Silicibacter lacuscaerulensis ITI-1157 whole [asmbl_id: NC_000000].3515866, GC%: 62.97%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 16 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1782362..782411 attL    GCGGAATCATAATCCGCGTGTCGGGGGTTCAAGTCCCTCCTCCGCTACCA 0.0 Click
2complement(785185..786936) PHAGE_Campyl_NCTC12673: possible methylase; PP_00778; phage(gi332672404) 1e-24 Click
3787128..787331 bacteriophage transcriptional regulator [Mannheimia haemolytica USDA-ARS-USMARC-183] gi|472334025|ref|YP_007666300.1|; PP_00779 3e-05 Click
4complement(787365..788558) MobA/MobL protein [Rhodopseudomonas palustris BisB5] gi|91978402|ref|YP_571061.1|; PP_00780 8e-19 Click
5complement(788932..789708) PHAGE_Rhizob_3: p101; PP_00781; phage(gi195546631) 4e-10 Click
6complement(790167..791549) PROPHAGE_Mesorh_MAFF303099: phage integrase; PP_00782; phage(gi13473443) 1e-13 Click
7791801..791850 attR    GCGGAATCATAATCCGCGTGTCGGGGGTTCAAGTCCCTCCTCCGCTACCA 0.0 Click
8792019..792408 PHAGE_Entero_4795: putative transposase OrfA protein of IS629; PP_00783; phage(gi157166066) 1e-19 Click
9792516..792734 PROPHAGE_Xantho_306: transposase; PP_00784; phage(gi21243165) 3e-08 Click
10792707..793363 PHAGE_Burkho_phiE125: ISBt3 transposase subunit protein; PP_00785; phage(gi17975200) 2e-78 Click
11793818..794366 PHAGE_Strept_1: site-specific recombinase; PP_00786; phage(gi28876169) 4e-11 Click
12794465..794737 hypothetical; PP_00787 0.0 Click
13794913..795410 PHAGE_Entero_mEp213: head maturation protease; PP_00788; phage(gi428782594) 8e-09 Click
14795410..795631 hypothetical protein Rvan_2774 [Rhodomicrobium vannielii ATCC 17100] gi|312115487|ref|YP_004013083.1|; PP_00789 1e-13 Click
15795633..795962 PHAGE_Entero_mEp213: hypothetical protein; PP_00790; phage(gi428782595) 4e-08 Click
16796099..796215 hypothetical protein Dshi_0989 [Dinoroseobacter shibae DFL 12] gi|159043538|ref|YP_001532332.1|; PP_00791 4e-06 Click
17796216..797337 PHAGE_Azospi_Cd: integrase; PP_00792; phage(gi168495175) 2e-36 Click
18797483..797495 attL    TTTTCTAAATATT 0.0 Click
19797597..798967 PROPHAGE_Escher_CFT073: P4 family integrase; PP_00793; phage(gi26248244) 2e-16 Click
20805046..805058 attR    TTTTCTAAATATT 0.0 Click

Region 2, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
11995023..1997113 PHAGE_Loktan_pCB2051_A: tail length tape measure protein; PP_02028; phage(gi472341411) 2e-17 Click
21997551..1997784 hypothetical; PP_02029 0.0 Click
31997781..1998368 PHAGE_Rhodob_RcapNL: hypothetical protein; PP_02030; phage(gi461474978) 3e-41 Click
41998365..1998787 PHAGE_Rhodob_RcapNL: hypothetical protein; PP_02031; phage(gi461474979) 2e-18 Click
51998777..2000888 PHAGE_Rhodob_RcapNL: phage tail component protein; PP_02032; phage(gi461474981) 6e-115 Click
62000133..2000888 PHAGE_Rhodob_RcapNL: phage tail component protein; PP_02033; phage(gi461474981) 2e-43 Click
72000901..2002226 PHAGE_Synech_S_SSM7: fiber; PP_02034; phage(gi326783687) 4e-07 Click
82002226..2002381 hypothetical; PP_02035 0.0 Click
92002381..2002713 hypothetical; PP_02036 0.0 Click
102002713..2003051 PHAGE_Synech_S_ShM2: hypothetical protein; PP_02037; phage(gi326782379) 8e-12 Click
112003063..2003275 hypothetical; PP_02038 0.0 Click
122003272..2003817 hypothetical; PP_02039 0.0 Click
132003819..2004505 PHAGE_Sulfit_pCB2047_C: secretion activator protein; PP_02040; phage(gi472341758) 8e-34 Click
142004502..2004699 hypothetical; PP_02041 0.0 Click
152004699..2005067 PHAGE_Sulfit_pCB2047_C: hypothetical protein; PP_02042; phage(gi472341760) 9e-32 Click
162005064..2005363 PHAGE_Roseob_1: hypothetical protein RDJLphi1_gp31; PP_02043; phage(gi331028085) 1e-11 Click
172005408..2005917 PHAGE_Burkho_DC1: major capsid protein; PP_02044; phage(gi401723065) 2e-06 Click
182006148..2006483 hypothetical; PP_02045 0.0 Click
192006494..2007936 PHAGE_Human__2: EBNA-1; PP_02046; phage(gi139424506) 1e-35 Click
202007936..2008256 hypothetical protein Bcell_2109 [Bacillus cellulosilyticus DSM 2522] gi|317128819|ref|YP_004095101.1|; PP_02047 2e-08 Click
21complement(2008981..2009778) putative high-affinity zinc uptake system membrane protein [Dinoroseobacter shibae DFL 12] gi|159044250|ref|YP_001533044.1|; PP_02048 9e-117 Click
22complement(2009778..2010518) PHAGE_Plankt_PaV_LD: ABC transporter; PP_02049; phage(gi371496158) 2e-15 Click

Region 3, total : 24 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
1complement(2757878..2759128) PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; PP_02839; phage(gi310831360) 6e-42 Click
2complement(2760349..2760504) hypothetical; PP_02841 0.0 Click
32760544..2761722 PHAGE_Strept_6: terminase large subunit; PP_02840; phage(gi93007440) 5e-63 Click
4complement(2761723..2762565) PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; PP_02842; phage(gi116326757) 6e-05 Click
52762758..2763930 PHAGE_Strept_6: portal protein; PP_02843; phage(gi93007441) 4e-22 Click
62763923..2764147 hypothetical protein SPO2263 [Ruegeria pomeroyi DSS-3] gi|56697125|ref|YP_167488.1|; PP_02844 3e-27 Click
72764174..2764719 PHAGE_Tetras_SI1: phage prohead protease; PP_02845; phage(gi472342256) 2e-26 Click
82764754..2765932 PHAGE_Azospi_Cd: Phage major capsid protein; PP_02846; phage(gi168495136) 5e-68 Click
92766110..2766709 PHAGE_Rhizob_3: p008; PP_02847; phage(gi195546539) 8e-05 Click
102766706..2767044 PHAGE_Geobac_E2: putative head-tail adaptor; PP_02848; phage(gi148747735) 5e-05 Click
112767041..2767454 hypothetical protein SPO2258 [Ruegeria pomeroyi DSS-3] gi|56697120|ref|YP_167483.1|; PP_02849 2e-53 Click
122767475..2767888 PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; PP_02850; phage(gi461474972) 2e-19 Click
132767888..2768208 hypothetical protein SPO2256 [Ruegeria pomeroyi DSS-3] gi|56697118|ref|YP_167481.1|; PP_02851 3e-42 Click
142768205..2768423 hypothetical protein SPO2255 [Ruegeria pomeroyi DSS-3] gi|56697117|ref|YP_167480.1|; PP_02852 6e-22 Click
152768401..2769063 PHAGE_Entero_2009a: putative bacteriophage tail tape measure protein; PP_02853; phage(gi225220098) 9e-19 Click
162769079..2769711 PHAGE_Roseob_1: putative glycoside hydrolase; PP_02854; phage(gi331028135) 2e-45 Click
172769711..2770598 PHAGE_Tetras_SI1: hypothetical protein; PP_02855; phage(gi472342235) 6e-35 Click
182770595..2771041 PHAGE_Roseob_1: phage cell wall peptidase; PP_02856; phage(gi331028137) 3e-26 Click
192771041..2775003 PHAGE_Tetras_SI1: hypothetical protein; PP_02857; phage(gi472342233) 4e-32 Click
202775011..2775307 hypothetical protein SPO2249 [Ruegeria pomeroyi DSS-3] gi|56697112|ref|YP_167475.1|; PP_02858 2e-30 Click
21complement(2775288..2775626) dnaK suppressor protein [Ruegeria pomeroyi DSS-3] gi|56697111|ref|YP_167474.1|; PP_02859 2e-32 Click
222775713..2776522 serine O-acetyltransferase [Ruegeria pomeroyi DSS-3] gi|56697110|ref|YP_167473.1|; PP_02860 2e-131 Click
23complement(2776591..2777904) PHAGE_Macaci_1: large tegument protein; PP_02861; phage(gi30984464) 3e-08 Click
24complement(2777919..2779298) PHAGE_Synech_S_SM2: transketolase central region-containing protein; PP_02862; phage(gi326781943) 3e-09 Click