231211678..1211812 hypothetical; PP_01131 0.0 Click
241211799..1212008 hypothetical; PP_01132 0.0 Click
251211995..1212174 hypothetical; PP_01133 0.0 Click
261212180..1212434 hypothetical; PP_01134 0.0 Click
271212427..1212753 hypothetical; PP_01135 0.0 Click
281212753..1212974 hypothetical; PP_01136 0.0 Click
291212980..1213135 hypothetical; PP_01137 0.0 Click
301213107..1213490 hypothetical; PP_01138 0.0 Click
311213672..1213746 tRNA 0.0 Click
321213835..1214290 PHAGE_Strept_6: putative terminase small subunit; PP_01139; phage(gi28876466) 1e-19 Click
331214293..1215558 PHAGE_Deep_s_D6E: large subunit terminase; PP_01140; phage(gi423262329) 4e-101 Click
341215627..1216937 PHAGE_Clostr_phiCD38_2: minor capsid protein; PP_01141; phage(gi333798110) 1e-87 Click
351216915..1218579 PHAGE_Clostr_phiCD38_2: minor capsid protein; PP_01142; phage(gi333798111) 4e-59 Click
361218569..1218778 hypothetical; PP_01143 0.0 Click
371218831..1219061 hypothetical; PP_01144 0.0 Click
381219144..1219680 PHAGE_Clostr_phiCD38_2: scaffolding protein; PP_01145; phage(gi333798113) 5e-13 Click
391219696..1220586 PHAGE_Clostr_CD119: putative capsid protein; PP_01146; phage(gi90592716) 6e-28 Click
401220704..1221126 PHAGE_Lister_A500: gp8; PP_01147; phage(gi157324968) 2e-05 Click
411221126..1221473 hypothetical; PP_01148 0.0 Click
421221470..1221829 PHAGE_Clostr_phiCD38_2: hypothetical protein; PP_01149; phage(gi333798117) 4e-10 Click
431221826..1222245 PHAGE_Clostr_phiCD38_2: hypothetical protein; PP_01150; phage(gi333798118) 8e-29 Click
441222249..1222746 hypothetical protein Clole_0826 [Clostridium lentocellum DSM 5427] gi|326789936|ref|YP_004307757.1|; PP_01151 7e-34 Click
451222747..1222860 hypothetical; PP_01152 0.0 Click
461222865..1223263 PHAGE_Clostr_phiCD38_2: hypothetical protein; PP_01153; phage(gi333798120) 6e-09 Click
471223260..1223841 PHAGE_Clostr_phiCD38_2: hypothetical protein; PP_01154; phage(gi333798121) 4e-19 Click
481223838..1224014 hypothetical; PP_01155 0.0 Click
491224057..1227752 PHAGE_Clostr_phiCP26F: phage tail tape measure protein; PP_01156; phage(gi422933964) 2e-52 Click
501227749..1228453 hypothetical protein TEH_17990 [Tetragenococcus halophilus NBRC 12172] gi|352517973|ref|YP_004887290.1|; PP_01157 6e-16 Click
511228453..1230291 PHAGE_Clostr_phi8074_B1: putative phage tail protein; PP_01158; phage(gi431810378) 6e-26 Click
521233246..1233287 attR    TTATTCGATCCCTGCCTGCTGTTTAGCAGCTGTGAGGGTATT 0.0 Click

Region 2, total : 21 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
12072114..2072125 attL    TTTTCTTTCAAA 0.0 Click
2complement(2074091..2075209) PHAGE_Clostr_CD119: putative integrase; PP_01935; phage(gi90592679) 2e-25 Click
3complement(2075292..2075702) PHAGE_Bacill_IEBH: helix-turn-helix domain protein; PP_01936; phage(gi197261593) 5e-11 Click
42075864..2075875 attR    TTTTCTTTCAAA 0.0 Click
52075951..2076151 hypothetical; PP_01937 0.0 Click
62076186..2076197 attL    GAAAGGACTGAA 0.0 Click
72076202..2076405 hypothetical; PP_01938 0.0 Click
82076408..2076803 hypothetical; PP_01939 0.0 Click
92076850..2077044 hypothetical; PP_01940 0.0 Click
102077059..2077244 hypothetical; PP_01941 0.0 Click
112077348..2077674 hypothetical; PP_01942 0.0 Click
122077671..2077793 hypothetical; PP_01943 0.0 Click
132077810..2079063 PHAGE_Deep_s_D6E: recombinase; PP_01944; phage(gi423262352) 5e-26 Click
14complement(2079280..2079624) hypothetical protein RHOM_15575 [Roseburia hominis A2-183] gi|347533390|ref|YP_004840153.1|; PP_01945 1e-40 Click
152079765..2079932 PROPHAGE_Clostr_E88: putative transposase; PP_01946; phage(gi28211552) 3e-13 Click
162079995..2080684 PHAGE_Feldma_virus: putative sensor histidine kinase; PP_01947; phage(gi197322366) 1e-08 Click
172080681..2081709 PHAGE_Ectoca_1: EsV-1-65; PP_01948; phage(gi13242537) 9e-15 Click
182081887..2082552 PHAGE_Plankt_PaV_LD: ABC transporter; PP_01949; phage(gi371496158) 3e-36 Click
192082567..2084981 permease [Eubacterium limosum KIST612] gi|310829312|ref|YP_003961669.1|; PP_01950 9e-69 Click
202085595..2086035 hypothetical protein SmuNN2025_0889 [Streptococcus mutans NN2025] gi|290580415|ref|YP_003484807.1|; PP_01951 6e-20 Click
212086276..2086605 hypothetical; PP_01952 0.0 Click
222086622..2087107 hypothetical; PP_01953 0.0 Click
232087111..2087299 hypothetical protein Rumal_3520 [Ruminococcus albus 7] gi|317133939|ref|YP_004089850.1|; PP_01954 1e-24 Click
242087421..2088974 PHAGE_Deep_s_D6E: recombinase; PP_01955; phage(gi423262352) 9e-25 Click
252097981..2097992 attR    GAAAGGACTGAA 0.0 Click

Region 3, total : 26 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13086998..3087459 PHAGE_Amsact_: hypothetical protein AMV072; PP_02886; phage(gi9964386) 8e-05 Click
23087456..3087659 (NiFe) hydrogenase maturation protein HypF [Clostridium cellulovorans 743B] gi|302876774|ref|YP_003845407.1|; PP_02887 1e-11 Click
33087903..3088256 antirestriction protein (ArdA) [Filifactor alocis ATCC 35896] gi|374307703|ref|YP_005054134.1|; PP_02888 7e-18 Click
43088415..3088759 hypothetical; PP_02889 0.0 Click
53088956..3089195 hypothetical protein btf_209 [Dehalococcoides mccartyi BTF08] gi|452204531|ref|YP_007484660.1|; PP_02890 8e-16 Click
63089250..3090251 PHAGE_Mycoba_244: gp9; PP_02891; phage(gi109302762) 2e-55 Click
7complement(3090252..3090377) hypothetical; PP_02893 0.0 Click
83090414..3090851 PHAGE_Geobac_E2: putative terminase large subunit; PP_02892; phage(gi148747729) 4e-21 Click
9complement(3090879..3090998) hypothetical; PP_02894 0.0 Click
103091361..3092383 PHAGE_Entero_phiP27: putative portal protein; PP_02895; phage(gi18249902) 3e-53 Click
113092389..3092607 PHAGE_Yersin_PY54: portal protein; PP_02896; phage(gi33770511) 2e-05 Click
123092604..3093356 PHAGE_Geobac_E2: putative Clp peptidase; PP_02897; phage(gi148747731) 4e-47 Click
133093372..3094577 PHAGE_Salmon_ST64B: Major capsid protein precursor; PP_02898; phage(gi23505451) 1e-36 Click
143094574..3094846 phage protein [Ethanoligenens harbinense YUAN-3] gi|317132780|ref|YP_004092094.1|; PP_02899 4e-15 Click
153094846..3095199 PHAGE_Geobac_E2: putative head-tail adaptor; PP_02900; phage(gi148747735) 1e-06 Click
163095204..3095554 PHAGE_Geobac_E2: hypothetical protein GBVE2_gp010; PP_02901; phage(gi148747737) 2e-15 Click
173095551..3095868 PHAGE_Geobac_E2: hypothetical protein GBVE2_gp011; PP_02902; phage(gi148747738) 2e-13 Click
183095871..3096509 PHAGE_Geobac_E2: putative major capsid protein; PP_02903; phage(gi148747739) 1e-29 Click
193096521..3096901 PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp27; PP_02904; phage(gi115334637) 1e-11 Click
203096928..3097065 hypothetical protein Ethha_1845 [Ethanoligenens harbinense YUAN-3] gi|317132786|ref|YP_004092100.1|; PP_02905 1e-06 Click
213097349..3097639 hypothetical; PP_02906 0.0 Click
223097722..3102056 PHAGE_Staphy_phi13: tail length tape measure protein; PP_02907; phage(gi29028708) 5e-136 Click
23complement(3102060..3102761) hypothetical; PP_02908 0.0 Click
24complement(3102764..3103204) hypothetical protein Lebu_1441 [Leptotrichia buccalis C-1013-b] gi|257126194|ref|YP_003164308.1|; PP_02909 5e-06 Click
253103289..3104146 PHAGE_Clostr_phiCD6356: putative phage tail protein; PP_02910; phage(gi326536863) 5e-17 Click
263104148..3105260 PHAGE_Entero_phiFL4A: hypothetical protein; PP_02911; phage(gi281416484) 4e-21 Click

Region 4, total : 8 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13101001..3101012 attL    CTTGCTGAGAAA 0.0 Click
23105264..3106643 PHAGE_Clostr_phiCD6356: truncated putative phage structural protein; PP_02912; phage(gi326536865) 1e-13 Click
33106643..3107716 PHAGE_Pseudo_1: virion structural protein; PP_02913; phage(gi189490385) 2e-07 Click
43107713..3108384 hypothetical; PP_02914 0.0 Click
53108381..3108812 PHAGE_Bacill_PBC1: holin; PP_02915; phage(gi389060343) 1e-19 Click
63108826..3109536 PHAGE_Clostr_phiSM101: autolytic lysozyme; PP_02916; phage(gi110804057) 1e-12 Click
73110080..3110307 transposon Tn916 excisionase [Acidaminococcus fermentans DSM 20731] gi|284048466|ref|YP_003398805.1|; PP_02917 8e-06 Click
83110260..3110271 attR    CTTGCTGAGAAA 0.0 Click
93110285..3110494 hypothetical; PP_02918 0.0 Click
103110494..3111741 PHAGE_Staphy_PT1028: ORF002; PP_02919; phage(gi66395166) 3e-19 Click