Citreicella sp. SE45 whole genome shotgun [asmbl_id: NC_000000].5507140, GC%: 67.48%



Text file for download

            Hits against Virus and prophage DB
             Hits against Bacterial DB or GenBank file

Region 1, total : 9 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13383640..3383693 attL    ATGTAGCGTGACGCTCAAACTTGCAGTGATTTACGGCGAAGTTTACAGCAACGC 0.0 Click
2complement(3384752..3386584) PHAGE_Entero_epsilon15: tail fiber; PP_03359; phage(gi30387399) 2e-09 Click
3complement(3386594..3389137) PHAGE_Rhodov_RS1: tail fiber protein; PP_03360; phage(gi472342928) 2e-149 Click
4complement(3389156..3391261) PHAGE_Rhodov_RS1: integrase; PP_03361; phage(gi472342882) 2e-28 Click
5complement(3391254..3392147) PHAGE_Rhodob_RcapMu: ParB-like nuclease; PP_03362; phage(gi356870851) 1e-16 Click
6complement(3392140..3392301) hypothetical; PP_03363 0.0 Click
7complement(3392313..3392603) PHAGE_Rhodov_RS1: hypothetical protein; PP_03365; phage(gi472342880) 6e-07 Click
83392619..3392849 hypothetical; PP_03364 0.0 Click
93393683..3393952 PHAGE_Pseudo_vB_PaeS_PMG1: cI repressor protein; PP_03366; phage(gi374531715) 5e-05 Click
103394225..3395244 PROPHAGE_Shewan_MR-1: IS110 family transposase; PP_03367; phage(gi24375433) 1e-55 Click
113403008..3403061 attR    ATGTAGCGTGACGCTCAAACTTGCAGTGATTTACGGCGAAGTTTACAGCAACGC 0.0 Click

Region 2, total : 22 CDS.
#CDS_POSITIONBLAST_HITE-VALUESEQUENCE
13573393..3574715 PHAGE_Rhodoc_RRH1: caudovirus prohead protease family protein; PP_03533; phage(gi372449807) 7e-05 Click
23574930..3576117 Putative permease of the major facilitator superfamily MFS1 [Sphingomonas sp. MM-1] gi|470215271|ref|YP_007617633.1|; PP_03534 2e-100 Click
33576069..3576245 hypothetical; PP_03535 0.0 Click
4complement(3576212..3577030) serine O-acetyltransferase [Rhodobacter capsulatus SB 1003] gi|294677237|ref|YP_003577852.1|; PP_03536 3e-117 Click
5complement(3577186..3577566) hypothetical protein SPO2249 [Ruegeria pomeroyi DSS-3] gi|56697112|ref|YP_167475.1|; PP_03537 2e-12 Click
6complement(3577563..3581468) PHAGE_Tetras_SI1: hypothetical protein; PP_03538; phage(gi472342233) 3e-32 Click
7complement(3581468..3581908) PHAGE_Roseob_1: phage cell wall peptidase; PP_03539; phage(gi331028137) 1e-27 Click
8complement(3581901..3582788) PHAGE_Tetras_SI1: hypothetical protein; PP_03540; phage(gi472342235) 3e-25 Click
9complement(3582788..3583420) PHAGE_Roseob_1: putative glycoside hydrolase; PP_03541; phage(gi331028135) 5e-48 Click
10complement(3583431..3584093) PHAGE_Vibrio_vB_VpaS_MAR10: tail tape measure protein; PP_03542; phage(gi428782128) 6e-18 Click
11complement(3584090..3584290) hypothetical protein SPO2255 [Ruegeria pomeroyi DSS-3] gi|56697117|ref|YP_167480.1|; PP_03543 1e-16 Click
12complement(3584290..3584586) hypothetical protein SPO2256 [Ruegeria pomeroyi DSS-3] gi|56697118|ref|YP_167481.1|; PP_03544 5e-31 Click
13complement(3584610..3585032) PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; PP_03545; phage(gi461474972) 2e-19 Click
14complement(3585058..3585465) PHAGE_Strept_phiSASD1: gp33; PP_03546; phage(gi298103498) 6e-07 Click
15complement(3585462..3585800) head-tail adaptor [Ruegeria pomeroyi DSS-3] gi|56697121|ref|YP_167484.1|; PP_03548 4e-26 Click
16complement(3585797..3586387) PHAGE_Rhodob_RcapNL: hypothetical protein; PP_03547; phage(gi461474967) 3e-08 Click
17complement(3586553..3587638) PHAGE_Entero_phiP27: putative major capsid protein; PP_03549; phage(gi18249904) 1e-67 Click
18complement(3587768..3588310) PHAGE_Tetras_SI1: phage prohead protease; PP_03550; phage(gi472342256) 1e-25 Click
19complement(3588334..3588561) hypothetical protein PGA2_c17540 [Phaeobacter gallaeciensis 2.10] gi|400754628|ref|YP_006562996.1|; PP_03551 1e-17 Click
20complement(3588554..3589744) PHAGE_Marino_P12026: phage portal protein, HK97 family; PP_03552; phage(gi399528319) 2e-21 Click
213589983..3590465 N-acetyltransferase GCN5 [Rhodopseudomonas palustris TIE-1] gi|192290601|ref|YP_001991206.1|; PP_03553 2e-24 Click
22complement(3590515..3591744) PHAGE_Strept_6: terminase large subunit; PP_03554; phage(gi93007440) 1e-59 Click